Home |
Help |
Advanced search
2024-04-20 09:22:06, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_026580 2412 bp RNA linear PRI 16-JUL-2013
DEFINITION Homo sapiens transcription factor Dp-1 (TFDP1), transcript variant
2, non-coding RNA.
ACCESSION NR_026580
VERSION NR_026580.1 GI:219842239
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2412)
AUTHORS Pelka,P., Miller,M.S., Cecchini,M., Yousef,A.F., Bowdish,D.M.,
Dick,F., Whyte,P. and Mymryk,J.S.
TITLE Adenovirus E1A directly targets the E2F/DP-1 complex
JOURNAL J. Virol. 85 (17), 8841-8851 (2011)
PUBMED 21715488
REMARK GeneRIF: The authors demonstrate that adenovirus E1A binds to
E2F/DP-1 complexes through a direct interaction with DP-1 and may
selectively activate a subset of E2F-regulated cellular genes
during infection.
REFERENCE 2 (bases 1 to 2412)
AUTHORS Arakawa,T., Masuhiro,Y., Kamiya,Y., Kojima,H. and Hanazawa,S.
TITLE Identification of significant regions of transcription factor DP-1
(TFDP-1) involved in stability/instability of the protein
JOURNAL Biochem. Biophys. Res. Commun. 397 (2), 345-349 (2010)
PUBMED 20513349
REMARK GeneRIF: the DP-1 'Stabilon' domain was a C-terminal acidic motif
and was quite important for DP-1 stability.
REFERENCE 3 (bases 1 to 2412)
AUTHORS Cunningham JM, Vierkant RA, Sellers TA, Phelan C, Rider DN, Liebow
M, Schildkraut J, Berchuck A, Couch FJ, Wang X, Fridley BL,
Gentry-Maharaj A, Menon U, Hogdall E, Kjaer S, Whittemore A,
DiCioccio R, Song H, Gayther SA, Ramus SJ, Pharaoh PD and Goode EL.
CONSRTM Ovarian Cancer Association Consortium
TITLE Cell cycle genes and ovarian cancer susceptibility: a tagSNP
analysis
JOURNAL Br. J. Cancer 101 (8), 1461-1468 (2009)
PUBMED 19738611
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 4 (bases 1 to 2412)
AUTHORS Melchor,L., Saucedo-Cuevas,L.P., Munoz-Repeto,I.,
Rodriguez-Pinilla,S.M., Honrado,E., Campoverde,A., Palacios,J.,
Nathanson,K.L., Garcia,M.J. and Benitez,J.
TITLE Comprehensive characterization of the DNA amplification at 13q34 in
human breast cancer reveals TFDP1 and CUL4A as likely candidate
target genes
JOURNAL Breast Cancer Res. 11 (6), R86 (2009)
PUBMED 19995430
REMARK GeneRIF: 13q34 amplification may be of relevance in tumor
progression of breast cancers by inducing overexpression of CUL4A
and TFDP1, important in cell cycle regulation. These genes were
also overexpressed in non-basal-like tumor samples.
REFERENCE 5 (bases 1 to 2412)
AUTHORS Masuhiro,Y., Kayama,K., Fukushima,A., Baba,K., Soutsu,M.,
Kamiya,Y., Gotoh,M., Yamaguchi,N. and Hanazawa,S.
TITLE SOCS-3 inhibits E2F/DP-1 transcriptional activity and cell cycle
progression via interaction with DP-1
JOURNAL J. Biol. Chem. 283 (46), 31575-31583 (2008)
PUBMED 18687693
REMARK GeneRIF: SOCS-3 acts as a negative regulator of the cell cycle
progression under E2F/DP-1 control by interfering with heterodimer
formation between DP-1 and E2F
REFERENCE 6 (bases 1 to 2412)
AUTHORS Zhang,Y., Venkatraj,V.S., Fischer,S.G., Warburton,D. and
Chellappan,S.P.
TITLE Genomic cloning and chromosomal assignment of the E2F dimerization
partner TFDP gene family
JOURNAL Genomics 39 (1), 95-98 (1997)
PUBMED 9027491
REFERENCE 7 (bases 1 to 2412)
AUTHORS Hijmans,E.M., Voorhoeve,P.M., Beijersbergen,R.L., van 't Veer,L.J.
and Bernards,R.
TITLE E2F-5, a new E2F family member that interacts with p130 in vivo
JOURNAL Mol. Cell. Biol. 15 (6), 3082-3089 (1995)
PUBMED 7760804
REFERENCE 8 (bases 1 to 2412)
AUTHORS Wu,C.L., Zukerberg,L.R., Ngwu,C., Harlow,E. and Lees,J.A.
TITLE In vivo association of E2F and DP family proteins
JOURNAL Mol. Cell. Biol. 15 (5), 2536-2546 (1995)
PUBMED 7739537
REFERENCE 9 (bases 1 to 2412)
AUTHORS Beijersbergen,R.L., Kerkhoven,R.M., Zhu,L., Carlee,L.,
Voorhoeve,P.M. and Bernards,R.
TITLE E2F-4, a new member of the E2F gene family, has oncogenic activity
and associates with p107 in vivo
JOURNAL Genes Dev. 8 (22), 2680-2690 (1994)
PUBMED 7958925
REFERENCE 10 (bases 1 to 2412)
AUTHORS Ginsberg,D., Vairo,G., Chittenden,T., Xiao,Z.X., Xu,G.,
Wydner,K.L., DeCaprio,J.A., Lawrence,J.B. and Livingston,D.M.
TITLE E2F-4, a new member of the E2F transcription factor family,
interacts with p107
JOURNAL Genes Dev. 8 (22), 2665-2679 (1994)
PUBMED 7958924
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from CD623680.1, AK297114.1 and
AL442125.13.
Summary: This gene encodes a member of a family of transcription
factors that heterodimerize with E2F proteins to enhance their
DNA-binding activity and promote transcription from E2F target
genes. The encoded protein functions as part of this complex to
control the transcriptional activity of numerous genes involved in
cell cycle progression from G1 to S phase. Alternative splicing
results in multiple transcript variants. Pseudogenes of this gene
are found on chromosomes 1, 15, and X.[provided by RefSeq, Jan
2009].
Transcript Variant: This variant (2) lacks an internal alternate
exon compared to variant 1. This variant is represented as
non-coding because the use of the 5'-most translational start
codon, as used in variant 1, renders the transcript a candidate for
nonsense-mediated mRNA decay (NMD).
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-10 CD623680.1 1-10
11-1337 AK297114.1 1-1327
1338-2412 AL442125.13 176111-177185
FEATURES Location/Qualifiers
source 1..2412
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="13"
/map="13q34"
gene 1..2412
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/note="transcription factor Dp-1"
/db_xref="GeneID:7027"
/db_xref="HGNC:11749"
/db_xref="MIM:189902"
misc_RNA 1..2412
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/product="transcription factor Dp-1, transcript variant 2"
/db_xref="GeneID:7027"
/db_xref="HGNC:11749"
/db_xref="MIM:189902"
exon 1..43
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
exon 44..119
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 74
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:377460213"
variation 100
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:139759728"
misc_feature 108..467
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="COORDINATES:
alignment:Blast2seq::RefSeq|NM_007111.4"
/note="primary ORF has stop codon >50 nucleotides from the
terminal splice site; nonsense-mediated decay (NMD)
candidate"
exon 120..186
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 122
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150730"
variation 140
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150731"
variation 151
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200455628"
variation 179
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144432965"
exon 187..293
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 188
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:139600212"
variation 192
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:145127789"
variation 200
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376309894"
variation 206
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:147153953"
variation 207
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201938481"
variation 222
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372043898"
variation 229
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140523394"
variation 230
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201563015"
variation 233
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:4150756"
variation 250
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374939623"
variation 266
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:151229785"
variation 269..270
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="c"
/db_xref="dbSNP:34781189"
variation 271
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:140385325"
exon 294..459
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 357
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:141171684"
variation 396
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:145060973"
variation 431
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:199968505"
variation 432
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:138846629"
variation 433
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:371385894"
exon 460..603
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 463
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:367915991"
variation 465
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200482856"
variation 489
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374253994"
variation 513
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200930289"
variation 549
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150788"
variation 579
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200042404"
exon 604..672
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 609
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201627059"
variation 612
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:61729944"
variation 619
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:373197629"
variation 648
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143750751"
exon 673..824
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 690
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:369104225"
variation 694
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:368780494"
variation 713
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:148175670"
variation 714
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150806"
variation 732
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:372891699"
variation 738
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:201874910"
variation 757
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:199966137"
variation 774
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="c"
/replace="t"
/db_xref="dbSNP:200050514"
variation 777
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:202144389"
variation 801
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:150730789"
variation 805
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:201312901"
exon 825..991
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 882
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:137909568"
variation 907
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:143376685"
variation 918
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:147172256"
variation 933
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140379028"
variation 956
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:368176674"
variation 967
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:149728583"
variation 984
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:144543834"
variation 985
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:148494753"
exon 992..1058
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 1007
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="c"
/db_xref="dbSNP:199990090"
variation 1017
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:142697119"
variation 1020
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200035867"
variation 1028
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:372826918"
variation 1032
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146505939"
exon 1059..2412
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/inference="alignment:Splign:1.39.8"
variation 1068
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:201411969"
variation 1090
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:372494238"
variation 1103
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:200282402"
variation 1107
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:199691334"
variation 1119
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:375741872"
variation 1121
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:370888253"
variation 1140
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:377544697"
variation 1148
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:141230527"
variation 1152
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:143555000"
variation 1160
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146824402"
variation 1164
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:140489086"
variation 1174
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150823"
variation 1194
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374558698"
variation 1208
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:150466630"
variation 1216
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:376532717"
variation 1228
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:113220010"
variation 1241
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:374365132"
variation 1248
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:200563498"
variation 1249
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:370718516"
variation 1272
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:28624173"
variation 1274
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:182792488"
variation 1297
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150824"
variation 1302..1303
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="c"
/db_xref="dbSNP:34533673"
variation 1322
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150825"
variation 1364
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:190739978"
variation 1366
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150826"
variation 1379
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:146046782"
variation 1414
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="g"
/db_xref="dbSNP:4150827"
variation 1420
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:371317153"
variation 1432
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:4150828"
variation 1467..1468
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="t"
/db_xref="dbSNP:375173308"
variation 1470
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:140024363"
variation 1510
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:11545598"
variation 1534
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="c"
/db_xref="dbSNP:377596187"
variation 1584
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="t"
/db_xref="dbSNP:4150829"
variation 1607
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:78345683"
variation 1608
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:75700214"
variation 1609
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:77556813"
variation 1710
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="g"
/replace="t"
/db_xref="dbSNP:371395847"
variation 1733
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="t"
/db_xref="dbSNP:34438141"
variation 1817
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="g"
/db_xref="dbSNP:4150830"
variation 1899
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="c"
/replace="t"
/db_xref="dbSNP:9577597"
polyA_signal 2103..2108
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
polyA_site 2128
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
variation 2142
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace="a"
/replace="t"
/db_xref="dbSNP:183205277"
variation 2271..2272
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="a"
/db_xref="dbSNP:199853572"
variation 2275..2276
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
/replace=""
/replace="a"
/db_xref="dbSNP:4150831"
polyA_signal 2384..2389
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
polyA_site 2412
/gene="TFDP1"
/gene_synonym="Dp-1; DP1; DRTF1"
ORIGIN
accgcgccgcgcgcacgtcacgccggcccgacgctcggccaggaaaaatcatttttcttctctgggaaggtgaacatttgtagcattgatttcccggatctggtaacatggcaaaagatgccggtctaattgaagccaacggagaactcaaggtcttcatagaccagaaccttagtcccgggaaaggcgtggtgtccctcgtggccgttcacccctccaccgtcaacccgctcgggaagcagctcttgccaaaaacctttggacagtccaatgtcaacattgcccagcaagtggaagcgcaacaggaaaggagagaagaatggcaagggcctacggcatttctccatgaaggtctgcgagaaggtgcagaggaaagggaccacttcctacaacgaagtggcagacgagctggttgcggagttcagtgctgccgacaaccacatcttaccaaacgagtcagcttatgaccagaaaaacataagacggcgcgtctacgatgccttaaacgtgctaatggccatgaacatcatctccaaggagaagaaggagatcaagtggattggtctgcccaccaactcggctcaggaatgtcagaacttagaggtggaaagacagaggagacttgaaagaataaaacagaaacagtctcaacttcaagaacttattctacagcaaattgccttcaagaacctggtgcagagaaaccggcatgcggagcagcaggccagccggccaccgccacccaactcagtcatccacctgcccttcatcatcgtcaacaccagcaagaagacggtcatcgactgcagcatctccaatgacaaatttgagtatctgtttaattttgacaacacatttgaaatccacgatgacatagaagtgctgaagcggatgggcatggcttgcgggctggagtcggggagctgctctgccgaagaccttaaaatggccagaagtctggtccccaaggctctggagccatacgtgacagaaatggctcagggaactgttggaggcgtgttcatcacgacggcaggttccacgtctaacggcacaagtgacctgaccaacggtgcagatgggatgctggccacaagctccaatgggtctcagtacagcggctccagggtggagactccggtgtcctacgtcggggaggacgacgaggaggacgatgacttcaacgagaatgacgaggacgactgacgtcctccccacttcagattcggcttcaggaaaacgtttagcgaaaagaaactttttttttaatgtgggttttctgtttccttttggcctactcccaagaagatattggtaagctattgaatttagatatgcacctctgataagcaaggattgtttcccgtaggattaggacgtgctgtggatgtgtgttttgataccagtgtgctgatgcagagcgtttatttacttgttaggattttgtgttttcatttgctatttttctttaagtgcagagttcatttttgcccctgaaaagtttttgctgagtttgctgaagaaattgtatttcaaccacatccatgaaaataaaacacctcctgttgtggatggtgagcccctgatgccgcttatttgccgtgagtttggacggcacccctgctggcggatagcaagactctgtggagtttgttcagtggtacggtgtccaagcaaacagcagaatgcaactttctaaacagccccaagcaaacagcagaattcaactttttaaacaataaacaccatcaaccttattgactttattgtcccttaaattatattgactgttgtgattccatcaagtttgtacactcttttctctccctgttttgcagcaacaaattgcgaagtgcttttgtttgtttgttttcgtttggttaaagcttattgccatgctggtgcggctatggagactgtctggaaggcttggaatggtttattgcttatggtaaaatttgcctgatttcttacaggcagcgtttggaaaccttttattatatagttgtttacatacttataagtctatcatttaaagacatgtactgaaacaaatgtatttgtttcataagcatcttcctgtaatctattataaaattgaaattaaatatagagaatgttttaacaattttttaactcaaaatttgtcaatcatttttaatagttctttttttataaaaagaaaaaggaatttaaggacaggcagtagtctcttttaaaatttattcacaaaacccattaactgcacagttgctattagctgcctgttctaaaacgatagtctttttattgaaacacaaataaacttttctgtaatattttatggtatataaagagactttaattgtttgacttgtttaacttggcactgttagtttttattaataaaacgcgcatgggcattttaaacaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:7027 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA
GeneID:7027 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
GeneID:7027 -> Molecular function: GO:0003713 [transcription coactivator activity] evidence: TAS
GeneID:7027 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:7027 -> Molecular function: GO:0008134 [transcription factor binding] evidence: IPI
GeneID:7027 -> Molecular function: GO:0019904 [protein domain specific binding] evidence: IPI
GeneID:7027 -> Biological process: GO:0000082 [G1/S transition of mitotic cell cycle] evidence: TAS
GeneID:7027 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
GeneID:7027 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: TAS
GeneID:7027 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: TAS
GeneID:7027 -> Biological process: GO:0006367 [transcription initiation from RNA polymerase II promoter] evidence: TAS
GeneID:7027 -> Biological process: GO:0007179 [transforming growth factor beta receptor signaling pathway] evidence: TAS
GeneID:7027 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
GeneID:7027 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:7027 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: TAS
GeneID:7027 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:7027 -> Cellular component: GO:0005667 [transcription factor complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.