GGRNA Home | Help | Advanced search

2019-03-23 04:06:03, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_073494               1058 bp    RNA     linear   PRI 17-JUL-2013
DEFINITION  Homo sapiens SUZ RNA binding domain containing 1 pseudogene
            (LOC100130075), non-coding RNA.
ACCESSION   NR_073494
VERSION     NR_073494.1  GI:429325253
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1058)
  AUTHORS   Kimura,K., Wakamatsu,A., Suzuki,Y., Ota,T., Nishikawa,T.,
            Yamashita,R., Yamamoto,J., Sekine,M., Tsuritani,K., Wakaguri,H.,
            Ishii,S., Sugiyama,T., Saito,K., Isono,Y., Irie,R., Kushida,N.,
            Yoneyama,T., Otsuka,R., Kanda,K., Yokoi,T., Kondo,H., Wagatsuma,M.,
            Murakawa,K., Ishida,S., Ishibashi,T., Takahashi-Fujii,A.,
            Tanase,T., Nagai,K., Kikuchi,H., Nakai,K., Isogai,T. and Sugano,S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC025423.32.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1058              AC025423.32        143984-145041
FEATURES             Location/Qualifiers
     source          1..1058
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q15"
     gene            1..1058
                     /gene="LOC100130075"
                     /note="SUZ RNA binding domain containing 1 pseudogene"
                     /pseudo
                     /db_xref="GeneID:100130075"
     misc_RNA        1..1058
                     /gene="LOC100130075"
                     /product="SUZ RNA binding domain containing 1 pseudogene"
                     /pseudo
                     /db_xref="GeneID:100130075"
     exon            1..1058
                     /gene="LOC100130075"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(68)
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2120742"
     variation       complement(127)
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80294346"
     variation       complement(220)
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:193148015"
     variation       complement(239)
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:11177379"
     variation       complement(267)
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:7969876"
     variation       complement(307)
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148797200"
     variation       complement(343)
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187723386"
     variation       complement(439)
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370918383"
     variation       complement(450)
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:183002082"
     variation       complement(463)
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200489144"
     variation       complement(512)
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190409327"
     variation       complement(542)
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114307899"
     variation       complement(563)
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187268101"
     variation       complement(617)
                     /gene="LOC100130075"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183055447"
     variation       complement(644)
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1144941"
     variation       complement(651)
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:115045775"
     variation       complement(701)
                     /gene="LOC100130075"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144405813"
     variation       complement(921..922)
                     /gene="LOC100130075"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:202102871"
     variation       complement(981)
                     /gene="LOC100130075"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191255350"
ORIGIN      


ggaaagtggcgagtaagatggaatatgaggaggttgctgagagctgggaggagacggcagacagcggggaaatagacgtctggaaaaaaaactgaagatcacacagaaagcaggaaattcaaatctcccaaagtgcccattgtgattcaggatgataattttcccccgggaccccctccacaggtccgcatcctcaagaggcccaccagcaacggtgtggtcagcagccccaagtccgctagcaggcccgcccttccagtcaagtccctggcacagtgggaagccgagtacaccgaggccaggaagcggatcctgggcagcgccaacccgaggagaagcaggagaaacccatcctcgataggtcttcctctgatcttcttcccttcaggccaaccaggatctcctaacccgaagacagcagacagcccaataatgtgatcagacagcctctgggtcctgatgggtcacacggcttcaaacagcgcagataaatgcaggcaagaagagatggcgcgactgccgcgtcaacgcgtcctgggtcgtccgccaagggttgcactaccgtggcagacagctggacttgagcagcgggaacttgacttacttgcctggtgatccccgttgctccgcccactgtgaccttgaatcccatgcactgtgacctccccccttctcctccttcccactgtgattggcactttgacaaggactgtcccaagtcaatggaaagggaaaaagggtgagggttaggagaaggttggggggaacccaccaattactcagagtagagagtcagacagggccagcaatagcggtttatcatgctcattaatttgggatttcaaaacacaaatgaactcacacctacccacccccaagtgcatgtcatcacttaaaaagtgagttccatttgaaaaaaaagaaagcaaactacctgctcactctaaaagcagttgctgttgtttgtgactttgccatttaaaaaaatacagaccagctgctgctgtttgcttgcattccacagttatcttgtgtcactttgccctttgttgtgctta
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.