GGRNA Home | Help | Advanced search

2019-03-26 15:04:11, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_024608               2175 bp    RNA     linear   PRI 16-JUL-2013
DEFINITION  Homo sapiens X-ray repair complementing defective repair in Chinese
            hamster cells 6 pseudogene 5 (XRCC6P5), non-coding RNA.
ACCESSION   NR_024608 XM_001716243 XM_001726957 XM_001726964
VERSION     NR_024608.1  GI:218749869
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2175)
  AUTHORS   Sakano,S., Hinoda,Y., Okayama,N., Kawai,Y., Korenaga,Y., Eguchi,S.,
            Nagao,K., Ohmi,C. and Naito,K.
  TITLE     The association of DNA repair gene polymorphisms with the
            development and progression of renal cell carcinoma
  JOURNAL   Ann. Oncol. 18 (11), 1817-1827 (2007)
   PUBMED   17712032
  REMARK    GeneRIF: The association between DNA repair gene polymorphism and
            the genetic susceptibility and progression of renal cell carcinoma
            are not specific.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AL390027.11, AL137843.4, AL590293.3 and AL022148.1.
            
            Sequence Note: The RefSeq transcript was derived from the reference
            genome assembly. The genomic coordinates were determined from
            alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-451               AL390027.11        176887-177337       c
            452-527             AL390027.11        85714-85789         c
            528-535             AL390027.11        23344-23351         c
            536-547             AL137843.4         3724-3735
            548-563             AL137843.4         25697-25712
            564-572             AL137843.4         32468-32476
            573-860             AL137843.4         34922-35209
            861-1867            AL137843.4         35466-36472
            1868-1963           AL137843.4         99311-99406
            1964-2072           AL590293.3         50242-50350         c
            2073-2175           AL022148.1         31017-31119         c
FEATURES             Location/Qualifiers
     source          1..2175
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xq22.1"
     gene            1..2175
                     /gene="XRCC6P5"
                     /note="X-ray repair complementing defective repair in
                     Chinese hamster cells 6 pseudogene 5"
                     /pseudo
                     /db_xref="GeneID:442459"
                     /db_xref="HGNC:45187"
     misc_RNA        1..2175
                     /gene="XRCC6P5"
                     /product="X-ray repair complementing defective repair in
                     Chinese hamster cells 6 pseudogene 5"
                     /pseudo
                     /db_xref="GeneID:442459"
                     /db_xref="HGNC:45187"
     exon            1..451
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(17..18)
                     /gene="XRCC6P5"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:35143815"
     variation       complement(58)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2884584"
     variation       complement(69)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190706264"
     variation       complement(79)
                     /gene="XRCC6P5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113728054"
     variation       complement(107)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185412819"
     variation       complement(144)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4026619"
     variation       complement(178)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2884583"
     variation       complement(223..224)
                     /gene="XRCC6P5"
                     /replace=""
                     /replace="cc"
                     /db_xref="dbSNP:3050846"
     variation       complement(228)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2358923"
     variation       complement(231)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2358922"
     variation       complement(287)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369383201"
     variation       complement(355)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192722436"
     variation       complement(362)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2884582"
     variation       complement(375)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4026618"
     variation       complement(394)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4026617"
     variation       complement(401)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2884581"
     variation       complement(408..413)
                     /gene="XRCC6P5"
                     /replace=""
                     /replace="gtgcct"
                     /db_xref="dbSNP:4026616"
     variation       complement(419)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:16983262"
     variation       complement(425..427)
                     /gene="XRCC6P5"
                     /replace=""
                     /replace="cgc"
                     /db_xref="dbSNP:4026615"
     variation       complement(451)
                     /gene="XRCC6P5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2884580"
     exon            452..527
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     exon            528..535
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     exon            536..547
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     exon            548..563
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(550)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377567514"
     exon            564..572
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(571)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146583915"
     exon            573..860
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(730)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376894952"
     exon            861..1867
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(869..887)
                     /gene="XRCC6P5"
                     /replace=""
                     /replace="ttcactttgaggaatccag"
                     /db_xref="dbSNP:199712912"
     variation       complement(889)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:143875649"
     variation       complement(922)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113231409"
     variation       complement(1089)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:192639669"
     variation       complement(1119)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188110507"
     variation       complement(1129)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376455082"
     variation       complement(1130)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138097687"
     variation       complement(1163)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150342783"
     variation       complement(1172)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73560306"
     variation       complement(1204)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:183324267"
     variation       complement(1262)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113441076"
     variation       complement(1281)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191065655"
     variation       complement(1285)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187365141"
     variation       complement(1299)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182732259"
     variation       complement(1353)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375165042"
     variation       complement(1400..1401)
                     /gene="XRCC6P5"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35871454"
     variation       complement(1477)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191040188"
     variation       complement(1657)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:145685469"
     variation       complement(1678)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186180467"
     exon            1868..1963
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(1868)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140289709"
     variation       complement(1886)
                     /gene="XRCC6P5"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372248971"
     variation       complement(1916)
                     /gene="XRCC6P5"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113353198"
     exon            1964..2072
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(2002)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187105918"
     exon            2073..2175
                     /gene="XRCC6P5"
                     /inference="alignment:Splign:1.39.8"
                     /pseudo
     variation       complement(2149)
                     /gene="XRCC6P5"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:11797236"
ORIGIN      


atggtggaaccatggggacttgggggtggggcagaggtgggaacatttgtatcagttaagtcagcttcgtggctccctgtggagccagggctgagccttgtgacgcgcactcgccaattagagattgatcagccagcagtcaaatgcattctccagtccttgcaagaaggatcagccttttctgtgccagcctcgatcgccttgtgctttggtctctttttctcccctgcttggatcctgcctcgcgcgggccgtcctgttgctgagactcggggtaccgttctgctgacccagctccctttagtcacgtttgcttggctctggtaccaaatagttgggattaccgaagagtccccttcctcgcgtgtcagcacagatgctgtgactgccacccgcgtccccgtcaagtgcctgtgcccgagctcgccgccgccgtgtgtgctgcgctgatagtttccagttgttctttctgggtgatggtgatatagatgtacagtactacatggcactaatatataggtaagtttgatgttgattttgatggacagtacttcatgccccttatacttaggggctatgtttgaatctcagagcgaaggtgagttgactccttttgacatgagcatccagtgtatccaaagtgtgtacatgagtaagatcataagcagtgatcgagatctttatgatactgagaaagacaaaaattcagtgaattttaaaaatatttacgtcttacaggagttggaaaatccaggtgcaaaacaaattctaaagcttgaccagtttaaggggcagcagggacaaaaatgtttcgaagacctgatgggccatggatctgactactcattcagtgaagttctgaatccagttcactttgaggaatccagcaatctagaagacctgttgcagaaggttcgtgccaaggagaccaggaaatgggcactcagcaggttaaagctgaagctcaacaaagacatagtgatctctgtgggcatttacagtctcgtccagaaggctctcaagcctccttcaataaaactctatcggaaaacaaatgaaccagtgaaaaccaagtcccggaaatttaatattaataccggcagtttgcttctgcctagcgataccaagcggtctcagatctatgggagtcatcagattatactggagaaagaggaaacagaagagctaaaatggtttgatgaaccagctttgatgctcatggttttcaagcccttggtaatgctgaaggagcaccattacccgaggccctccttgttcacgtaccctgaggagtcgccggtgaatgggagttcaaccctgttcagtgctctgctcattaagtgtctggagaaggtggtcatagcattgtgcagatacacaccccgcaggaacatccccccttatttggtggctttggtgtcacaggaagaggagttggatgaccagaaaattcaggtgactactccaggtttccagctggtctttttaccctttgctgatgataaaaggaaggtgccctttactgaaaaagtcatggcaactccagagcaggtggacaacatgaaggctatcattcagaagctctgcttcacatacagaagtgacagctttgagaaccccgtgctgcagcagcacttcgggaacctggagcccttgatcttgtatttgatggaggaacaagcagtggaccttatattacccaaggttgaagaaatgaataaaagactgggctccatggtgaatgagtttaaggaacttgtctactcaccagattataatcctgaagggaaaattaccaagagaaaatgcaataatgaaggttccagaagcaaaaggcccaagcggagtattcagaagaggagctgaaatgcacaggctcttccaccaggtggaatcttgcctgcagcatctctcctgccatcaaaggtgctgccaaagtggcaaagatcctttaaagactgatgcacttctaaaggaggggtttctcgtggttggcactacagcctcaggcatttgtaccacactactggaggttcccaattattcttatgatcagacccttgcagcttgagtcattgtgtttcaaagtatttcaataacatgtaaatcagcagcctctgtggttggttcttttctgttgtcactcttcctactagcttctttgatttggcatcc
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.