Home |
Help |
Advanced search
2024-04-20 10:48:23, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_049734 3573 bp RNA linear PRI 17-JUL-2013
DEFINITION Homo sapiens membrane-spanning 4-domains, subfamily A, member 14
(MS4A14), transcript variant 8, non-coding RNA.
ACCESSION NR_049734
VERSION NR_049734.1 GI:387849363
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3573)
AUTHORS Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
Snippe,H., Hibberd,M.L. and Seielstad,M.
TITLE New genetic associations detected in a host response study to
hepatitis B vaccine
JOURNAL Genes Immun. 11 (3), 232-238 (2010)
PUBMED 20237496
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AP003127.2 and DB450359.2.
Transcript Variant: This variant (8) includes an alternate exon in
the coding region, compared to variant 4, which results in the
introduction of an early stop codon. The transcript is sufficiently
abundant to represent as a RefSeq record; however, the predicted
protein product is not represented because the product is
significantly truncated and the transcript is a candidate for
nonsense-mediated mRNA decay (NMD).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-496 AP003127.2 99935-100430
497-1159 DB450359.2 5-667
1160-1253 AP003127.2 109815-109908
1254-3573 AP003127.2 119358-121677
FEATURES Location/Qualifiers
source 1..3573
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q12.2"
gene 1..3573
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/note="membrane-spanning 4-domains, subfamily A, member
14"
/db_xref="GeneID:84689"
/db_xref="HGNC:30706"
misc_RNA 1..3573
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/product="membrane-spanning 4-domains, subfamily A, member
14, transcript variant 8"
/db_xref="GeneID:84689"
/db_xref="HGNC:30706"
exon 1..703
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 31
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:186234557"
variation 39
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:7929046"
variation 40
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:190992915"
variation 51..52
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="a"
/db_xref="dbSNP:377307026"
variation 102
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76333679"
variation 110
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:143358541"
variation 149
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3816270"
variation 223
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76174817"
variation 281
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:180800488"
variation 296
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:185942516"
variation 379
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:141665394"
variation 421
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:112785513"
variation 427
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375045470"
variation 432
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:190864604"
variation 472
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:6591579"
variation 517
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368431455"
variation 545
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:367878785"
variation 560
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200592380"
misc_feature 566..1078
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="COORDINATES:
alignment:Blast2seq::RefSeq|NM_001261828.1"
/note="primary ORF has stop codon >50 nucleotides from the
terminal splice site; nonsense-mediated decay (NMD)
candidate"
variation 569
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/replace="g"
/db_xref="dbSNP:201462421"
variation 577
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:375301622"
variation 589
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:140226757"
variation 601
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200092161"
variation 602
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371634910"
variation 640
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:150323558"
variation 653
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:200017443"
variation 701
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:138895874"
exon 704..832
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 709
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:141700245"
variation 731
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:72514098"
variation 732..733
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:3217518"
variation 732
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:74733740"
variation 732
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="tt"
/db_xref="dbSNP:77630012"
variation 747
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147119308"
variation 769
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:138517611"
variation 770
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:368053345"
variation 771
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:144076317"
variation 794
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:369576834"
variation 796
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:144248317"
variation 802
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:2197234"
variation 810
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:372708908"
variation 815
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:148297999"
variation 827
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375255532"
variation 831
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:141490187"
exon 833..883
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 836
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:367787186"
variation 853
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:77796224"
variation 882
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:139149393"
exon 884..1033
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 884
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375760675"
variation 885
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:202236686"
variation 897
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:146613208"
variation 898
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371907012"
variation 907
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:183715072"
variation 927
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:76136794"
variation 932
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375247098"
variation 942
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:146035561"
variation 961
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:140270120"
variation 1011
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:145354751"
exon 1034..1154
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 1090
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200118179"
variation 1091
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:61898304"
variation 1102
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:10750937"
variation 1110
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:188315131"
exon 1155..1253
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 1189
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:369231964"
variation 1194
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:77038741"
variation 1220
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:186474420"
exon 1254..3573
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/inference="alignment:Splign:1.39.8"
variation 1274
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:371774895"
variation 1285
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375761169"
variation 1299
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:143463721"
variation 1314
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:7131283"
variation 1315
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:148391374"
variation 1362
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:369024994"
variation 1368
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142563385"
variation 1378
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:373780418"
variation 1386
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:116626186"
variation 1391
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:140195795"
variation 1417
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:142269991"
variation 1423
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147713621"
variation 1424
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142667482"
variation 1435
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:370208539"
variation 1473
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:373858678"
variation 1476
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:150268605"
variation 1533
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:117801657"
variation 1536
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:149338262"
variation 1572
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:187868937"
variation 1618
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:150868984"
variation 1634
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:193025815"
variation 1635
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:368158780"
variation 1636
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:375278465"
variation 1641
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:114064661"
variation 1657
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:138285006"
variation 1662
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142839945"
variation 1682
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369608879"
variation 1693
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:185708225"
variation 1730
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201469306"
variation 1736
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:114663860"
variation 1745
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:376669252"
variation 1756
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:139364741"
variation 1762
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:149681158"
variation 1782
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:150784858"
variation 1832
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:370940283"
variation 1861
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:145539034"
variation 1881
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:149868650"
variation 1892
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:144883718"
variation 1929
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:140428922"
variation 1965
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:144301602"
variation 1999
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:116345276"
variation 2021
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:112103602"
variation 2053
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:369619070"
variation 2081
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:373220783"
variation 2093..2094
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="c"
/db_xref="dbSNP:35183103"
variation 2137
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3802959"
variation 2168
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:143398166"
variation 2179
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:139435636"
variation 2186
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:145054362"
variation 2224
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/replace="t"
/db_xref="dbSNP:140456628"
variation 2238
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:376488191"
variation 2276
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:150409796"
variation 2281
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:74837900"
variation 2297
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:142892172"
variation 2312
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:145051590"
variation 2329
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:199805024"
variation 2353
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:199505839"
variation 2356
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:374402343"
variation 2367
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:201227484"
variation 2390
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142235413"
variation 2422
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:113290465"
variation 2426
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:80173276"
variation 2427
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:144635507"
variation 2440
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:372468983"
variation 2462
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370935983"
variation 2512
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:200738251"
variation 2513
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:148489703"
variation 2520
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:375897716"
variation 2535
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:3825020"
variation 2561
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="t"
/db_xref="dbSNP:374558627"
variation 2614
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:116224124"
variation 2621
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:73481226"
variation 2631
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200543306"
variation 2635
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:144309625"
variation 2636
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:201726394"
variation 2643
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:200307761"
variation 2650
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:3016727"
variation 2663
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:147367847"
variation 2664
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:140936913"
variation 2679
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:368186934"
variation 2681
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:146179294"
variation 2693
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:370794980"
variation 2702
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:375353153"
variation 2722
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:145801550"
variation 2746
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:368014397"
variation 2748
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:149015522"
variation 2806
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:142968938"
variation 2811
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:151183005"
variation 2844
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:181547264"
variation 2952
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:77025492"
variation 3062
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="c"
/db_xref="dbSNP:184474834"
variation 3162
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="g"
/replace="t"
/db_xref="dbSNP:375774697"
variation 3184
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:1443243"
variation 3273
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:78731118"
variation 3352
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:375396734"
variation 3388
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:75538311"
variation 3410
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="t"
/db_xref="dbSNP:138237921"
variation 3418
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="c"
/replace="g"
/db_xref="dbSNP:188971082"
variation 3509..3510
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace=""
/replace="aacac"
/db_xref="dbSNP:140068962"
variation 3550
/gene="MS4A14"
/gene_synonym="MS4A16; NYD-SP21"
/replace="a"
/replace="g"
/db_xref="dbSNP:181921480"
ORIGIN
atcaagtaaaagaaactcctttcaaaggagggcagaagcgtggctgagtttaaaaaacatagattttggagacaggtcaagttgagtttgccccttccctgtcctgtatgtctttgggtgacataaccttgctgttcctcagtttcagtattgtagaactgttaaaagaataaatgttagtgcatgtcaacaccttctacacagttcccagaacataaggaatattccataagttttagttcctttataactcatgaacatatgtgtaaggacttgtttcgtatataccatctattctttgtttaccatatgtttgtaagcaaattgacaagagagtaagtcttctggatacagtacttttcaccaggaagatggggggctgagcatgctctagaattctaaaactctgtgactcaactatgattctgagattctactactgagtagagtcatcactaagggctcatctctgagggctccatgtgactctggtggagaggtagatcatgatttgggcggcaatgtttgctcactctttcccttactagagttctgccatagaatcatggagtcaacatcccaggacagaagggcaactcacgtcatcactataaaaccaaacgaaactgtattgactgcatttccctacagacctcatagctctctgctggattttctgaagggagagccaagagtcttgggggctacccagatcctgcttgctctaatcattgtgggctttggaactatatttgcacttaattacatcggtttctcccaaagacttccccttgttgtcctcacaggatatccattctggggagcacttatttttattcttacaggatacctcacagtaaccgataagaaatcaaaacttctgggtcaaggtgtcacgggcatgaatgttatcagctccttggttgcgataactgggattactttcaccattctcagctacagacatcaagacaagtactgccagatgccatcctttgaagaaatatgtgttttcagtagaactcttttcattgacttcatccttctcactcctccacactccagccacttcctataatcccttaatgtgtcaagtatccacggccccaagatgatcagaggatcagcttcttccggctttgaaccgtcaccagggaattttgttaatcttactgatcatcagcatagcagagctcagcatctctgtgactattgcatcctttagaagcaagtgctggacacagtcagatgaggttctgtttttcttgccttcggatgttactcaaaatagtgaacaacctgccccagaagaaaatgatcaattacaatttgtgcttcaagaagagttttccagtgatgattcaacaacaaatgcacaatctgttatctttggaggctatgctttcttcaagttaacactctctaggagtcctttagtctcccaaccaggtaataaaggtagagaatttgtgccagatgaacaaaagcaaagtatccttccatctcccaaattttcagaggaagaaattgaacctttgcctcccacactagagaaaaagccctcagaaaatatgtccattcagctagactctacatttaaacaaatgaaagatgaagatctacaatctgctattgtacaaccttctcaaatgcaaaccaagcttctgcaggaccaagctgcgtcactccaagtttttccatcccattctgcactaaaactcgaagatatatcacctgaagacttgccatcccaagctctaccagtagaaggcctgtcagaacaaaccatgccatctaagtctacatcatcccatgtcaaacagtcttctaatctgacagctaatgacctgccccctcaaggcatactatcccaagacacatcatctcaagatatgctgtttcatgacatgacatcccaagatatgcaatccctagatatgctatctcaagacacaccatcccacgccatgccacctcaagacataccttcccaagatatgctatcccaagctctatcagcgcatgccatattacctgaagcctcaacatcccatattgtgcagttccctgaaatacaacacctacttcagcagcccccagatcttcaaccagaaaacactgaacctcaaaaccagcaaattttacaaatgtcatatcaagatattagatcagaagttatggaagagaccaaagaatggaaatctgaggaggaactccatagaagaaaatcctcaagacggcattccttaaaccagcaaaccaaagccttgcaatacttaaggagacattctttagacgtgcaagccaaaggccagaaatcctcaaagaggcattccttagatcagcaaagcaaaggctggcaatctccaaagcagaaatccttagaccagcaaatcaaagactggctatccccaaagaggcactccgtagataagcaagctcaacttaatcaaactaaagagcaactcccagatcagcaagctgaagatcagcaagccaaaggggaacaatacccagaaggacaatctaaagatggacaagttaaagaccagcagactgataaggagcaaaactcaaagaagcaaacccaggatcagcaaactgaagaccagccggcccaagagaagaaatccccgaaaggacaattccaaaatgttcaagccgaaggacagcaagctcaggtggagaaagtgccaaaactgttatgccaagattcagaatcccaaatacagcaataccaattctggcaattccacaaaggcaatctccaggctggacaacccaggactgtcaatcttttggccaagaatcccctgactggataactcagggctggagaaacaaagattataaagcacgagaatggcaatttgaaatgaagcactggcaaacacaggatctattagagaaagaagccctaaagcagaaagctctataccaagaagtccaaacccagcacgcaacagcccaacataacctagaatgtcaagacactcaagataaagaccaacaagaccttcaatccagagttacacaaaaaggagatatgtacactagagacatcaaaccaggggacatgaaatgtatagggcaaacctcaggggacctgcaatcagaagacgtgaaggcagattttcattcttcttctggccaaagctcagtacaagacacatgtttagcctatttgtccaatctagattcagaacaagatgtgcaaccagacacttcagcttcctcaaattcatataaagaagatgtgaatttaacttctacttcatgtgatccaaaagatcaacagcaatctgaagactctgactaacatgcagaatctacccaataccacactgcccccattaatggaattaaattgggaaaaacaatattgcctcctccaatctgtgttctcaactgtggttgccacctcattaacttacaaaaaaatgaagggcatgctgagcactcaaacaatttgttcttacttaaaataaaatgacaacaaaccaaatgttaacactgtatcatcactttatgtatgtgaagaaataattcacatgtatattccttgtcatcaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:84689 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.