GGRNA Home | Help | Advanced search

2019-03-26 15:50:21, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_102763               1788 bp    RNA     linear   PRI 17-JUL-2013
DEFINITION  Homo sapiens GATA6 antisense RNA 1 (head to head) (GATA6-AS1),
            non-coding RNA.
ACCESSION   NR_102763 XR_109470 XR_111780 XR_172237
VERSION     NR_102763.1  GI:493800010
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1788)
  AUTHORS   Ota,T., Suzuki,Y., Nishikawa,T., Otsuki,T., Sugiyama,T., Irie,R.,
            Wakamatsu,A., Hayashi,K., Sato,H., Nagai,K., Kimura,K., Makita,H.,
            Sekine,M., Obayashi,M., Nishi,T., Shibahara,T., Tanaka,T.,
            Ishii,S., Yamamoto,J., Saito,K., Kawai,Y., Isono,Y., Nakamura,Y.,
            Nagahari,K., Murakami,K., Yasuda,T., Iwayanagi,T., Wagatsuma,M.,
            Shiratori,A., Sudo,H., Hosoiri,T., Kaku,Y., Kodaira,H., Kondo,H.,
            Sugawara,M., Takahashi,M., Kanda,K., Yokoi,T., Furuya,T.,
            Kikkawa,E., Omura,Y., Abe,K., Kamihara,K., Katsuta,N., Sato,K.,
            Tanikawa,M., Yamazaki,M., Ninomiya,K., Ishibashi,T., Yamashita,H.,
            Murakawa,K., Fujimori,K., Tanai,H., Kimata,M., Watanabe,M.,
            Hiraoka,S., Chiba,Y., Ishida,S., Ono,Y., Takiguchi,S., Watanabe,S.,
            Yosida,M., Hotuta,T., Kusano,J., Kanehori,K., Takahashi-Fujii,A.,
            Hara,H., Tanase,T.O., Nomura,Y., Togiya,S., Komai,F., Hara,R.,
            Takeuchi,K., Arita,M., Imose,N., Musashino,K., Yuuki,H., Oshima,A.,
            Sasaki,N., Aotsuka,S., Yoshikawa,Y., Matsunawa,H., Ichihara,T.,
            Shiohata,N., Sano,S., Moriya,S., Momiyama,H., Satoh,N., Takami,S.,
            Terashima,Y., Suzuki,O., Nakagawa,S., Senoh,A., Mizoguchi,H.,
            Goto,Y., Shimizu,F., Wakebe,H., Hishigaki,H., Watanabe,T.,
            Sugiyama,A., Takemoto,M., Kawakami,B., Yamazaki,M., Watanabe,K.,
            Kumagai,A., Itakura,S., Fukuzumi,Y., Fujimori,Y., Komiyama,M.,
            Tashiro,H., Tanigami,A., Fujiwara,T., Ono,T., Yamada,K., Fujii,Y.,
            Ozaki,K., Hirao,M., Ohmori,Y., Kawabata,A., Hikiji,T., Kobatake,N.,
            Inagaki,H., Ikema,Y., Okamoto,S., Okitani,R., Kawakami,T.,
            Noguchi,S., Itoh,T., Shigeta,K., Senba,T., Matsumura,K.,
            Nakajima,Y., Mizuno,T., Morinaga,M., Sasaki,M., Togashi,T.,
            Oyama,M., Hata,H., Watanabe,M., Komatsu,T., Mizushima-Sugano,J.,
            Satoh,T., Shirai,Y., Takahashi,Y., Nakagawa,K., Okumura,K.,
            Nagase,T., Nomura,N., Kikuchi,H., Masuho,Y., Yamashita,R.,
            Nakai,K., Yada,T., Nakamura,Y., Ohara,O., Isogai,T. and Sugano,S.
  TITLE     Complete sequencing and characterization of 21,243 full-length
            human cDNAs
  JOURNAL   Nat. Genet. 36 (1), 40-45 (2004)
   PUBMED   14702039
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK123079.1.
            On or before May 10, 2013 this sequence version replaced
            gi:410173487, gi:310113231, gi:310123744.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK123079.1, DA017074.1 [ECO:0000332]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1788              AK123079.1         1-1788
FEATURES             Location/Qualifiers
     source          1..1788
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q11.2"
     gene            1..1788
                     /gene="GATA6-AS1"
                     /note="GATA6 antisense RNA 1 (head to head)"
                     /db_xref="GeneID:100128893"
                     /db_xref="HGNC:48840"
     misc_RNA        1..1788
                     /gene="GATA6-AS1"
                     /product="GATA6 antisense RNA 1 (head to head)"
                     /db_xref="GeneID:100128893"
                     /db_xref="HGNC:48840"
     exon            1..302
                     /gene="GATA6-AS1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(25)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144923558"
     variation       complement(75)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115330049"
     variation       complement(112)
                     /gene="GATA6-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79335487"
     variation       complement(134)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187376351"
     variation       complement(190)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:114082533"
     variation       complement(219)
                     /gene="GATA6-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:111231025"
     variation       complement(246)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369259473"
     exon            303..1788
                     /gene="GATA6-AS1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(342)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183680964"
     variation       complement(408)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45491491"
     variation       complement(421)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45508599"
     variation       complement(446)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:180790436"
     variation       complement(468)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73390820"
     variation       complement(492)
                     /gene="GATA6-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143199287"
     variation       complement(504)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75757230"
     variation       complement(656)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189713891"
     variation       complement(676)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139965483"
     variation       complement(772)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146032339"
     variation       complement(1032)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:9955740"
     variation       complement(1114)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375636461"
     variation       complement(1119)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:35917816"
     variation       complement(1146)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184879894"
     variation       complement(1318)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374587322"
     variation       complement(1431..1432)
                     /gene="GATA6-AS1"
                     /replace="gc"
                     /replace="ta"
                     /db_xref="dbSNP:34725963"
     variation       complement(1431)
                     /gene="GATA6-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11874952"
     variation       complement(1432)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11874782"
     variation       complement(1514)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12604478"
     variation       complement(1571)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144071364"
     variation       complement(1581)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377094322"
     variation       complement(1584)
                     /gene="GATA6-AS1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374831302"
     variation       complement(1597)
                     /gene="GATA6-AS1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:9946505"
     variation       complement(1710..1711)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="tgt"
                     /db_xref="dbSNP:72183639"
     variation       complement(1711..1712)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="tgt"
                     /replace="tgttgt"
                     /db_xref="dbSNP:57305619"
     variation       complement(1721..1722)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="ttg"
                     /replace="ttgttg"
                     /db_xref="dbSNP:35915662"
     variation       complement(1722..1723)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="ttg"
                     /db_xref="dbSNP:111880619"
     variation       complement(1724..1725)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="ttg"
                     /db_xref="dbSNP:72243848"
     variation       complement(1731..1732)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="tgt"
                     /replace="ttg"
                     /db_xref="dbSNP:35885646"
     variation       complement(1732..1733)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="gtt"
                     /db_xref="dbSNP:72054732"
     variation       complement(1733..1734)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="gtt"
                     /replace="tttttttttt"
                     /db_xref="dbSNP:143738564"
     variation       complement(1734)
                     /gene="GATA6-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:192986224"
     variation       complement(1750..1751)
                     /gene="GATA6-AS1"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:34616556"
ORIGIN      


aacccccgcctagccccttcacagcaaatgcgctttttgccctgaagttgtgtgagaccgaccttaaactttctccgaccctatctcgggatgctacggctcaggtcgtggtggtttcgggaacctcaagacaacattccccagctgacctttgggaactttaactcgggtcgtcatgtacggaaaggtagtctatggggtacgcagaatggaaaagggcttccacatcagtcgtgtccgaggacgctctccaacttttgatgtccctggagagtttctgatatttccctggagagtttcagaaaggatttcttccgacagacgtgaccccagaaggctgccgagggagactttaggacaagaggcgttgtttttgtgagaatgaatttttatactttaccccgaccccaccccctaccccccgcccaggtaaatccaagtaaatgattttctgaaggtcggtctcctagaaagcgtttaggctctggttttttgttttgtttctattttcgtgttttcccagttagggaaggaagaggagcctgtgcagagttgaactggggtggagaggtgccttgtaaagtatggtttccagagatggtgagacctcgtagctaagcgttgtttcctctgcacgtaactgtgagttgtgaacttgtggctcctgggggagcgggacagggcctggcagtgcgggggagggggcaaggaattcaggaagttggcgagaattcttcgtttttcattcttcgttgtaaattgcttctaaacacttctgaattttaaattgctaccgagaaggtccagaaaccgttctcatccaatttagtcacttttattacgttccactttgcctcccccaatcactgcggcggctcccagtttcagcgtggccgcatttggaaaaggctgaaggtagaaaactctggaatggagaggctggcgactggagcaggatccaggggctttaaattttaacctgaatgcgatcgaatgcgcgactcccagaagagatagccaggcgtccgcccggccgctcaacccccgccaggactcggaatgccttgcttttggttcttttcgtgagttccgaccaaatgtttaagtggactgggttttgcagaagctcatttgtaagcactgacggaaatgggttgtgggcatttgatttcctttgattccaacgttttgaaataatgtttctcggatttgctattcgaagcaattttctaaaaactcatatcttatttgctaaaaataaactctttggctcagtttgtgtccaggctgtgtacggcctccaaccctgagccccgaggagatcgagccctggcgcgagcctgatctctgtcctgtgtgtttctttgtatttgcaagtacaaggatgtctgcgtggatatccctggacactcgataccccccggggacctgcttttcccgcagctccgcagacgcggcgggagggcgcgctggccccggcgctgctgggacagaggtgagcagcggggtggacattgaccgattcgacaacgttcgggctctaagggctcgggaagggacccggcattttaccctccagattcccaatctatttttaaaaataatgttcaaaacatatgggaaaaataagtgattgctccttttcatggtcacagattgtatttattttttcagactggttttccaacctaacgagggaatgggtagtgaatgttgttgttgttgttgttgtttatgttggttaatttcgaaataaaactgtttaactcgtacagttgattcagacag
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.