GGRNA Home | Help | Advanced search

2024-04-20 21:39:56, GGRNA : RefSeq release 60 (20130726)

LOCUS       XM_001720798            1269 bp    mRNA    linear   PRI 30-OCT-2012
DEFINITION  PREDICTED: Homo sapiens double homeobox protein 4-like protein
            4-like (LOC652119), mRNA.
ACCESSION   XM_001720798
VERSION     XM_001720798.3  GI:341914866
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
COMMENT     MODEL REFSEQ:  This record is predicted by automated computational
            analysis. This record is derived from a genomic sequence
            (NW_001839689) annotated using gene prediction method: GNOMON.
            Also see:
                Documentation of NCBI's Annotation Process
            
            On Jul 28, 2011 this sequence version replaced gi:310117764.
            ##Genome-Annotation-Data-START##
            Annotation Provider :: NCBI
            Annotation Status   :: Full annotation
            Annotation Version  :: Homo sapiens Annotation Release 104
            Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline
            Annotation Method   :: Best-placed RefSeq; Gnomon
            Features Annotated  :: Gene; mRNA; CDS; ncRNA
            ##Genome-Annotation-Data-END##
FEATURES             Location/Qualifiers
     source          1..1269
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="Unknown"
                     /sex="male"
                     /dev_stage="adult"
     gene            1..1269
                     /gene="LOC652119"
                     /note="Derived by automated computational analysis using
                     gene prediction method: GNOMON. Supporting evidence
                     includes similarity to: 2 Proteins"
                     /db_xref="GeneID:652119"
     CDS             1..1269
                     /gene="LOC652119"
                     /codon_start=1
                     /product="double homeobox protein 4-like protein 4-like"
                     /protein_id="XP_001720850.3"
                     /db_xref="GI:341914867"
                     /db_xref="GeneID:652119"
                     /translation="
MALPTPLYSTLPVESQGRGSRRRLIWTPSKSEALRACFEWNPYPGITTGGRLAQAIGISEPRVQIWFQNERSCQLMQDQRESWPWPGRCGTQEGRRKPTAVTGSQTALYLQAFEKDRFPDIAAREELARETGLPESRSEIWFQNRRARHPGQAGREPAQAGGLCNVVPGGCHPAPSWVAFAHTSAWGTGLPTPYVPGAPGALPQGAFMSQGARAVPVLQASLAMPAEGISQPAPARGDFLYATPTPPEGALSHPQAPRWPAHPGKSREDRELQLDGLPGPCTVGQPGPAQARPQGQGVLAIPASQGSPWWGWGQGPQVARAAWEPQAGAAPPRQPAPPEASAWQGQMQGIPVPTEVLQEPGRSSALPSGLLLHELLVSQEFLQQGLPFLETEAPGELEALEEAASLEEPLSEEEYRGLLEEL
"
     misc_feature    61..213
                     /gene="LOC652119"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(61..72,76..78,127..129,145..147,184..186,190..195,
                     202..207,211..213)
                     /gene="LOC652119"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(64..66,73..75,193..195,202..207)
                     /gene="LOC652119"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    283..447
                     /gene="LOC652119"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(283..297,301..303,352..354,370..372,409..411,
                     415..420,427..432,436..444)
                     /gene="LOC652119"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(289..291,298..300,418..420,427..432,439..441)
                     /gene="LOC652119"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     variation       941
                     /gene="LOC652119"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:36140252"
ORIGIN      
atggctctcccgacacctttgtacagcaccctcccagtggaatcccagggacggggatcgcgaaggagactcatttggacccctagcaaaagcgaggccctgcgagcctgctttgagtggaacccgtacccgggtatcaccaccggaggacggctggcccaggccatcggcatttcggagcccagggtccagatttggtttcagaatgagaggtcatgccagctgatgcaggaccagcgtgaatcttggccctggccggggagatgcggcacgcaagaaggcagacgaaagccgaccgccgtcaccggatcccagaccgccctgtacctccaagcctttgagaaggatcgctttccagacatcgccgccagggaagagctggccagagagacgggcctcccggagtccaggagtgagatctggtttcagaatcgaagggccaggcacccgggacaggctggaagggaaccagcacaggcaggtggcctgtgcaacgtggtccccggcgggtgtcaccctgctccctcgtgggtcgccttcgcccacaccagcgcgtggggaacggggcttcccacgccctacgtgcccggtgcgcctggggctctccctcagggggctttcatgagccagggagcgagggccgtccctgtgctccaggccagcctggccatgccggcagaggggatctcccaacctgccccggcacgcggggattttctctatgccaccccgactcctccggaaggggcgctctcccaccctcaggctcctcggtggcctgcgcacccgggcaaaagccgggaggaccgggaactgcagcttgacggcctgccgggcccttgcacggtgggacagcctgggcccgctcaagcgaggccacagggccaaggtgtgcttgcgatacccgcgtcccaggggagtccgtggtggggctggggccagggtccccaggtcgccagggcagcgtgggaaccccaagccggggcagctccacctcgccagcccgcgcccccggaggcctccgcgtggcaggggcagatgcaaggcatcccggtgcccaccgaggtgctccaggagccagggcgctcgtctgcactcccctccggccttctgctgcatgagctcctggtgagccaggagttcctgcagcaggggctacctttcctagaaacggaggccccaggggagctggaggccttggaagaggccgcctcgctggaagaacccctcagcgaggaagaataccggggtctgctggaggagctttag
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.