2024-04-26 08:14:40, GGRNA : RefSeq release 60 (20130726)
LOCUS XM_001720798 1269 bp mRNA linear PRI 30-OCT-2012 DEFINITION PREDICTED: Homo sapiens double homeobox protein 4-like protein 4-like (LOC652119), mRNA. ACCESSION XM_001720798 VERSION XM_001720798.3 GI:341914866 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_001839689) annotated using gene prediction method: GNOMON. Also see: Documentation of NCBI's Annotation Process On Jul 28, 2011 this sequence version replaced gi:310117764. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..1269 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="Unknown" /sex="male" /dev_stage="adult" gene 1..1269 /gene="LOC652119" /note="Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 2 Proteins" /db_xref="GeneID:652119" CDS 1..1269 /gene="LOC652119" /codon_start=1 /product="double homeobox protein 4-like protein 4-like" /protein_id="XP_001720850.3" /db_xref="GI:341914867" /db_xref="GeneID:652119" /translation="
MALPTPLYSTLPVESQGRGSRRRLIWTPSKSEALRACFEWNPYPGITTGGRLAQAIGISEPRVQIWFQNERSCQLMQDQRESWPWPGRCGTQEGRRKPTAVTGSQTALYLQAFEKDRFPDIAAREELARETGLPESRSEIWFQNRRARHPGQAGREPAQAGGLCNVVPGGCHPAPSWVAFAHTSAWGTGLPTPYVPGAPGALPQGAFMSQGARAVPVLQASLAMPAEGISQPAPARGDFLYATPTPPEGALSHPQAPRWPAHPGKSREDRELQLDGLPGPCTVGQPGPAQARPQGQGVLAIPASQGSPWWGWGQGPQVARAAWEPQAGAAPPRQPAPPEASAWQGQMQGIPVPTEVLQEPGRSSALPSGLLLHELLVSQEFLQQGLPFLETEAPGELEALEEAASLEEPLSEEEYRGLLEEL
" misc_feature 61..213 /gene="LOC652119" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(61..72,76..78,127..129,145..147,184..186,190..195, 202..207,211..213) /gene="LOC652119" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(64..66,73..75,193..195,202..207) /gene="LOC652119" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 283..447 /gene="LOC652119" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(283..297,301..303,352..354,370..372,409..411, 415..420,427..432,436..444) /gene="LOC652119" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(289..291,298..300,418..420,427..432,439..441) /gene="LOC652119" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" variation 941 /gene="LOC652119" /replace="a" /replace="g" /db_xref="dbSNP:36140252" ORIGIN
atggctctcccgacacctttgtacagcaccctcccagtggaatcccagggacggggatcgcgaaggagactcatttggacccctagcaaaagcgaggccctgcgagcctgctttgagtggaacccgtacccgggtatcaccaccggaggacggctggcccaggccatcggcatttcggagcccagggtccagatttggtttcagaatgagaggtcatgccagctgatgcaggaccagcgtgaatcttggccctggccggggagatgcggcacgcaagaaggcagacgaaagccgaccgccgtcaccggatcccagaccgccctgtacctccaagcctttgagaaggatcgctttccagacatcgccgccagggaagagctggccagagagacgggcctcccggagtccaggagtgagatctggtttcagaatcgaagggccaggcacccgggacaggctggaagggaaccagcacaggcaggtggcctgtgcaacgtggtccccggcgggtgtcaccctgctccctcgtgggtcgccttcgcccacaccagcgcgtggggaacggggcttcccacgccctacgtgcccggtgcgcctggggctctccctcagggggctttcatgagccagggagcgagggccgtccctgtgctccaggccagcctggccatgccggcagaggggatctcccaacctgccccggcacgcggggattttctctatgccaccccgactcctccggaaggggcgctctcccaccctcaggctcctcggtggcctgcgcacccgggcaaaagccgggaggaccgggaactgcagcttgacggcctgccgggcccttgcacggtgggacagcctgggcccgctcaagcgaggccacagggccaaggtgtgcttgcgatacccgcgtcccaggggagtccgtggtggggctggggccagggtccccaggtcgccagggcagcgtgggaaccccaagccggggcagctccacctcgccagcccgcgcccccggaggcctccgcgtggcaggggcagatgcaaggcatcccggtgcccaccgaggtgctccaggagccagggcgctcgtctgcactcccctccggccttctgctgcatgagctcctggtgagccaggagttcctgcagcaggggctacctttcctagaaacggaggccccaggggagctggaggccttggaagaggccgcctcgctggaagaacccctcagcgaggaagaataccggggtctgctggaggagctttag
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.