2024-03-28 19:53:16, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_037944 4653 bp RNA linear PRI 16-JUL-2013 DEFINITION Homo sapiens WNT1 inducible signaling pathway protein 1 (WISP1), transcript variant 5, non-coding RNA. ACCESSION NR_037944 VERSION NR_037944.1 GI:325910846 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 4653) AUTHORS Liu,J.F., Hou,S.M., Tsai,C.H., Huang,C.Y., Hsu,C.J. and Tang,C.H. TITLE CCN4 induces vascular cell adhesion molecule-1 expression in human synovial fibroblasts and promotes monocyte adhesion JOURNAL Biochim. Biophys. Acta 1833 (5), 966-975 (2013) PUBMED 23313051 REMARK GeneRIF: The CCN4-induced VCAM-1 expression promoted monocyte adhesion to human OASFs. REFERENCE 2 (bases 1 to 4653) AUTHORS Saxena R, Saleheen D, Been LF, Garavito ML, Braun T, Bjonnes A, Young R, Ho WK, Rasheed A, Frossard P, Sim X, Hassanali N, Radha V, Chidambaram M, Liju S, Rees SD, Ng DP, Wong TY, Yamauchi T, Hara K, Tanaka Y, Hirose H, McCarthy MI, Morris AP, Basit A, Barnett AH, Katulanda P, Matthews D, Mohan V, Wander GS, Singh JR, Mehra NK, Ralhan S, Kamboh MI, Mulvihill JJ, Maegawa H, Tobe K, Maeda S, Cho YS, Tai ES, Kelly MA, Chambers JC, Kooner JS, Kadowaki T, Deloukas P, Rader DJ, Danesh J and Sanghera DK. CONSRTM DIAGRAM; MuTHER; AGEN TITLE Genome-wide association study identifies a novel locus contributing to type 2 diabetes susceptibility in Sikhs of Punjabi origin from India JOURNAL Diabetes 62 (5), 1746-1755 (2013) PUBMED 23300278 REFERENCE 3 (bases 1 to 4653) AUTHORS Zemans,R.L., McClendon,J., Aschner,Y., Briones,N., Young,S.K., Lau,L.F., Kahn,M. and Downey,G.P. TITLE Role of beta-catenin-regulated CCN matricellular proteins in epithelial repair after inflammatory lung injury JOURNAL Am. J. Physiol. Lung Cell Mol. Physiol. 304 (6), L415-L427 (2013) PUBMED 23316072 REMARK GeneRIF: Beta-catenin-dependent expression of WISP1 and Cyr61 is critical for epithelial repair. REFERENCE 4 (bases 1 to 4653) AUTHORS Hennemeier,I., Humpf,H.U., Gekle,M. and Schwerdt,G. TITLE The food contaminant and nephrotoxin ochratoxin A enhances Wnt1 inducible signaling protein 1 and tumor necrosis factor-alpha expression in human primary proximal tubule cells JOURNAL Mol Nutr Food Res 56 (9), 1375-1384 (2012) PUBMED 22778029 REMARK GeneRIF: Prolonged exposure of kidney cells to ochratoxin A, expectable in human kidney due to a normal diet, leads to a marked ERK1/2-dependent upregulation of WISP1 gene expression, which, accompanied by increased ERK1/2- dependent TNF-alpha expression. REFERENCE 5 (bases 1 to 4653) AUTHORS Shao,H., Cai,L., Grichnik,J.M., Livingstone,A.S., Velazquez,O.C. and Liu,Z.J. TITLE Activation of Notch1 signaling in stromal fibroblasts inhibits melanoma growth by upregulating WISP-1 JOURNAL Oncogene 30 (42), 4316-4326 (2011) PUBMED 21516124 REMARK GeneRIF: This study shows that constitutive activation of the Notch1 pathway confers fibroblasts with a suppressive phenotype to melanoma growth, partially through WISP-1. REFERENCE 6 (bases 1 to 4653) AUTHORS Xie,D., Nakachi,K., Wang,H., Elashoff,R. and Koeffler,H.P. TITLE Elevated levels of connective tissue growth factor, WISP-1, and CYR61 in primary breast cancers associated with more advanced features JOURNAL Cancer Res. 61 (24), 8917-8923 (2001) PUBMED 11751417 REMARK GeneRIF: Elevated levels of connective tissue growth factor, WISP-1, and CYR61 in primary breast cancers associated with more advanced features. REFERENCE 7 (bases 1 to 4653) AUTHORS Desnoyers,L., Arnott,D. and Pennica,D. TITLE WISP-1 binds to decorin and biglycan JOURNAL J. Biol. Chem. 276 (50), 47599-47607 (2001) PUBMED 11598131 REFERENCE 8 (bases 1 to 4653) AUTHORS Tanaka,S., Sugimachi,K., Saeki,H., Kinoshita,J., Ohga,T., Shimada,M., Maehara,Y. and Sugimachi,K. TITLE A novel variant of WISP1 lacking a Von Willebrand type C module overexpressed in scirrhous gastric carcinoma JOURNAL Oncogene 20 (39), 5525-5532 (2001) PUBMED 11571650 REFERENCE 9 (bases 1 to 4653) AUTHORS Xu,L., Corcoran,R.B., Welsh,J.W., Pennica,D. and Levine,A.J. TITLE WISP-1 is a Wnt-1- and beta-catenin-responsive oncogene JOURNAL Genes Dev. 14 (5), 585-595 (2000) PUBMED 10716946 REFERENCE 10 (bases 1 to 4653) AUTHORS Pennica,D., Swanson,T.A., Welsh,J.W., Roy,M.A., Lawrence,D.A., Lee,J., Brush,J., Taneyhill,L.A., Deuel,B., Lew,M., Watanabe,C., Cohen,R.L., Melhem,M.F., Finley,G.G., Quirke,P., Goddard,A.D., Hillan,K.J., Gurney,A.L., Botstein,D. and Levine,A.J. TITLE WISP genes are members of the connective tissue growth factor family that are up-regulated in wnt-1-transformed cells and aberrantly expressed in human colon tumors JOURNAL Proc. Natl. Acad. Sci. U.S.A. 95 (25), 14717-14722 (1998) PUBMED 9843955 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK301508.1, AF192304.6 and AI347990.1. Summary: This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like domain. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. It is expressed at a high level in fibroblast cells, and overexpressed in colon tumors. The encoded protein binds to decorin and biglycan, two members of a family of small leucine-rich proteoglycans present in the extracellular matrix of connective tissue, and possibly prevents the inhibitory activity of decorin and biglycan in tumor cell proliferation. It also attenuates p53-mediated apoptosis in response to DNA damage through activation of the Akt kinase. It is 83% identical to the mouse protein at the amino acid level. Multiple alternatively spliced transcript variants have been identified. [provided by RefSeq, Mar 2011]. Transcript Variant: This variant (5) lacks internal two exons, resulting in an immature translation termination, as compared to variant 1. The transcript is a nonsense-mediated mRNA decay candidate. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1319 AK301508.1 1-1319 1320-4373 AF192304.6 66484-69537 4374-4653 AI347990.1 1-280 c FEATURES Location/Qualifiers source 1..4653 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="8" /map="8q24.22" gene 1..4653 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /note="WNT1 inducible signaling pathway protein 1" /db_xref="GeneID:8840" /db_xref="HGNC:12769" /db_xref="MIM:603398" misc_RNA 1..4653 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /product="WNT1 inducible signaling pathway protein 1, transcript variant 5" /db_xref="GeneID:8840" /db_xref="HGNC:12769" /db_xref="MIM:603398" exon 1..175 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /inference="alignment:Splign:1.39.8" variation 22 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:35244636" variation 55 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:116716037" variation 58 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:113859079" variation 60 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:201515187" variation 76 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:370168550" variation 77 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:373840690" misc_feature 107..217 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /inference="COORDINATES: alignment:Blast2seq::RefSeq|NM_001204870.1" /note="primary ORF has stop codon >50 nucleotides from the terminal splice site; nonsense-mediated decay (NMD) candidate" variation 128 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:145302227" variation 130 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:147864416" variation 134 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:141541463" variation 135 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:147047617" variation 140 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:145240649" variation 144 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:149172980" variation 155 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:375956639" variation 174 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:370536589" variation 175 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:374241755" exon 176..369 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /inference="alignment:Splign:1.39.8" variation 178 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:35513885" variation 179 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:369847225" variation 192 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:141179228" variation 198 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="t" /db_xref="dbSNP:377427275" variation 236 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:373574457" variation 247 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:199564945" variation 255 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:150744504" variation 256 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:139602125" variation 284 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:199672029" variation 291 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:201767438" variation 292 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:200522670" variation 315 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:200030526" variation 319 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:370235023" variation 335 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:201197950" variation 343 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:202087900" variation 360 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:113292639" exon 370..4649 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /inference="alignment:Splign:1.39.8" variation 413 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:370616029" variation 420 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:35938742" variation 428 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:374293123" variation 429 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:34279368" variation 458 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:368398252" variation 462 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:150347257" variation 486 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:3739261" variation 501 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:369316693" variation 535 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:200845163" variation 560 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:371947572" variation 570 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:34665171" variation 621 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:146812236" variation 663 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:140629356" variation 671 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:192420341" variation 691 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:200836970" variation 696 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:374163879" variation 814 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:138013484" variation 924 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:57390041" variation 1038 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="a" /db_xref="dbSNP:142394577" variation 1120 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:113549310" variation 1145 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:184580529" variation 1262 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:190313906" variation 1310 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:142461254" variation 1413 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:2929969" variation 1639 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:12164193" variation 1648 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:145960909" variation 1654 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:73362554" variation 1723 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="c" /db_xref="dbSNP:182003497" variation 1802 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:4265166" variation 1853 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:2929970" variation 1922 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:374010309" variation 1927 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:4577938" variation 2018 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="t" /db_xref="dbSNP:377032724" variation 2132 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:146162433" variation 2187 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:185849289" variation 2483 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:188945068" variation 2492 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:181057409" variation 2495 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:148796937" variation 2716 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:117072299" variation 2749 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:2977549" variation 3052 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:73362557" variation 3054 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:76779268" variation 3088 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:2929971" variation 3095 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:373530385" variation 3119 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:142427022" variation 3171 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:2929972" variation 3224 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:2929973" variation 3248 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:151300566" variation 3396 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:16904856" variation 3427..3428 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="c" /db_xref="dbSNP:36017627" variation 3483 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:370468302" variation 3525 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:2977550" variation 3640 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:9649971" variation 3642 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:186406622" variation 3672 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:16904857" variation 3761 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:191533905" variation 3795 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:200715437" variation 3823 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:145461011" variation 3964 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:16904858" variation 4072 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:114925013" variation 4082 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:16904859" variation 4138 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="t" /db_xref="dbSNP:73711826" variation 4140..4141 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="g" /db_xref="dbSNP:35647766" variation 4145 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:16904860" variation 4158..4161 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="ctga" /db_xref="dbSNP:372155216" variation 4160..4163 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="" /replace="gact" /db_xref="dbSNP:367926394" variation 4184 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:182511484" variation 4201 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:186242527" variation 4247 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="g" /db_xref="dbSNP:74818902" variation 4266 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="c" /replace="t" /db_xref="dbSNP:2977551" variation 4378 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="g" /replace="t" /db_xref="dbSNP:147688784" variation 4390 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:191950359" variation 4555 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" /replace="a" /replace="g" /db_xref="dbSNP:77866098" polyA_signal 4627..4632 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" polyA_site 4649 /gene="WISP1" /gene_synonym="CCN4; WISP1c; WISP1i; WISP1tc" ORIGIN
atatctggtgctcctgatgggccggccagtctgggcccagctcccccgagaggtggtcggatcctctgggctgctcggtcgatgcctgtgccactgacgtccaggcatgaggtggttcctgccctggacgctggcagcagtgacagcagcagccgccagcaccgtcctggccacgatgctgtgggtgaggtggaggcatggcacaggaactgcatagcctacacaagcccctggagcccttgctccaccagctgcggcctgggggtctccactcggatctccaatgttaacgcccagtgctggcctgagcaagagagccgcctctgcaacttgcggccatgcgatgtggacatccatacactcattaaggcagggaagaagtgtctggctgtgtaccagccagaggcatccatgaacttcacacttgcgggctgcatcagcacacgctcctatcaacccaagtactgtggagtttgcatggacaataggtgctgcatcccctacaagtctaagactatcgacgtgtccttccagtgtcctgatgggcttggcttctcccgccaggtcctatggattaatgcctgcttctgtaacctgagctgtaggaatcccaatgacatctttgctgacttggaatcctaccctgacttctcagaaattgccaactaggcaggcacaaatcttgggtcttggggactaacccaatgcctgtgaagcagtcagcccttatggccaataacttttcaccaatgagccttagttaccctgatctggacccttggcctccatttctgtctctaaccattcaaatgacgcctgatggtgctgctcaggcccatgctatgagttttctccttgatatcattcagcatctactctaaagaaaaatgcctgtctctagctgttctggactacacccaagcctgatccagcctttccaagtcactagaagtcctgctggatcttgcctaaatcccaagaaatggaatcaggtagacttttaatatcactaatttcttctttagatgccaaaccacaagactctttgggtccattcagatgaatagatggaatttggaacaatagaataatctattatttggagcctgccaagaggtactgtaatgggtaattctgacgtcagcgcaccaaaactatcctgattccaaatatgtatgcacctcaaggtcatcaaacatttgccaagtgagttgaatagttgcttaattttgatttttaatggaaagttgtatccattaacctgggcattgttgaggttaagtttctcttcacccctacactgtgaagggtacagattaggtttgtcccagtcagaaataaaatttgataaacattcctgttgatgggaaaagcccccagttaatactccagagacagggaaaggtcagcccgtttcagaaggaccaattgactctcacactgaatcagctgctgactggcagggctttgggcagttggccaggctcttccttgaatcttctcccttgtcctgcttggggttcataggaattggtaaggcctctggactggcctgtctggcccctgagagtggtgccctggaacactcctctactcttacagagccttgagagacccagctgcagaccatgccagacccactgaaatgaccaagacaggttcaggtaggggtgtgggtcaaaccaagaagtgggtgcccttggtagcagcctggggtgacctctagagctggaggctgtgggactccaggggcccccgtgttcaggacacatctattgcagagactcatttcacagcctttcgttctgctgaccaaatggccagttttctggtaggaagatggaggtttaccggttgtttagaaacagaaatagacttaataaaggtttaaagctgaagaggttgaagctaaaaggaaaaggttgttgttaatgaatatcaggctattatttattgtattaggaaaatataatatttactgttagaattcttttatttagggccttttctgtgccagacattgctctcagtgctttgcatgtattagctcactgaatcttcacgacaatgttgagaagttcccattattatttctgttcttacaaatgtgaaacggaagctcatagaggtgagaaaactcaaccagagtcacccagttggtgactgggaaagttaggattcagatcgaaattggactgtctttataacccatattttccccctgtttttagagcttccaaatgtgtcagaataggaaaacattgcaataaatggcttgattttttaatgtcatttttccctcttatagtctttctagctccttttcaaaagacgagaatatctgattttctgataatttaggtgcttaagcatccaaaatacatgggacacacaaaaatccaggaatcccctgtagcttattccctctttcccatcggaaccagctctcatcacacatttaaaagatgattctgtttacccaatgctgcatattgaatgttgtgtagttattcacagggaattctgtgcagtgtgcagagagattcctaaacgggaaaaggactgggaatacatcctccttactgtgacctccccaaaacctagtccagtgcaaggtatacagtggtgctcattaaatacttgatgaatacaggaagctgtgcatgtgttcctacttttattcgaagctctcttcttccaaagctacatgaaaatagaattttaacagtcaaaattttatattaagtgccttagcaaaagagacatttaatatttcaaagaaatgcatatgtatgtatacatatatttgtgtatgcgtatgcaagaattcttgtataaagagaattcactccatgaatgatctcttctgtaagtcagtgtgaatcatgttagattttctgagagtgaaaacacctgccatctacaaattacaaggctggataacagctcactccatttgaaattcagtggaaacccaagagctaggttcttactgaatttgcatctcaatttgggaaactgaacttagctttcaaagatcataggaagtctggttggagaaactagggattattctggcaatgggtgcaggaaggtggtcagaataacccagtcgccattggttttgagaaacggaactatcttatgcagagcccggagggcaagtctcagacccatgggttgaagccatggagaaggaaatttggatccaatgtaatgaagcgctttctaagtcagaatttccctgcaatggtgtggcctgattcaataaaaattaagaataataaatataatggaaaaaaatctccactgattgagtgtttacttggtgccaagcactatgctaagttgttcattattttatttaattgttacagcaattttgagtatgcatctttcactattttataagtggaaaagagaagtgcccccaaaaagttagagctcaaacagcagcttattctaccagcccctgctcttgcggaggcctctggaaaagacctgaatgacacctattggagaattacatctacaaggggcttcaaacagaccaaatagatcatcacctctgtggtcccttgttaactatatgttctgagacaaaggaaagctaccctaagggttagttaacctttgctgaggaaatttacattcatacttagagtgaattactcaggtgtgcttaggtgtgcaaaagggaaggagacctgaattcaccaagttaaatcttgctaaaccttatcataagcattttttgagcgcttagcatacaccaagccttgtggaaggtgctttcctgccatatctcatttaatcctcacagcaaacctatagaatatggcattatcatctgagtctcacagaagtttagtcgtgtactcaaggtcttaccagctagtgaacagcagaccaagactggaaacccaggatagtctgatacctgagccatctcttcttgtgctacgcctagttattctgtcccccaaatcaaaaggcatgacctttataagaggcgctttactgacaatagctgcaattttaactttgaaaatgattcagaattatcaaagatagtagattcgaatgacatgattgtctataatctcgctagccttgtactgtgtgtgcatagcaattacagggaagtaatctagctcctgactattatgttgaactatgtcgctgctttttacaaacttgtcttgatccaaagcagtcacaatgataaccctgcatatctgggaatcataagtcaactatgtatccctgtgtgtgtatatatatgtatgtatgtatctattttcaaactgtgatttaatatttaaatattcctactgccatttttgtgactgaaaaactacacatgaggaaacgtcttagaattttccaatagaggaaaaataacacttgggcaatctgtcatgtttcacaacagttctcatttttctcatgatttgtgtagcgtggaatgtgtttgctcaatgtgaagggttttcattgctcaatttctctgtgtaagtcttttccttaaggtaataaaccatcagcaaagtcacatactggagttggtggcttttcttgtacaggcagttgttatgagacaatgatggagcattgagcatgttcaataaatgtgcagatggtggaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:8840 -> Molecular function: GO:0005520 [insulin-like growth factor binding] evidence: IEA GeneID:8840 -> Biological process: GO:0001558 [regulation of cell growth] evidence: IEA GeneID:8840 -> Biological process: GO:0007155 [cell adhesion] evidence: IEA GeneID:8840 -> Biological process: GO:0007165 [signal transduction] evidence: TAS GeneID:8840 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS GeneID:8840 -> Biological process: GO:0016055 [Wnt receptor signaling pathway] evidence: IEA GeneID:8840 -> Cellular component: GO:0005615 [extracellular space] evidence: NAS GeneID:8840 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.