GGRNA Home | Help | Advanced search

2019-03-23 04:02:17, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_047565               4544 bp    RNA     linear   PRI 17-JUL-2013
DEFINITION  Homo sapiens coiled-coil domain containing 129 (CCDC129),
            transcript variant 4, non-coding RNA.
ACCESSION   NR_047565
VERSION     NR_047565.1  GI:384081588
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4544)
  AUTHORS   Rose,J.E., Behm,F.M., Drgon,T., Johnson,C. and Uhl,G.R.
  TITLE     Personalized smoking cessation: interactions between nicotine dose,
            dependence and quit-success genotype score
  JOURNAL   Mol. Med. 16 (7-8), 247-253 (2010)
   PUBMED   20379614
  REMARK    GeneRIF: Clinical trial of gene-disease association and
            gene-environment interaction. (HuGE Navigator)
            Erratum:[Mol Med. 2012;18(1):729]
REFERENCE   2  (bases 1 to 4544)
  AUTHORS   Kimura,K., Wakamatsu,A., Suzuki,Y., Ota,T., Nishikawa,T.,
            Yamashita,R., Yamamoto,J., Sekine,M., Tsuritani,K., Wakaguri,H.,
            Ishii,S., Sugiyama,T., Saito,K., Isono,Y., Irie,R., Kushida,N.,
            Yoneyama,T., Otsuka,R., Kanda,K., Yokoi,T., Kondo,H., Wagatsuma,M.,
            Murakawa,K., Ishida,S., Ishibashi,T., Takahashi-Fujii,A.,
            Tanase,T., Nagai,K., Kikuchi,H., Nakai,K., Isogai,T. and Sugano,S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK128026.1, AC005090.2, AC006044.2 and BC132719.1.
            
            Transcript Variant: This variant (4) uses an alternate 5' exon
            structure, compared to variant 1. This variant is represented as
            non-coding due to the presence of an upstream ORF that is predicted
            to interfere with translation of the longest ORF; translation of
            the upstream ORF renders the transcript a candidate for
            nonsense-mediated mRNA decay (NMD).
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-234               AK128026.1         1-234
            235-537             AC005090.2         107799-108101
            538-1241            AK128026.1         538-1241
            1242-1242           AC006044.2         29077-29077
            1243-2017           AK128026.1         1243-2017
            2018-2018           AC006044.2         117022-117022
            2019-2974           BC132719.1         1508-2463
            2975-2975           AC006044.2         117979-117979
            2976-4210           AK128026.1         2976-4210
            4211-4211           AC006044.2         127539-127539
            4212-4544           AK128026.1         4212-4544
FEATURES             Location/Qualifiers
     source          1..4544
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7p14.3"
     gene            1..4544
                     /gene="CCDC129"
                     /note="coiled-coil domain containing 129"
                     /db_xref="GeneID:223075"
                     /db_xref="HGNC:27363"
     misc_RNA        1..4544
                     /gene="CCDC129"
                     /product="coiled-coil domain containing 129, transcript
                     variant 4"
                     /db_xref="GeneID:223075"
                     /db_xref="HGNC:27363"
     exon            1..974
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       27
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:373754732"
     variation       48
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:113626631"
     variation       56
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:13223005"
     variation       61
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79507561"
     misc_feature    141..455
                     /gene="CCDC129"
                     /inference="COORDINATES: ab initio prediction:ORF Finder"
                     /note="long (>35aa) upstream ORF has strong Kozak
                     sequence; nonsense-mediated decay mRNA (NMD) candidate"
     variation       155
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:112408760"
     variation       165
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185624605"
     variation       174
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188954217"
     variation       187
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:193053302"
     variation       198
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185415228"
     variation       235
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:217152"
     variation       242
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:11978226"
     variation       271
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:188894682"
     variation       277
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377430761"
     variation       293
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12701103"
     variation       311
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111451899"
     variation       319
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:111908567"
     variation       326
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12701104"
     variation       360
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:12701105"
     variation       453
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:217153"
     variation       463
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183808370"
     variation       537
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:217154"
     variation       560
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140494755"
     variation       605
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150418649"
     variation       637
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145196814"
     variation       675
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:12701106"
     variation       696
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:188188823"
     variation       698
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:73305474"
     variation       714
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:180736658"
     variation       748
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:12701107"
     variation       775
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187303262"
     variation       789
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190773785"
     variation       820
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78623479"
     variation       838
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182067798"
     exon            975..1156
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       982
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368232809"
     misc_feature    994..3684
                     /gene="CCDC129"
                     /inference="COORDINATES:
                     alignment:Blast2seq::RefSeq|NM_194300.3"
                     /note="primary ORF"
     variation       1032
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114739660"
     variation       1054
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368587451"
     variation       1061
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371959143"
     variation       1074
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147399119"
     variation       1081
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374470226"
     variation       1088
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:7811042"
     variation       1091
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143690079"
     variation       1092
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372303441"
     variation       1119
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371511395"
     variation       1135
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112921112"
     variation       1147
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376118062"
     exon            1157..1205
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1182
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200034335"
     exon            1206..1249
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1207
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372723381"
     variation       1231
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377546776"
     variation       1242
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2286711"
     variation       1243
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201211575"
     exon            1250..1301
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1259
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149696374"
     variation       1284
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145529826"
     variation       1295
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374187154"
     exon            1302..1388
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1302..1303
                     /gene="CCDC129"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35551867"
     variation       1344
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:67930674"
     variation       1345
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369866067"
     variation       1347
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146605019"
     variation       1348
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141438918"
     variation       1349
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202157240"
     variation       1353
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374063664"
     variation       1369
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201415095"
     exon            1389..1591
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1390
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370418381"
     variation       1396
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372753433"
     variation       1417
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200366088"
     variation       1444
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376020926"
     variation       1495
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370670531"
     variation       1534
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187352726"
     variation       1561
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199790271"
     variation       1577
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371060962"
     variation       1585
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191694538"
     variation       1586
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375679267"
     variation       1590
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143370840"
     exon            1592..1719
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1595
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151254328"
     variation       1621
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200848834"
     variation       1651
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140428776"
     variation       1684
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200031625"
     variation       1712
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373956174"
     exon            1720..1777
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1744
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188006642"
     variation       1775
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374799170"
     exon            1778..1860
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1821
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370130726"
     variation       1831
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367919427"
     variation       1839
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373855014"
     variation       1840
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368202210"
     exon            1861..3132
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1888
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372684457"
     variation       1889
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150398844"
     variation       1890
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185577476"
     variation       1900
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369485544"
     variation       1901
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138418545"
     variation       1908
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143912195"
     variation       1948
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201060776"
     variation       1965
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146986060"
     variation       1973
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190307572"
     variation       1990
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376801262"
     variation       1991
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138066602"
     variation       1992
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143751428"
     variation       2000
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115087893"
     variation       2018
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4141001"
     variation       2024
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182124848"
     variation       2039
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148685966"
     variation       2040
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141164020"
     variation       2059
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376345625"
     variation       2060
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200626153"
     variation       2081
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377326064"
     variation       2095
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150717357"
     variation       2120
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139246994"
     variation       2135
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144022203"
     variation       2160
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76357748"
     variation       2166
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:38396"
     variation       2194
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73686905"
     variation       2218
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77197319"
     variation       2240
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371473428"
     variation       2309
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375287000"
     variation       2330
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368084998"
     variation       2336
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116406137"
     variation       2338
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147656859"
     variation       2388
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143660819"
     variation       2401
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199508649"
     variation       2409
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201778549"
     variation       2412
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200300960"
     variation       2418
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:38397"
     variation       2451
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186727343"
     variation       2452
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375104335"
     variation       2463
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138128234"
     variation       2473
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148074341"
     variation       2492
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150134204"
     variation       2568
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200026024"
     variation       2601
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181108787"
     variation       2619
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117782044"
     variation       2691
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377002952"
     variation       2703
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185363516"
     variation       2730
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372213107"
     variation       2739
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375422464"
     variation       2805
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149320755"
     variation       2816
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141868591"
     variation       2833
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200809374"
     variation       2856
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137859522"
     variation       2896
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146267805"
     variation       2912
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369385676"
     variation       2932
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189731201"
     variation       2938
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202078186"
     variation       2947
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145959636"
     variation       2973
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139858209"
     variation       2975
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10247620"
     variation       2997
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76733226"
     variation       2998
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139431992"
     variation       3033
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150049545"
     variation       3086
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147673017"
     variation       3126
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377331865"
     variation       3131
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142323942"
     exon            3133..3260
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       3137
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201917207"
     variation       3164
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200617855"
     variation       3181
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142885665"
     variation       3182
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144601428"
     variation       3208
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7799540"
     variation       3213
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148953571"
     variation       3241
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370201894"
     exon            3261..3372
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       3270
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374114030"
     variation       3272
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143151561"
     variation       3280
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201354762"
     variation       3289
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148236609"
     variation       3290
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80081783"
     variation       3315
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141259951"
     exon            3373..4544
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       3383
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186386347"
     variation       3422
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137892596"
     variation       3485
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142389938"
     variation       3487
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377589498"
     variation       3492
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145933301"
     variation       3510
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368179579"
     variation       3511
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111514975"
     variation       3525
                     /gene="CCDC129"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:371362733"
     variation       3545
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149268880"
     variation       3549
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371944763"
     variation       3550
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115873834"
     variation       3568
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201005039"
     variation       3573
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200065011"
     variation       3584
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77915580"
     variation       3587
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374464304"
     variation       3598
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148552563"
     variation       3623
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183033798"
     variation       3632
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142016406"
     variation       3650
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34177136"
     variation       3656
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201675506"
     variation       3664
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140998733"
     variation       3693
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368704382"
     variation       3695
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201768075"
     variation       3722
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371845154"
     variation       3724
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371968855"
     variation       3726
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138001179"
     variation       3735
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369807067"
     variation       3737
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143478742"
     variation       3801
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187942842"
     variation       3837
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374773487"
     variation       3906
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:60432519"
     variation       3920
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147140713"
     variation       3934
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140268517"
     variation       4010
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371842462"
     variation       4132
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77503219"
     variation       4211
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2159513"
     variation       4221
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376168188"
     variation       4307
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182206184"
     variation       4350
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202091748"
ORIGIN      


atcctcccagaaacccagccggcttcacctctcaccaacagtggctgcgggactttccagcacctagcctgggcattcccacagcccagagggagctcgtcccagacaaccaagaggaaaagaagggaaacaagaaagagatggagacccatcattgtggccaacgaccccacgaagagggaatagcggtccacgcacgggacccagcctccgatcaagcccagcaggcgccgggtgcgcctgtgctgggaggcagagcccacgcccacccggaaccgcgccggccagcgaggtccgtgcgcagccccggctgccgcctgcgcttctccctccacacctcaccgttagcagagggagccggctccggcctcagccagccccagagacaggcccccacagcacagcggcgggctgaagggctcctcgagcgtggccagagcagacgccgaggctaaggaggtgccgagagacagcgagggctgctagcacattgtcacctctcaatactggaactcagaataagaggtctccactgttctgagttatgggagaaagatgggtgtatggtagacagaatagtgcctccccacaacaaagatgtcaacatgttactgtgtgtgttaaaagggactttgtaggtgtgagtaagttgaagatcttgagaagaaaagattatcctgggttttttgggtggggccaatgtcataaaaaggtccagataagaaagaggcagaagagtcagggtcagaggaggagccatcatgataggagcagagaagcagagtcaggagagttgatgctacactgctaactttgaagatgaagaagccacgagctatggaatggagacagcctctgaaaggcaaggagatggatttcctttagagcttccaggaaggagtgcaggcctgctaacagatacgttttagcccagtgagactaatttttagacttctgacttccaggaccgtaagtttgcagaattactctcctatgatggcacagaaatcacaaggatctgacaaccttcaggaaggccaggaaaagagcaagagagagatcctgaagtgcaccaaaagcgcgtgggctccgctggatgagtggctgccccctgaccctgaggaggaaagccagagtctcaccatccccatgctggaagattccaagcaagaaagtattcagcagtggctggactctggattctttgtctctgcaaatgaaaactttcaacaagtcattgaccgcactgtttctttgtatgaacaagggatggttcaaatgactgtgaaagactacatgagatctttgcatcagttttcagaaactcccatcctatccagagggaccagtttcaactcttgctattctactgcaagtgtaccacaaagcattcctgaatggctggaattttgggagatagatccagtggagattctcttggatctggggtttggtgctgatgagccagacatctgcatgcaaatcccagccagattccttggttgtggctcagcagccagaggaatcaacatccgtgtttttcttgaagctcaaaagcagcgaatggacattgagaaccccaacttgtacggtcgtttccgacagctggaaatcctggaccatgtgaccaatgccttctcatctctgctgagtgatgtcagcatcctgccaaacagagctgaagagaaagctggaggagagagtgtgcaaagaacctcagtccaaagctttgaagaagagactggtaatcctcttgacatgacttcaggaactgtaggtgccagggtggacagagcaaatagctgccagtctgacagcagcgggttcctggaggagccgctggaaccgctgcccctccagatgccttccttgccaaacagccagagtcctgctgagaatggaggtagaaagccaagagatcagagccacagcttagtatcatcccaggactgtcagctagagtcggatgggccagattccaaaagtagggcgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagtatctgtgatggaggaagagtttctgcttgaggccatggaggggccaccagagctgtatatcccagacatggcctgtgccaagaccaccacgaggggagaatgcccaaggaaagacagccatctgtggcagcttctgccaatgccccatgctgagtatgaggtcaccagacccacagccacttccaaatatgatcatcctctggggtttatggtaacccacgtcacagaaatgcaggacagttttgtgaggcctgagggagctggcaaagtgcaaagccaccacaatgagtctcaaaggtcacctggaaatgatcatactcaagacaagttccttcatgttgactctgaggccccacgagaagaggaaagcagtggattctgtcctcacaccaaccacagcttactcgtaccagaaagctcatcacagtgtatccccaagcacagtgaaatcacaccttatgcaactgaccttgctcaaacatctgaaaagctcattccccacctccataaactgcctggagatcctgcccaggtgaagtcaaggtctggtactttgggtcagatactacctgggacagaagctgagatggaaaaccttcctctaaatactggcagctccaggtctgtaatgacccagatgtcctccagcctggtgtcggctgctcagagggctgtggccttggggactggtcccagaggaacatctttagaatgcactgtgtgtgatcctgttaccgcaacagaaacaagactggggacaaaagcaagacagttaaatgatgcttccattcagacttcagctctaagcaacaagaccttgacacatgggccccagcccctcaccaaatccgtctctctagactcaggcttctctagtatctgcccaatgggcacctgccatgctatacctgcccactgctgcatctgctgtcatcaccaccctcactgccacggggagaggcaaagccctggccctgaaccctcagtctgtaggcactgcctgtgttcactaactggtcaccaggaagcccagttcatgacgactttgaaagcccttcaggacactacagtgagggagctatgttcctgcacagtccatgagatggaagccatgaagacgatatgccaaagtttccgggagtatttagaagaaattgaacagcaccttatgggacagcaggccctcttttccagggacatgtcagaggaggaaagggaggaggccgagcaactgcaaacgttacgtgaggccctgaggcagcaggtggcagagttggaatttcagttaggagaccgggctcagcaaatcagagaagggattttactgcagctggaggttctcacagcagagccacctgaacactattcaaatctgcatcaatataactggatagaagaaagcaatgggcagacttcatgttctaaaatccacccaggcatggccccgaggactgtgtttcctcccgatgatggccaggaggctccctgttcaggtgggacccagttggctgccttcactccacccaccttggagaacagcaccaggatgtctccttcatcatcagcttgggcaaagttaggtccaacccctttgtcaaattgtcctgttggagaaaaggatgcagatgtcttcctctagatcagagcaggtttgttaaccttcatacaaaatataaaggcccagaacagatgtagcaaggaaatttcaattttccccaaggagaagggtctgccaacccattgtcagctatatctctcatattctaccctttggttaaacccaagaggagtttagaatactctaatactcattcagtatagaataactgagcacctagtatgtgcctggcacagagtatgcaacagtgactaaatagtatacggtctctgccctgctagaacttacagtgtagtgggggagatagaattgcaaacaaaaagtatctgagacagacctcagtcaatatagaagtttattttgccaaggttaaggatacacacccagaagacaggtctgtgcctttctccaaagatgattttgaggccttcaacatttagtggggaaagggtgctaatggggaaagaggtgtgggtacataggaggcaaacagttgcatttttttgagtctgatcagcttttctcatgagagaaggggtagaggaactgtcacttatgcattcacctagctcagtggatctgcacttttacagaaggtaaaataaacatagggcagaggaagcaatcagatatgcatttgtctcgggggagcagagggatggctttgagttctgttctttgtcctgtacctattaagagaagctatcaatatactttgtcaggataaaattcaacagaactgttttagactaaagattttagggaccacaaggaatttcccagtgggcaaattgtgagggaggtatttagcttttaaaaaaatctttgtagctatctcatttagaaataaaatgggaggcagattgcctgatgcagctcct
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.