Home |
Help |
Advanced search
2024-04-25 15:48:34, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_028361 999 bp RNA linear PRI 16-JUL-2013
DEFINITION Homo sapiens gametogenetin binding protein 1 (pseudogene) (GGNBP1),
non-coding RNA.
ACCESSION NR_028361 XM_001721177 XM_001721286 XM_001724454
VERSION NR_028361.1 GI:256574800
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 999)
AUTHORS Bailey SD, Xie C, Do R, Montpetit A, Diaz R, Mohan V, Keavney B,
Yusuf S, Gerstein HC, Engert JC and Anand S.
CONSRTM DREAM investigators
TITLE Variation at the NFATC2 locus increases the risk of
thiazolidinedione-induced edema in the Diabetes REduction
Assessment with ramipril and rosiglitazone Medication (DREAM) study
JOURNAL Diabetes Care 33 (10), 2250-2253 (2010)
PUBMED 20628086
REMARK GeneRIF: Observational study of gene-disease association,
gene-environment interaction, and pharmacogenomic / toxicogenomic.
(HuGE Navigator)
REFERENCE 2 (bases 1 to 999)
AUTHORS Talmud PJ, Drenos F, Shah S, Shah T, Palmen J, Verzilli C, Gaunt
TR, Pallas J, Lovering R, Li K, Casas JP, Sofat R, Kumari M,
Rodriguez S, Johnson T, Newhouse SJ, Dominiczak A, Samani NJ,
Caulfield M, Sever P, Stanton A, Shields DC, Padmanabhan S,
Melander O, Hastie C, Delles C, Ebrahim S, Marmot MG, Smith GD,
Lawlor DA, Munroe PB, Day IN, Kivimaki M, Whittaker J, Humphries SE
and Hingorani AD.
CONSRTM ASCOT investigators; NORDIL investigators; BRIGHT Consortium
TITLE Gene-centric association signals for lipids and apolipoproteins
identified via the HumanCVD BeadChip
JOURNAL Am. J. Hum. Genet. 85 (5), 628-642 (2009)
PUBMED 19913121
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 3 (bases 1 to 999)
AUTHORS Zhou,Y., Zhao,Q., Bishop,C.E., Huang,P. and Lu,B.
TITLE Identification and characterization of a novel testicular germ
cell-specific gene Ggnbp1
JOURNAL Mol. Reprod. Dev. 70 (3), 301-307 (2005)
PUBMED 15625700
REMARK GeneRIF: A testicular germ cell-specific protein interacting with
GGN1. The protein seems to associate with the membrane system in
the germ cell.
REFERENCE 4 (bases 1 to 999)
AUTHORS Zhang,J., Wang,Y., Zhou,Y., Cao,Z., Huang,P. and Lu,B.
TITLE Yeast two-hybrid screens imply that GGNBP1, GGNBP2 and OAZ3 are
potential interaction partners of testicular germ cell-specific
protein GGN1
JOURNAL FEBS Lett. 579 (2), 559-566 (2005)
PUBMED 15642376
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from Z93017.6 and AY383627.1.
On or before Aug 27, 2009 this sequence version replaced
gi:169168948, gi:169169538, gi:169168616.
Summary: This gene is the ortholog of the mouse
gametogenetin-binding protein 1 gene. In human, the open reading
frame is disrupted by a nonsense mutation after 8-aa; consequently,
this gene is currently considered to be a unitary pseudogene in
human even though it is functional in other mammals. [provided by
RefSeq, Aug 2009].
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on alignments.
##Evidence-Data-START##
Transcript exon combination :: AY383627.1 [ECO:0000332]
##Evidence-Data-END##
##RefSeq-Attributes-START##
unitary pseudogene :: inferred protein-coding ortholog GeneID:
70772
##RefSeq-Attributes-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-39 Z93017.6 91129-91167
40-999 AY383627.1 1-960
FEATURES Location/Qualifiers
source 1..999
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="6"
/map="6p21"
gene 1..999
/gene="GGNBP1"
/note="gametogenetin binding protein 1 (pseudogene)"
/pseudo
/db_xref="GeneID:449520"
/db_xref="HGNC:19427"
/db_xref="MIM:609495"
misc_RNA 1..999
/gene="GGNBP1"
/product="gametogenetin binding protein 1 (pseudogene)"
/pseudo
/db_xref="GeneID:449520"
/db_xref="HGNC:19427"
/db_xref="MIM:609495"
exon 1..372
/gene="GGNBP1"
/inference="alignment:Splign:1.39.8"
/pseudo
variation 39
/gene="GGNBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:530878"
variation 120
/gene="GGNBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:191388362"
variation 218
/gene="GGNBP1"
/replace="g"
/replace="t"
/db_xref="dbSNP:374244208"
variation 236
/gene="GGNBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:376285103"
variation 296
/gene="GGNBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:79996832"
variation 343
/gene="GGNBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:112237716"
exon 373..485
/gene="GGNBP1"
/inference="alignment:Splign:1.39.8"
/pseudo
exon 486..634
/gene="GGNBP1"
/inference="alignment:Splign:1.39.8"
/pseudo
variation 524
/gene="GGNBP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:141621952"
exon 635..766
/gene="GGNBP1"
/inference="alignment:Splign:1.39.8"
/pseudo
variation 640
/gene="GGNBP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:74449185"
variation 707
/gene="GGNBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:115275555"
variation 723
/gene="GGNBP1"
/replace="a"
/replace="c"
/db_xref="dbSNP:138682210"
variation 728
/gene="GGNBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142844078"
exon 767..885
/gene="GGNBP1"
/inference="alignment:Splign:1.39.8"
/pseudo
variation 780
/gene="GGNBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:115004013"
variation 817
/gene="GGNBP1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376146249"
exon 886..999
/gene="GGNBP1"
/inference="alignment:Splign:1.39.8"
/pseudo
variation 907
/gene="GGNBP1"
/replace="a"
/replace="g"
/db_xref="dbSNP:183981527"
ORIGIN
atggaggccccagctccgaagccctgatcatgaatttcaggctgctcctccatgttccgccaccagggtgccatttccctgatgatgagccaagagggacatgtgaggaggagggggccgggaccatctgccttgccgccccaccccttctctgtggccatacccaggggcttctcaaaacggtcacagcagcctcccttaaagctgggcatggggcgtatggtgacctacacctgcaagagcaagaaggcctggcggagaggtgaagtcagttctgcccatagcaagccaggaggtgttgggcaacctgcctgagaaggaggggaaggagccagcaggggacgcctctgggaaaacaggggcctcagacagcagccactttatccagatcctgcagttgaaggaagaatacctgcagagagccacagggccccgtgaggtcagccctgagccctccaccagggagaaggagtgtctgcttgaaggcctggaccaccccacttgctgccagcctgtcagtgaccaccacccattcacaggagactgcgtgttggcctcttccagggtggaggcaactccttggaaccacttccacagtttggacaaggagcttcaaaactcggccatggccaaggtttgcccagcgaggagaaaagtgaggaagagaaaatgaaggaagaggacagctcattcaagctctgtgtcccaggcattgttgccctccagtcgccaccgaacaaggctttcagatccacagacacagtgggtttcctggagtcggagttgaagaagcttctgggaatgcagcaagagtcccgcctctggaagctaggcagccaagagggccgagagctgcttacccggccagagatcaccgtggtggagggagaaggttatgaggtgcagagaagactgaggcatcttccttcacccatttctgtcgcccagtgcctgcttcttgaggagaaaggtgagatgggaaactggcctccagagtga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:449520 -> Biological process: GO:0000266 [mitochondrial fission] evidence: IEA
GeneID:449520 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
GeneID:449520 -> Biological process: GO:0007283 [spermatogenesis] evidence: IEA
GeneID:449520 -> Biological process: GO:0030154 [cell differentiation] evidence: IEA
GeneID:449520 -> Cellular component: GO:0005758 [mitochondrial intermembrane space] evidence: IEA
GeneID:449520 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IEA
GeneID:449520 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.