GGRNA Home | Help | Advanced search

2020-10-24 06:20:02, GGRNA : RefSeq release 60 (20130726)

LOCUS       XM_003403858            1341 bp    mRNA    linear   PRI 30-OCT-2012
DEFINITION  PREDICTED: Homo sapiens patatin-like phospholipase domain
            containing 2 (PNPLA2), partial mRNA.
ACCESSION   XM_003403858
VERSION     XM_003403858.1  GI:341914943
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_001842195) annotated using gene prediction method: GNOMON,
            supported by EST evidence.
            Also see:
                Documentation of NCBI's Annotation Process
            
            COMPLETENESS: incomplete on the 3' end.
            ##Genome-Annotation-Data-START##
            Annotation Provider :: NCBI
            Annotation Status   :: Full annotation
            Annotation Version  :: Homo sapiens Annotation Release 104
            Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline
            Annotation Method   :: Best-placed RefSeq; Gnomon
            Features Annotated  :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1341
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="Unknown"
                     /sex="male"
                     /dev_stage="adult"
     gene            1..>1341
                     /gene="PNPLA2"
                     /note="Derived by automated computational analysis using
                     gene prediction method: GNOMON. Supporting evidence
                     includes similarity to: 36 ESTs, 8 Proteins"
                     /db_xref="GeneID:57104"
                     /db_xref="HGNC:30802"
                     /db_xref="MIM:609059"
     CDS             1..>1341
                     /gene="PNPLA2"
                     /codon_start=1
                     /product="patatin-like phospholipase domain containing 2"
                     /protein_id="XP_003403906.1"
                     /db_xref="GI:341914944"
                     /db_xref="GeneID:57104"
                     /db_xref="HGNC:30802"
                     /db_xref="MIM:609059"
                     /translation="
MGFVGLPHPRTAGSGQVGEAGAKFIEVSKEARKRFLGPLHPSFNLVKIIRSFLLKVLPADSHEHASGRLGISLTRVSDGENVIISHFNSKDELIQANVCSGFIPVYCGLIPPSLQGVRYVDGGISDNLPLYELKNTITVSPFSGESDICPQDSSTNIHELRVTNTSIQFNLRNLYRLSKALFPPEPLVLREMCKQGYRDGLRFLQRNGLLNRPNPLLALPPARPHGPEDKDQAVESAQAEDYSQLPGEDHILEHLPARLNEALLEACVEPTDLLTTLSNMLPVRLATAMMVPYTLPLESALSFTIRLLEWLPDVPEDIRWMKEQTGSICQYLVMRAKRKLGRHLPSRLPEQVELRRVQSLPSVPLSCAAYREALPGWMRNNLSLGDALAKWEECQRQLLLGLFCTNVAFPPEALRMRAPADPAPAPADPASPQHQPAGPAPLLSTPA
"
     misc_feature    <49..621
                     /gene="PNPLA2"
                     /note="Patatins and Phospholipases; Region:
                     Patatin_and_cPLA2; cl11396"
                     /db_xref="CDD:209300"
     variation       28
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141990864"
     variation       29
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370418255"
     STS             69..168
                     /gene="PNPLA2"
                     /standard_name="A009K14"
                     /db_xref="UniSTS:59101"
     STS             69..168
                     /gene="PNPLA2"
                     /standard_name="G32609"
                     /db_xref="UniSTS:117192"
     variation       95
                     /gene="PNPLA2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373487598"
     variation       100
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371871714"
     variation       101
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139576982"
     variation       111
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200701730"
     variation       115
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149334466"
     variation       148
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143443756"
     variation       156
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370529626"
     variation       182
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147988588"
     variation       191
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200683247"
     variation       203
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145999340"
     variation       225
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141674273"
     variation       234
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142174851"
     variation       235
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377534825"
     variation       237
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140052906"
     variation       257
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139202485"
     variation       264
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143992505"
     variation       273
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371125971"
     variation       274
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375693983"
     variation       312
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61740111"
     variation       332
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200260812"
     variation       357
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147314508"
     variation       362
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121908832"
     variation       392
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141014055"
     variation       429
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149864883"
     variation       449
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121918259"
     variation       450
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:111788298"
     variation       456
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200897893"
     variation       472
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370727999"
     variation       474
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199847643"
     variation       481
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145699347"
     variation       504
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370223018"
     variation       520
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140612115"
     variation       524..525
                     /gene="PNPLA2"
                     /replace=""
                     /replace="cccccccccc"
                     /db_xref="dbSNP:146660461"
     variation       543
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:10902224"
     variation       552
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371893260"
     variation       562
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142852995"
     variation       567
                     /gene="PNPLA2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146584016"
     variation       591
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144220751"
     variation       597
                     /gene="PNPLA2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:145966476"
     variation       612
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140959695"
     variation       621
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:140201358"
     variation       628
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372502231"
     variation       643
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145910728"
     variation       658
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56152088"
     variation       664
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199992922"
     variation       671
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201894536"
     variation       680
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200993304"
     variation       709
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146739862"
     variation       716
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369213107"
     variation       724
                     /gene="PNPLA2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373510143"
     variation       728
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200088893"
     variation       730
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121918260"
     variation       738
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1135628"
     variation       754
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368987427"
     variation       762
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376781834"
     variation       768
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141190104"
     variation       783
                     /gene="PNPLA2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201065998"
     variation       808
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150385364"
     variation       829
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137866968"
     variation       875
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370723127"
     variation       897
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373862598"
     variation       906
                     /gene="PNPLA2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374131475"
ORIGIN      
atgggttttgtgggtctgccccatccccgcactgctggatctggccaagtgggtgaggctggtgccaagttcattgaggtatctaaagaggcccggaagcggttcctgggccccctgcacccctccttcaacctggtaaagatcatccgcagtttcctgctgaaggtcctgcctgctgatagccatgagcatgccagtgggcgcctgggcatctccctgacccgcgtgtcagacggcgagaatgtcattatatcccacttcaactccaaggacgagctcatccaggccaatgtctgcagcggtttcatccccgtgtactgtgggctcatccctccctccctccagggggtgcgctacgtggatggtggcatttcagacaacctgccactctatgagcttaagaacaccatcacagtgtcccccttctcgggcgagagtgacatctgtccgcaggacagctccaccaacatccacgagctgcgggtcaccaacaccagcatccagttcaacctgcgcaacctctaccgcctctccaaggccctcttcccgccggagcccctggtgctgcgagagatgtgcaagcagggataccgggatggcctgcgctttctgcagcggaacggcctcctgaaccggcccaaccccttgctggcgttgccccccgcccgcccccacggcccagaggacaaggaccaggcagtggagagcgcccaagcggaggattactcgcagctgcccggagaagatcacatcctggagcacctgcccgcccggctcaatgaggccctgctggaggcctgcgtggagcccacggacctgctgaccaccctctccaacatgctgcctgtgcgtctggccacggccatgatggtgccctacacgctgccgctggagagcgctctgtccttcaccatccgcttgctggagtggctgcccgacgttcccgaggacatccggtggatgaaggagcagacgggcagcatctgccagtacctggtgatgcgcgccaagaggaagctgggcaggcacctgccctccaggctgccggagcaggtggagctgcgccgcgtccagtcgctgccgtccgtgccgctgtcctgcgccgcctacagagaggcactgcccggctggatgcgcaacaacctctcgctgggggacgcgctggccaagtgggaggagtgccagcgccagctgctgctcggcctcttctgcaccaacgtggccttcccgcccgaagctctgcgcatgcgcgcacccgccgacccggctcccgcccccgcggacccagcatccccgcagcaccagccggccgggcctgcccccttgctgagcacccctgct
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:57104 -> Molecular function: GO:0004806 [triglyceride lipase activity] evidence: ISS
            GeneID:57104 -> Molecular function: GO:0050253 [retinyl-palmitate esterase activity] evidence: IEA
            GeneID:57104 -> Biological process: GO:0006644 [phospholipid metabolic process] evidence: TAS
            GeneID:57104 -> Biological process: GO:0010891 [negative regulation of sequestering of triglyceride] evidence: IDA
            GeneID:57104 -> Biological process: GO:0010898 [positive regulation of triglyceride catabolic process] evidence: IDA
            GeneID:57104 -> Biological process: GO:0019433 [triglyceride catabolic process] evidence: IEA
            GeneID:57104 -> Biological process: GO:0036155 [acylglycerol acyl-chain remodeling] evidence: TAS
            GeneID:57104 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
            GeneID:57104 -> Biological process: GO:0046474 [glycerophospholipid biosynthetic process] evidence: TAS
            GeneID:57104 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS
            GeneID:57104 -> Cellular component: GO:0005811 [lipid particle] evidence: IEA
            GeneID:57104 -> Cellular component: GO:0005829 [cytosol] evidence: IEA
            GeneID:57104 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:57104 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.