2024-04-19 14:04:34, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_033519 3952 bp RNA linear PRI 16-JUL-2013 DEFINITION Homo sapiens mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor) (MASP1), transcript variant 4, non-coding RNA. ACCESSION NR_033519 VERSION NR_033519.1 GI:294997263 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3952) AUTHORS Megyeri,M., Harmat,V., Major,B., Vegh,A., Balczer,J., Heja,D., Szilagyi,K., Datz,D., Pal,G., Zavodszky,P., Gal,P. and Dobo,J. TITLE Quantitative characterization of the activation steps of mannan-binding lectin (MBL)-associated serine proteases (MASPs) points to the central role of MASP-1 in the initiation of the complement lectin pathway JOURNAL J. Biol. Chem. 288 (13), 8922-8934 (2013) PUBMED 23386610 REMARK GeneRIF: autoactivation of MASP-1 is crucial for the activation of MBL/ficolin.MASP complexes, and in the proenzymic phase zymogen MASP-1 controls the process REFERENCE 2 (bases 1 to 3952) AUTHORS Sekine,H., Takahashi,M., Iwaki,D. and Fujita,T. TITLE The role of MASP-1/3 in complement activation JOURNAL Adv. Exp. Med. Biol. 735, 41-53 (2013) PUBMED 23402018 REMARK GeneRIF: MASP-1 seems to be involved in activation of both the lectin and alternative complement pathways--{review} Review article REFERENCE 3 (bases 1 to 3952) AUTHORS Degn,S.E., Jensen,L., Hansen,A.G., Duman,D., Tekin,M., Jensenius,J.C. and Thiel,S. TITLE Mannan-binding lectin-associated serine protease (MASP)-1 is crucial for lectin pathway activation in human serum, whereas neither MASP-1 nor MASP-3 is required for alternative pathway function JOURNAL J. Immunol. 189 (8), 3957-3969 (2012) PUBMED 22966085 REMARK GeneRIF: A crucial role of MASP-1 is demonstrated in the activation of MASP-2, as well as of MASP-3, based on a patient harboring a nonsense mutation in the common part of the MASP1 gene. REFERENCE 4 (bases 1 to 3952) AUTHORS Skjoedt,M.O., Roversi,P., Hummelshoj,T., Palarasah,Y., Rosbjerg,A., Johnson,S., Lea,S.M. and Garred,P. TITLE Crystal structure and functional characterization of the complement regulator mannose-binding lectin (MBL)/ficolin-associated protein-1 (MAP-1) JOURNAL J. Biol. Chem. 287 (39), 32913-32921 (2012) PUBMED 22854970 REMARK GeneRIF: MAP-1 competes with all three MASPs for ligand binding and is able to mediate a strong dose-dependent inhibitory effect on the lectin pathway activation, as measured by levels of C3 and C9. REFERENCE 5 (bases 1 to 3952) AUTHORS Heja,D., Kocsis,A., Dobo,J., Szilagyi,K., Szasz,R., Zavodszky,P., Pal,G. and Gal,P. TITLE Revised mechanism of complement lectin-pathway activation revealing the role of serine protease MASP-1 as the exclusive activator of MASP-2 JOURNAL Proc. Natl. Acad. Sci. U.S.A. 109 (26), 10498-10503 (2012) PUBMED 22691502 REMARK GeneRIF: MASP-1 activates MASP-2 and, moreover, inhibition of MASP-1 prevents autoactivation of MASP-2 REFERENCE 6 (bases 1 to 3952) AUTHORS Endo,M., Ohi,H., Ohsawa,I., Fujita,T., Matsushita,M. and Fujita,T. TITLE Glomerular deposition of mannose-binding lectin (MBL) indicates a novel mechanism of complement activation in IgA nephropathy JOURNAL Nephrol. Dial. Transplant. 13 (8), 1984-1990 (1998) PUBMED 9719152 REFERENCE 7 (bases 1 to 3952) AUTHORS Endo,Y., Sato,T., Matsushita,M. and Fujita,T. TITLE Exon structure of the gene encoding the human mannose-binding protein-associated serine protease light chain: comparison with complement C1r and C1s genes JOURNAL Int. Immunol. 8 (9), 1355-1358 (1996) PUBMED 8921412 REFERENCE 8 (bases 1 to 3952) AUTHORS Takada,F., Seki,N., Matsuda,Y., Takayama,Y. and Kawakami,M. TITLE Localization of the genes for the 100-kDa complement-activating components of Ra-reactive factor (CRARF and Crarf) to human 3q27-q28 and mouse 16B2-B3 JOURNAL Genomics 25 (3), 757-759 (1995) PUBMED 7759119 REFERENCE 9 (bases 1 to 3952) AUTHORS Sato,T., Endo,Y., Matsushita,M. and Fujita,T. TITLE Molecular characterization of a novel serine protease involved in activation of the complement system by mannose-binding protein JOURNAL Int. Immunol. 6 (4), 665-669 (1994) PUBMED 8018603 REFERENCE 10 (bases 1 to 3952) AUTHORS Takada,F., Takayama,Y., Hatsuse,H. and Kawakami,M. TITLE A new member of the C1s family of complement proteins found in a bactericidal factor, Ra-reactive factor, in human serum JOURNAL Biochem. Biophys. Res. Commun. 196 (2), 1003-1009 (1993) PUBMED 8240317 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from DC423174.1, AK304334.1, AC007920.18, AF284421.1 and AI278088.1. Summary: This gene encodes a serine protease that functions as a component of the lectin pathway of complement activation. The complement pathway plays an essential role in the innate and adaptive immune response. The encoded protein is synthesized as a zymogen and is activated when it complexes with the pathogen recognition molecules of lectin pathway, the mannose-binding lectin and the ficolins. This protein is not directly involved in complement activation but may play a role as an amplifier of complement activation by cleaving complement C2 or by activating another complement serine protease, MASP-2. The encoded protein is also able to cleave fibrinogen and factor XIII and may may be involved in coagulation. A splice variant of this gene which lacks the serine protease domain functions as an inhibitor of the complement pathway. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]. Transcript Variant: This variant (4) has multiple differences, compared to variant 1. This variant is represented as non-coding because the use of the supported translational start codon, as used in variant 1, renders the transcript a candidate for nonsense-mediated mRNA decay (NMD). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-290 DC423174.1 1-290 291-1531 AK304334.1 1-1241 1532-1532 AC007920.18 125359-125359 1533-2590 AK304334.1 1243-2300 2591-3945 AF284421.1 2523-3877 3946-3952 AI278088.1 1-7 c FEATURES Location/Qualifiers source 1..3952 /organism="Homo sapiens" /mol_type="transcribed RNA" /db_xref="taxon:9606" /chromosome="3" /map="3q27-q28" gene 1..3952 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /note="mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)" /db_xref="GeneID:5648" /db_xref="HGNC:6901" /db_xref="MIM:600521" misc_RNA 1..3952 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /product="mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor), transcript variant 4" /db_xref="GeneID:5648" /db_xref="HGNC:6901" /db_xref="MIM:600521" exon 1..395 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 325 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:72549255" misc_feature 391..399 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="COORDINATES: alignment:Blast2seq::RefSeq|NM_001879.5" /note="primary ORF has stop codon >50 nucleotides from the terminal splice site; nonsense-mediated decay (NMD) candidate" exon 396..573 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 574..705 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 575 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549252" variation 624 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:200376787" exon 706..902 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 795 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:28945069" variation 861 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="g" /db_xref="dbSNP:3203210" variation 889 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:28945071" exon 903..1050 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 1051..1169 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 1170..1248 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" exon 1249..1386 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 1283 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:34207306" exon 1387..1461 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 1435 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:28945068" exon 1462..3947 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /inference="alignment:Splign:1.39.8" variation 1532 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:710452" variation 1544 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:35384947" variation 1842 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="g" /db_xref="dbSNP:72549155" variation 1885 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="g" /replace="t" /db_xref="dbSNP:72549154" variation 2009 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:850312" variation 2036 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="t" /db_xref="dbSNP:710458" variation 2054 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:710457" variation 2078 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:710456" variation 2591 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="g" /db_xref="dbSNP:850313" variation 2668 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549263" variation 2903 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="g" /db_xref="dbSNP:72549262" variation 2912 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549261" variation 2979 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549260" variation 3229 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:1109452" variation 3248 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="g" /db_xref="dbSNP:72549168" variation 3319 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="g" /replace="t" /db_xref="dbSNP:1317971" variation 3442 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="g" /db_xref="dbSNP:72549167" variation 3533 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="t" /db_xref="dbSNP:72549166" variation 3595 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="t" /db_xref="dbSNP:72549175" variation 3790 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="t" /db_xref="dbSNP:72549174" variation 3846 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="c" /replace="g" /db_xref="dbSNP:72549173" variation 3869 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" /replace="a" /replace="c" /db_xref="dbSNP:2679547" polyA_signal 3923..3928 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" polyA_site 3947 /gene="MASP1" /gene_synonym="3MC1; CRARF; CRARF1; MAP1; MAp44; MASP; MASP3; PRSS5; RaRF" ORIGIN
acacacagagtgatacaaatacctgcttgagcccctcagttattttctctcaagggctgaagtcagccacacaggataaaggagggaagggaaggagcagatcttttcggtaggaagacagattttgttgtcaggttcctgggagtgcaagagcaagtcaaaggagagagagaggagagaggaaaagccagagggagagagggggagaggggatctgttgcaggcaggggaaggcgtgacctgaatggagaatgccagccaattccagagacacacagggacctcagaacaaagataaggcatcacggacaccacaccgggcacgagctcacaggcaagtcaagctgggaggaccaaggccgggcagccgggagcacccaaggcaggaaaatgaggtagaaactgaggaccaggtgctggcaaccttctgtggcagggagaccacagacacagagcagactcccggccaggaggtggtcctctcccctggctccttcatgtccatcactttccggtcagatttctccaatgaggagcgtttcacaggctttgatgcccactacatggctgtggatgtggacgagtgcaaggagagggaggacgaggagctgtcctgtgaccactactgccacaactacattggcggctactactgctcctgccgcttcggctacatcctccacacagacaacaggacctgccgagtggagtgcagtgacaacctcttcactcaaaggactggggtgatcaccagccctgacttcccaaacccttaccccaagagctctgaatgcctgtataccatcgagctggaggagggtttcatggtcaacctgcagtttgaggacatatttgacattgaggaccatcctgaggtgccctgcccctatgactacatcaagatcaaagttggtccaaaagttttggggcctttctgtggagagaaagccccagaacccatcagcacccagagccacagtgtcctgatcctgttccatagtgacaactcgggagagaaccggggctggaggctctcatacagggctgcaggaaatgagtgcccagagctacagcctcctgtccatgggaaaatcgagccctcccaagccaagtatttcttcaaagaccaagtgctcgtcagctgtgacacaggctacaaagtgctgaaggataatgtggagatggacacattccagattgagtgtctgaaggatgggacgtggagtaacaagattcccacctgtaaaattgtagactgtagagccccaggagagctggaacacgggctgatcaccttctctacaaggaacaacctcaccacatacaagtctgagatcaaatactcctgtcaggagccctattacaagatgctcaacaataacacaggtatatatacctgttctgcccaaggagtctggatgaataaagtattggggagaagcctacccacctgccttccagagtgtggtcagccctcccgctccctgccaagcctggtcaagaggatcattgggggccgaaatgctgagcctggcctcttcccgtggcaggccctgatagtggtggaggacacttcgagagtgccaaatgacaagtggtttgggagtggggccctgctctctgcgtcctggatcctcacagcagctcatgtgctgcgctcccagcgtagagacaccacggtgataccagtctccaaggagcatgtcaccgtctacctgggcttgcatgatgtgcgagacaaatcgggggcagtcaacagctcagctgcccgagtggtgctccacccagacttcaacatccaaaactacaaccacgatatagctctggtgcagctgcaggagcctgtgcccctgggaccccacgttatgcctgtctgcctgccaaggcttgagcctgaaggcccggccccccacatgctgggcctggtggccggctggggcatctccaatcccaatgtgacagtggatgagatcatcagcagtggcacacggaccttgtcagatgtcctgcagtatgtcaagttacccgtggtgcctcacgctgagtgcaaaactagctatgagtcccgctcgggcaattacagcgtcacggagaacatgttctgtgctggctactacgagggcggcaaagacacgtgccttggagatagcggtggggcctttgtcatctttgatgacttgagccagcgctgggtggtgcaaggcctggtgtcctgggggggacctgaagaatgcggcagcaagcaggtctatggagtctacacaaaggtctccaattacgtggactgggtgtgggagcagatgggcttaccacaaagtgttgtggagccccaggtggaacggtgagctgacttacttcctcggggcctgcctcccctgagcgaagctacaccgcacttccgacagcacactccacattacttatcagaccatatggaatggaacacactgacctagcggtggcttctcctaccgagacagcccccaggaccctgagaggcagagtgtggtatagggaaaaggctccaggcaggagacctgtgttcctgagcttgtccaagtctctttccctgtctgggcctcactctaccgagtaatacaatgcaggagctcaaccaaggcctctgtgccaatcccagcactcctttccaggccatgcttcttaccccagtggcctttattcactcctgaccacttatcaaacccatcggtcctactgttggtataactgagcttggacctgactattagaaaatggtttctaacattgaactgaatgccgcatctgtatattttcctgctctgccttctgggactagccttggcctaatccttcctctaggagaagagcattcaggttttgggagatggctcatagccaagcccctctctcttagtgtgatcccttggagcaccttcatgcctggggtttctctcccaaaagcttcttgcagtctaagccttatcccttatgttccccattaaaggaatttcaaaagacatggagaaagttgggaaggtttgtgctgactgctgggagcagaatagccgtgggaggcccaccaagcccttaaattcccattgtcaactcagaacacatttgggcccatatgccaccctggaacaccagctgacaccatgggcgtccacacctgctgctccagacaagcacaaagcaatctttcagccttgaaatgtattatctgaaaggctacctgaagcccaggcccgaatatggggacttagtcgattacctggaaaaagaaaagacccacactgtgtcctgctgtgcttttgggcaggaaaatggaagaaagagtggggtgggcacattagaagtcacccaaatcctgccaggctgcctggcatccctggggcatgagctgggcggagaatccaccccgcaggatgttcagagggacccactccttcatttttcagagtcaaaggaatcagaggctcacccatggcaggcagtgaaaagagccaggagtcctgggttctagtccctgctctgcccccaactggctgtataacctttgaaaaatcattttctttgtctgagtctctggttctccgtcagcaacaggctggcataaggtcccctgcaggttccttctagctggagcactcagagcttccctgactgctagcagcctctctggccctcacagggctgattgttctccttctccctggagctctctctcctgaaaatctccatcagagcaaggcagccagagaagcccctgagagggaatgattgggaagtgtccactttctcaaccggctcatcaaacacactcctttgtctatgaatggcacatgtaaatgatgttatattttgtatcttttatatcatatgcttcaccattctgtaaagggcctctgcattgttgctcccatcaggggtctcaagtggaaataaaccctcgtggataaccaacaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:5648 -> Molecular function: GO:0004252 [serine-type endopeptidase activity] evidence: IDA GeneID:5648 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IDA GeneID:5648 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:5648 -> Molecular function: GO:0008233 [peptidase activity] evidence: IDA GeneID:5648 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI GeneID:5648 -> Molecular function: GO:0048306 [calcium-dependent protein binding] evidence: IPI GeneID:5648 -> Biological process: GO:0001867 [complement activation, lectin pathway] evidence: IMP GeneID:5648 -> Biological process: GO:0001867 [complement activation, lectin pathway] evidence: TAS GeneID:5648 -> Biological process: GO:0006508 [proteolysis] evidence: IEA GeneID:5648 -> Biological process: GO:0006956 [complement activation] evidence: TAS GeneID:5648 -> Biological process: GO:0045087 [innate immune response] evidence: TAS GeneID:5648 -> Biological process: GO:0045916 [negative regulation of complement activation] evidence: IDA GeneID:5648 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS GeneID:5648 -> Cellular component: GO:0005615 [extracellular space] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.