GGRNA Home | Help | Advanced search

2019-03-22 05:04:03, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_047571               7840 bp    RNA     linear   PRI 17-JUL-2013
DEFINITION  Homo sapiens ankyrin repeat and FYVE domain containing 1 (ANKFY1),
            transcript variant 4, non-coding RNA.
ACCESSION   NR_047571
VERSION     NR_047571.1  GI:384367971
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 7840)
  AUTHORS   Zhang,J., Reiling,C., Reinecke,J.B., Prislan,I., Marky,L.A.,
            Sorgen,P.L., Naslavsky,N. and Caplan,S.
  TITLE     Rabankyrin-5 interacts with EHD1 and Vps26 to regulate endocytic
            trafficking and retromer function
  JOURNAL   Traffic 13 (5), 745-757 (2012)
   PUBMED   22284051
  REMARK    GeneRIF: Rabankyrin-5 interacts with EHD1 and Vps26 to regulate
            endocytic trafficking and retromer function
REFERENCE   2  (bases 1 to 7840)
  AUTHORS   Bouslam,N., Bouhouche,A., Benomar,A., Hanein,S., Klebe,S.,
            Azzedine,H., Di Giandomenico,S., Boland-Auge,A., Santorelli,F.M.,
            Durr,A., Brice,A., Yahyaoui,M. and Stevanin,G.
  TITLE     A novel locus for autosomal recessive spastic ataxia on chromosome
            17p
  JOURNAL   Hum. Genet. 121 (3-4), 413-420 (2007)
   PUBMED   17273843
REFERENCE   3  (bases 1 to 7840)
  AUTHORS   Schnatwinkel,C., Christoforidis,S., Lindsay,M.R.,
            Uttenweiler-Joseph,S., Wilm,M., Parton,R.G. and Zerial,M.
  TITLE     The Rab5 effector Rabankyrin-5 regulates and coordinates different
            endocytic mechanisms
  JOURNAL   PLoS Biol. 2 (9), E261 (2004)
   PUBMED   15328530
  REMARK    GeneRIF: Rab5 regulates and coordinates different endocytic
            mechanisms through its effector Rabankyrin-5
REFERENCE   4  (bases 1 to 7840)
  AUTHORS   Kuriyama,H., Asakawa,S., Minoshima,S., Maruyama,H., Ishii,N.,
            Ito,K., Gejyo,F., Arakawa,M., Shimizu,N. and Kuwano,R.
  TITLE     Characterization and chromosomal mapping of a novel human gene,
            ANKHZN
  JOURNAL   Gene 253 (2), 151-160 (2000)
   PUBMED   10940552
REFERENCE   5  (bases 1 to 7840)
  AUTHORS   Ito,K., Ishii,N., Miyashita,A., Tominaga,K., Kuriyama,H.,
            Maruyama,H., Shirai,M., Naito,M., Arakawa,M. and Kuwano,R.
  TITLE     Molecular cloning of a novel 130-kDa cytoplasmic protein, Ankhzn,
            containing Ankyrin repeats hooked to a zinc finger motif
  JOURNAL   Biochem. Biophys. Res. Commun. 257 (1), 206-213 (1999)
   PUBMED   10092534
  REMARK    GeneRIF: Characterization of the related mouse gene
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AL706226.1, AK057047.1 and
            AC087292.14.
            
            Summary: This gene encodes a cytoplasmic protein that contains a
            coiled-coil structure and a BTB/POZ domain at its N-terminus,
            ankyrin repeats in the middle portion, and a FYVE-finger motif at
            its C-terminus. This protein belongs to a subgroup of double zinc
            finger proteins which may be involved in vesicle or protein
            transport. Alternate splicing results in multiple transcript
            variants of this gene. [provided by RefSeq, Apr 2012].
            
            Transcript Variant: This variant (4) lacks an internal exon,
            compared to variant 1. This variant is represented as non-coding
            because the use of the 5'-most supported translational start codon,
            as used in variant 1, renders the transcript a candidate for
            nonsense-mediated mRNA decay (NMD).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-23                AL706226.1         2-24
            24-1439             AK057047.1         1-1416
            1440-1440           AC087292.14        172048-172048       c
            1441-3375           AK057047.1         1418-3352
            3376-7840           AC087292.14        150422-154886       c
FEATURES             Location/Qualifiers
     source          1..7840
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="17"
                     /map="17p13.3"
     gene            1..7840
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="ankyrin repeat and FYVE domain containing 1"
                     /db_xref="GeneID:51479"
                     /db_xref="HGNC:20763"
                     /db_xref="MIM:607927"
     misc_RNA        1..7840
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /product="ankyrin repeat and FYVE domain containing 1,
                     transcript variant 4"
                     /db_xref="GeneID:51479"
                     /db_xref="HGNC:20763"
                     /db_xref="MIM:607927"
     exon            1..48
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    39..248
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="COORDINATES: ab initio prediction:ORF Finder"
                     /note="primary ORF has stop codon >50 nucleotides from the
                     terminal splice site; nonsense-mediated mRNA decay
                     (NMD)candidate"
     exon            49..241
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            242..377
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            378..501
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            502..651
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            652..817
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     variation       681
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369749781"
     variation       711
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3744671"
     exon            818..1022
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1023..1091
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1092..1291
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1292..1389
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1390..1618
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     variation       1440
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2020118"
     variation       1557
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1973059"
     exon            1619..1717
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1718..1871
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            1872..2043
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2044..2162
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2163..2319
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2320..2520
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2521..2697
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2698..2845
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2846..2936
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            2937..3061
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3062..3208
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3209..3299
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     exon            3300..7840
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /inference="alignment:Splign:1.39.8"
     variation       4490
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1045016"
     variation       4770
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3760471"
     variation       6646
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:3840875"
     variation       6953
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1043587"
     variation       7190
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1043592"
     polyA_signal    7283..7288
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
     polyA_site      7304
                     /gene="ANKFY1"
                     /gene_synonym="ANKHZN; BTBD23; ZFYVE14"
                     /note="The 3'-most polyA site has not been determined.
                     This is an internal polyA site."
ORIGIN      


gcacttctcgcgaggttgcaggcagtgccgggccagacatggcggaagaggaggtggccaagttggagaagcacttgatgcttctgcggcaggagtatgtcaagctgcagaagaagctggcggagacagagaagcgctgcgctctcttggctgcgcaggcaaacaaggagagcagcagcgagtccttcatcagccgtctgctggccatcgtggcagacctctacgagcaggagcagtacagatgctaatcctgaggtgacgatgacaatgcttcgctggatctatacagatgagctggagttcagagaggatgatgtgttcctgactgaactgatgaaactagcaaatcggtttcagctacagctcctcagggagagatgtgagaagggtgttatgtctctagtgaatgtcaggaactgtattcgcttctaccagacggcagaggagctgaatgccagcacactgatgaactactgtgcagaaattattgcaagtcattgggacgacctgaggaaggaggatttcagcagcatgagcgctcagttgttatacaaaatgatcaaatccaagacagagtacccgctacataaagccatcaaagtggagagagaagacgtggtcttcctgtatctgattgaaatggattcccagctccctgggaagctgaatgaagcggatcataacggagatctggcattagatctagccctctcacgacgactggagagtattgccaccacgctggttagtcacaaagctgatgtggacatggtggacaagagtggctggagcttgttacacaaaggaatccaaagaggagatctctttgctgccactttcctcattaagaatggggcctttgtcaacgctgctacactgggtgcccaggagacaccactgcaccttgtggccttgtacagttcaaagaaacactcagcagatgtgatgtctgagatggcgcagattgcagaggcccttctgcaggctggtgccaaccccaacatgcaggacagcaaggggaggactcctttacatgtgtccatcatggccgggaatgaatatgtgttcagtcagctgctgcagtgcaaacaactagatttagaactcaaagaccacgagggcagcacggctctgtggctggcagtgcagcatatcacagtgtcttctgaccagtctgtgaaccccttcgaagatgtccccgtggtaaatgggacttcatttgatgagaacagctttgcagccagactcatccagcgcggcagccacacagacgcacctgacacggcgacaggaaactgtttactacagcgggcagctggagcaggaaacgaggcagcagctcttttcctggcaaccaacggtgcccatgtcaaccacagaaacaagtggggagaaaccccgttgcacacagcgtgtcggcatggcctggccaacctcacggcagagctcctgcagcaaggcgccaacccaaacctgcagacggaggaagctctgcctctgccaaaggaggccgcatccctgaccagcttggcggacagcgtccatctgcagacgccactgcacatggcgatcgcctataaccatccggatgtggtgtctgtcatcctggagcagaaagccaatgctcttcatgccaccaacaacttgcagatcattccggacttcagcctcaaagattcccgagaccagactgtgctgggcctggcattatggactggcatgcacacgatcgcagcccagctgctgggctctggagccgccatcaatgacaccatgtcggatgggcagacgctactgcacatggccatacagcggcaggacagcaagagcgcactcttcctgctggagcaccaggcagatataaatgtcagcaggactcaggacggggagacagccctccagctggccatcagaaaccagcttccactcgtagttgatgccatatgcacccgaggagctgacatgtctgtgccagatgagaaggggaaccccccgctgtggcttgcattggcaaacaatctggaggacatcgcatccactctggtcagacatggctgtgatgccacatgctggggtccgggacctggtgggtgccttcagacgctcctgcacagagccattgatgaaaacaacgagcccaccgcctgctttcttattcgcagtggctgtgacgtgaacagtcccagacaaccaggcgccaatggagaaggagaggaagaggctagagatgggcagacccctttgcatttggcagcctcttgggggctggaagagacagtacagtgtcttctggagtttggtgccaacgtgaacgcacaggatgcagaaggaagaacccccatccacgtggccatcagcagccaacacggtgtcatcattcagctgttggtttctcaccccgatatccatttgaatgtacgagacagacaagggctgaccccgtttgcctgtgccatgactttcaagaacaacaagtcagccgaggccattctcaaacgagagtccggggctgctgagcaggtggataacaagggccggaatttccttcatgtggcagttcagaactctgatattgaaagtgtgctgttcctgatcagtgtccacgctaatgtgaattcaagagtccaggatgcctccaagttgacccccctgcacctcgctgtccaagcaggctcagaaattattgtccgcaatttgcttcttgcgggagccaaagtgaacgaattaaccaagcatcgccagactgccctccatcttgctgcccagcaggacctgcccaccatctgctcagtcctcctagagaatggcgtggactttgctgccgtggatgagaatggaaacaatgctcttcatcttgctgtcatgcacggccggctcaacaacatccgggttctcctgacagagtgcacagtggacgccgaagcctttaatctcagaggccagtcaccactgcacattttgggacaatatggcaaggagaatgcagcggccatctttgatctcttcctagaatgcatgccggggtatcctctggacaagccggatgcagacggcagcacggtgctgctcctggcatacatgaaagggaacgccaacttgtgccgcgccatcgtccggtcgggggctcgcctcggggtgaataacaaccagggagtcaacatcttcaactaccaggtcgccaccaagcagctcctgttccgactgctggatatgctgtccaaggagcctccgtggtgtgacggctcctactgctatgagtgcactgccaggttcggagtcaccactcgcaaacaccactgtcgtcactgcggacgtcttctttgccataaatgctcgaccaaggagattcctattataaagtttgatctgaacaagcctgtgcgggtttgcaacatttgttttgatgtactgactctgggtggggtttcttagtgagccccccggagggtccaggccacgtccttggtcacctccccagcagctgctctgctcaccagcctgaccccacccagagcaggagctggcgggtgtcttcctgcggcaatagactggaacgattaaggaccatggtgtgatagatcccatttcaaatgattccatatgattgtcagtgtgtgtgtcagactgtgatcgatttcactagatgtctcactcatcagaccaggccattgggcctaagtggtaaatgtgattaggaattagacctctccccattctgctagcaacatacagggacacttggaaaaccatttccccttccagtagcttggtgtccatcccagagcattcatgaagtcttcccgcctgggctgactgatgaggcagagcctctcagcgtaggaagctggctgcttaatgagctggctttactctagggtaagtggctgtggacttttctgcacagtgttttcataaagataataggatcctcttgccctgaagtctttttttctttttacgctaagctgtatttttagtgagctaccccttttaaaaaggtgaaatctttcttaacagggttcaaagatgagagctgaaaaatcgtggccttaacaactgaaagctttacagtgttcatgctactgaggtgtcaggagtgcagctgggccgcttgacacctcgtagcagccgtctcattctctcgtcttgctgcgtcctgtctgtggagtcctcagtcactctgctgttggagagtgctggaggaaatgcacttttactgtgctgcactttttatagagctgcattgtcggtgattccaatttaaaaatccatattcaaaaataccctcacacatccctgcatcagtgattctaatgatcagctttgactggacctcagctcacacgaatctccaaggaaaaactctacagagcatcttttagagcaagagattcatacaggccaagtgatgagagggggagtcaccaaggcttcagccccaagggcatctccagcctcaggccggcaggtcctatgtccttgacacaaatgcttcttgctgaaatcctccctagtgatgctgcgagtgctgttggtcccagttctgtgtagcttgccctgccccatgaagggccaccagccaagggccctggccacgtgtgcgccaccttactttggaagtctctggcttgtgtgctggatgaggctgccagaacttgttgggcgttcatcgctgttagtacatatattaaccgtgaggtgttaaacttttcttttgaaggtttggccagtttctaaaaaatgcacatttaaagagaagcatctaccacggctttaaaacaaaacaactctgagatgaacaatatgtgttatactcagagattaacaatctcaatcatacatactgattctttcagacatttaataaccactacatttttttgcattaatgaagtttgactatatgtgtaaagggactaaatatttttgcaacagcctgttctttgttcattcttttctggatagtgtgtcctctgtattgcggtagatttatacattctgttgcctaaatatgtgtgtaaaatgagctgataaactggagtactacttaaaaaaaagtctgtgatttataagatgtatatgctttctatgtgaatataagcttgtgcacaatgtttaaaagaaaaacaatgaattagaagagatcccccgtcccccagtctgacatatttcatacagaatgtttaaaagaaaaactctgctagtcttggcaaacatttggccatgtgaggcatgtggtcagtttccattttctattacctggaaagggccataaggaagcaggcagggcttaggtagcttggttacctaagttagaaagtaagagaatcatgattcggatatgaattgaagtggttggtacatggatacctgttctttaaaaggaatgtgggagatgagtcaagggtgaggccgattgttctgcccatgccctaccataccaatttcaataacaatcttgcctgtcattgcactcagaatcttaagatcatgtttcaaatatgttgattcaaacttgcttctaagcctgagtccagggatagcaatggtactgaccagctatggactgggagaacattgagtcctgttttccattggcttcagggcgcatccatgtggatataggaaaagcctctttccacagacttaggaagccccccgaccacgcggacgctcgctgggctgcactcagcaggctgcttgagtgggagctgactccaacatgccctgccctggctgggactaggcatgcttccagcccttcccgtgctctccctgctgtcaacacttgcgtacaaacctgcctagctgttgtaagttttcatcagtagcttaagtactagtagcaaaaacttaaattcattcagaaagttgccacttctgaatgagtagagcaggaaaagtaaactttactgaaacataatttgctgcaacagtcaacattgttatgctgaatgtgctctcaactgccctttgctcatcgccagatttattatccagtgtattcctaacagtcttttgttgtcgttgtttttaaaacaaaggtacggaccatgtgctatatataaatcgaatggcttaaactaatttgctatgatcctctaacaccgaaatttcccataaacttaagtgcctacacttaggacttttgaactttcagtcatctttttcgtggtgtctcactgaacgatgtgttagaacatgtgttccatttggagttttgggcctgtgcacggtcaaccccaattaccaatttagttgaggctggattcgattgctcagttcacctgccacgttctctccaaggagtggggtctacgtgacctttagtcctctacctcagagccccgagtcatttctgaccaccccgttctgtgtcctcactcttgtccctgaatgggtccctgtgtggatctcagtgtgtgtgtggtttctccactcctccccgctcatgtcccacacctgccatattgaaccgtttctgcactaatcttctccacgggcacggagtggagggaacgtcttgggaaaggggagagcttgacctccatctaggtttcttttatctggagaaaaagaacacttttgaactatgtaatgcttcaccctgaaaggcaagctaacgctaacttcccaggtgacagtagcaggaacaaggaagggtaatgtttccatgacagacacttgcttcccttgggacaagtcccagaagaactacctgaagcaccaaagctccccaccccagcctggtggcagaggaagcaggtggcaccaactcaccaaagggacttgggagccaccttctcactctgtggaagtactttagtgagagctgactggcaagataaaaaccctgaaattcccagaagttacagatgccttaaagactttctttggaagatcattgcctgtactattccttttttgtgtggcataaataatatattaacctgttacaactgacaacattggttttctgcagctagggagtcttgagtcgagactgctcgccttgatgacttgctcttttttggcagatgtgtggagttggctgttacgacatccctgtgtgatcccagaggaggggcagtagctgggcagaaactgcaggcacacatttgggtggatcacctggcttccagccccttcggggtggtgctcagtgtggggtgatggtatcatagaggaccacggcgcttatcagcattgtttctttggagtctgtgtaatggaatgtatttttcaaatactgatatttgcattttctgtaacaattccttataataaaatgaagtaaaattgtgcatttaaagtggaaactttaataagacatttgtagttacttctaatgcagaagtaccaataagcattaaaaacaaattttagaaaactcctgacgtgaataagtttcttgaccagctgccctccagaaagtttgaattccaacatttttcaggaacatgctgttgacagcagtaaaagtagctattttatgtatgtatttttaatttttaaaagtttcagtaggtttttggggttcaggtggtgtttggttacgtgaggttctttagcggtgatttccaggattttggggcacccatcacccaagcagtgtacactggacccttttatccctcaccccaaccctttcccctgagcccccaaagtccactgtatcattcttaatgcctttacgtcctcatggcttagctcccgaaaagtagttattttaaacatactagctgcctgaacttactgtgcccttggcccagatttcagctcatagcaccgagcgtgatcactgaggcagtctcagtcaccgtcacctgacccctctgaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:51479 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:51479 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:51479 -> Cellular component: GO:0010008 [endosome membrane] evidence: ISS
            GeneID:51479 -> Cellular component: GO:0043231 [intracellular membrane-bounded organelle] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.