2024-03-28 19:49:50, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_049829 112 bp RNA linear PRI 17-JUL-2013 DEFINITION Homo sapiens microRNA 5197 (MIR5197), microRNA. ACCESSION NR_049829 VERSION NR_049829.1 GI:388596756 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 112) AUTHORS Schotte,D., Akbari Moqadam,F., Lange-Turenhout,E.A., Chen,C., van Ijcken,W.F., Pieters,R. and den Boer,M.L. TITLE Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia JOURNAL Leukemia 25 (9), 1389-1399 (2011) PUBMED 21606961 REMARK Review article REFERENCE 2 (bases 1 to 112) AUTHORS Griffiths-Jones,S., Grocock,R.J., van Dongen,S., Bateman,A. and Enright,A.J. TITLE miRBase: microRNA sequences, targets and gene nomenclature JOURNAL Nucleic Acids Res. 34 (DATABASE ISSUE), D140-D144 (2006) PUBMED 16381832 COMMENT PROVISIONAL REFSEQ: This record is based on preliminary annotation provided by NCBI staff in collaboration with miRBase. The reference sequence was derived from AC008696.6. Summary: microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop. [provided by RefSeq, Sep 2009]. Sequence Note: This record represents a predicted microRNA stem-loop as defined by miRBase. Some sequence at the 5' and 3' ends may not be included in the intermediate precursor miRNA produced by Drosha cleavage. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-112 AC008696.6 125814-125925 c FEATURES Location/Qualifiers source 1..112 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="5" /map="5" gene 1..112 /gene="MIR5197" /note="microRNA 5197" /db_xref="GeneID:100846991" /db_xref="HGNC:43450" /db_xref="miRBase:MI0018176" precursor_RNA 1..112 /gene="MIR5197" /product="microRNA 5197" /db_xref="GeneID:100846991" /db_xref="HGNC:43450" /db_xref="miRBase:MI0018176" exon 1..112 /gene="MIR5197" /inference="alignment:Splign:1.39.8" variation 6..7 /gene="MIR5197" /replace="" /replace="g" /db_xref="dbSNP:35579612" variation 9 /gene="MIR5197" /replace="a" /replace="g" /db_xref="dbSNP:2042253" ncRNA 27..49 /gene="MIR5197" /ncRNA_class="miRNA" /product="hsa-miR-5197-5p" /db_xref="miRBase:MIMAT0021130" /db_xref="GeneID:100846991" /db_xref="HGNC:43450" /db_xref="miRBase:MI0018176" variation 45 /gene="MIR5197" /replace="a" /replace="c" /db_xref="dbSNP:372758014" ncRNA 64..86 /gene="MIR5197" /ncRNA_class="miRNA" /product="hsa-miR-5197-3p" /db_xref="miRBase:MIMAT0021131" /db_xref="GeneID:100846991" /db_xref="HGNC:43450" /db_xref="miRBase:MI0018176" variation 71 /gene="MIR5197" /replace="g" /replace="t" /db_xref="dbSNP:77549240" ORIGIN
tatgggattccacagacaatgagtatcaatggcacaaactcattcttgaatttttgccagttcaagaagagactgagtcatcgaatgctctaaatgtcacttcacctcatgt
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.