2024-04-25 13:05:06, GGRNA : RefSeq release 60 (20130726)
LOCUS XM_001719844 945 bp mRNA linear PRI 30-OCT-2012 DEFINITION PREDICTED: Homo sapiens double homeobox protein 4-like protein 4-like (LOC652586), mRNA. ACCESSION XM_001719844 VERSION XM_001719844.3 GI:397138615 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. COMMENT MODEL REFSEQ: This record is predicted by automated computational analysis. This record is derived from a genomic sequence (NW_001840859) annotated using gene prediction method: GNOMON. Also see: Documentation of NCBI's Annotation Process On Jul 23, 2012 this sequence version replaced gi:239758066. ##Genome-Annotation-Data-START## Annotation Provider :: NCBI Annotation Status :: Full annotation Annotation Version :: Homo sapiens Annotation Release 104 Annotation Pipeline :: NCBI eukaryotic genome annotation pipeline Annotation Method :: Best-placed RefSeq; Gnomon Features Annotated :: Gene; mRNA; CDS; ncRNA ##Genome-Annotation-Data-END## FEATURES Location/Qualifiers source 1..945 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="Unknown" /sex="male" /dev_stage="adult" gene 1..945 /gene="LOC652586" /note="Derived by automated computational analysis using gene prediction method: GNOMON. Supporting evidence includes similarity to: 4 Proteins" /db_xref="GeneID:652586" CDS 1..945 /gene="LOC652586" /codon_start=1 /product="double homeobox protein 4-like protein 4-like" /protein_id="XP_001719896.3" /db_xref="GI:397138616" /db_xref="GeneID:652586" /translation="
MQRRVEDRYGAFALLAIFQTGHTADSPCCRTRESIVRPSRRGGIFSLGSRFGLLRGNEREPHACVLHRQAEVHGSPPASLCPCPSVKFQPGLPAMALPTPSDGTHTAEAQGSGRRRRIVWTPSQREALRACFERNPYLGITTREQLAQAIGILEPRVPIWFQNERSSQLRQHRRKSRPWPGRHGPPEGRGKRTAVTGSQTALFLRAFEKDRFPGIAAKEELARETVLPESRIQIWFQNRRARHPGQAGRAPTKAGSLCNAATGECHPDPSWVAFAHIGAWGTRCGGGKELPRPRSRNPWPVSPVEVAGGRHAPL
" misc_feature 340..516 /gene="LOC652586" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(340..354,358..360,409..411,427..429,466..468, 472..477,484..489,493..501,505..510) /gene="LOC652586" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(346..348,355..357,475..477,484..489,496..498) /gene="LOC652586" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" misc_feature 565..729 /gene="LOC652586" /note="Homeodomain; DNA binding domains involved in the transcriptional regulation of key eukaryotic developmental processes; may bind to DNA as monomers or as homo- and/or heterodimers, in a sequence-specific manner; Region: homeodomain; cd00086" /db_xref="CDD:28970" misc_feature order(565..579,583..585,634..636,652..654,691..693, 697..702,709..714,718..726) /gene="LOC652586" /note="DNA binding site [nucleotide binding]" /db_xref="CDD:28970" misc_feature order(571..573,580..582,700..702,709..714,721..723) /gene="LOC652586" /note="specific DNA base contacts [nucleotide binding]; other site" /db_xref="CDD:28970" ORIGIN
atgcagagaagggtggaagaccggtatggtgcctttgctctccttgccattttccaaaccggccacactgcagactccccatgttgccgcacacgggaatccatcgtcaggccatcacgccggggaggcatcttctctctggggtctcgctttgggcttctacgtggaaatgaacgagagccacacgcctgcgtgttgcacaggcaggctgaggtgcacgggagcccgccggcctctctctgcccgtgtccgtccgtgaaattccagccgggactccccgcgatggccttgccgacaccttcggacggcacccataccgcggaagcccagggatcgggacggcgaaggagaatcgtttggaccccgagccaaagagaggccctgcgagcctgctttgagcggaacccatacctgggcatcaccaccagagaacagctggcccaggccatcggcattctggagcccagggtcccgatttggtttcagaatgagaggtcaagccagctgaggcagcaccggcggaaatctcggccctggcccgggagacacggcccgccagaaggtaggggaaagcggaccgccgtcaccggatcccagaccgccctgttcctcagagcctttgagaaggatcgctttccaggcatcgccgccaaggaagagctggccagagagacggtcctcccggagtccaggattcagatctggtttcagaatcgaagggccaggcacccgggacaggctggcagggcacccacgaaggcaggcagcctgtgcaatgcggccaccggcgagtgtcaccctgatccctcttgggtggccttcgcccacatcggcgcatggggaacgcgctgtgggggtgggaaggagttgcctagacctagaagcaggaatccttggcctgtcagcccggtggaggtggcggggggaagacacgcccctctatag
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.