GGRNA Home | Help | Advanced search

2019-03-25 08:18:47, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_024471               1904 bp    RNA     linear   PRI 16-JUL-2013
DEFINITION  Homo sapiens MRPL23 antisense RNA 1 (MRPL23-AS1), non-coding RNA.
ACCESSION   NR_024471 XM_001719659
VERSION     NR_024471.1  GI:213417947
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1904)
  AUTHORS   Venter,J.C., Adams,M.D., Myers,E.W., Li,P.W., Mural,R.J.,
            Sutton,G.G., Smith,H.O., Yandell,M., Evans,C.A., Holt,R.A.,
            Gocayne,J.D., Amanatides,P., Ballew,R.M., Huson,D.H., Wortman,J.R.,
            Zhang,Q., Kodira,C.D., Zheng,X.H., Chen,L., Skupski,M.,
            Subramanian,G., Thomas,P.D., Zhang,J., Gabor Miklos,G.L.,
            Nelson,C., Broder,S., Clark,A.G., Nadeau,J., McKusick,V.A.,
            Zinder,N., Levine,A.J., Roberts,R.J., Simon,M., Slayman,C.,
            Hunkapiller,M., Bolanos,R., Delcher,A., Dew,I., Fasulo,D.,
            Flanigan,M., Florea,L., Halpern,A., Hannenhalli,S., Kravitz,S.,
            Levy,S., Mobarry,C., Reinert,K., Remington,K., Abu-Threideh,J.,
            Beasley,E., Biddick,K., Bonazzi,V., Brandon,R., Cargill,M.,
            Chandramouliswaran,I., Charlab,R., Chaturvedi,K., Deng,Z., Di
            Francesco,V., Dunn,P., Eilbeck,K., Evangelista,C., Gabrielian,A.E.,
            Gan,W., Ge,W., Gong,F., Gu,Z., Guan,P., Heiman,T.J., Higgins,M.E.,
            Ji,R.R., Ke,Z., Ketchum,K.A., Lai,Z., Lei,Y., Li,Z., Li,J.,
            Liang,Y., Lin,X., Lu,F., Merkulov,G.V., Milshina,N., Moore,H.M.,
            Naik,A.K., Narayan,V.A., Neelam,B., Nusskern,D., Rusch,D.B.,
            Salzberg,S., Shao,W., Shue,B., Sun,J., Wang,Z., Wang,A., Wang,X.,
            Wang,J., Wei,M., Wides,R., Xiao,C., Yan,C., Yao,A., Ye,J., Zhan,M.,
            Zhang,W., Zhang,H., Zhao,Q., Zheng,L., Zhong,F., Zhong,W., Zhu,S.,
            Zhao,S., Gilbert,D., Baumhueter,S., Spier,G., Carter,C.,
            Cravchik,A., Woodage,T., Ali,F., An,H., Awe,A., Baldwin,D.,
            Baden,H., Barnstead,M., Barrow,I., Beeson,K., Busam,D., Carver,A.,
            Center,A., Cheng,M.L., Curry,L., Danaher,S., Davenport,L.,
            Desilets,R., Dietz,S., Dodson,K., Doup,L., Ferriera,S., Garg,N.,
            Gluecksmann,A., Hart,B., Haynes,J., Haynes,C., Heiner,C.,
            Hladun,S., Hostin,D., Houck,J., Howland,T., Ibegwam,C., Johnson,J.,
            Kalush,F., Kline,L., Koduru,S., Love,A., Mann,F., May,D.,
            McCawley,S., McIntosh,T., McMullen,I., Moy,M., Moy,L., Murphy,B.,
            Nelson,K., Pfannkoch,C., Pratts,E., Puri,V., Qureshi,H.,
            Reardon,M., Rodriguez,R., Rogers,Y.H., Romblad,D., Ruhfel,B.,
            Scott,R., Sitter,C., Smallwood,M., Stewart,E., Strong,R., Suh,E.,
            Thomas,R., Tint,N.N., Tse,S., Vech,C., Wang,G., Wetter,J.,
            Williams,S., Williams,M., Windsor,S., Winn-Deen,E., Wolfe,K.,
            Zaveri,J., Zaveri,K., Abril,J.F., Guigo,R., Campbell,M.J.,
            Sjolander,K.V., Karlak,B., Kejariwal,A., Mi,H., Lazareva,B.,
            Hatton,T., Narechania,A., Diemer,K., Muruganujan,A., Guo,N.,
            Sato,S., Bafna,V., Istrail,S., Lippert,R., Schwartz,R., Walenz,B.,
            Yooseph,S., Allen,D., Basu,A., Baxendale,J., Blick,L., Caminha,M.,
            Carnes-Stine,J., Caulk,P., Chiang,Y.H., Coyne,M., Dahlke,C.,
            Mays,A., Dombroski,M., Donnelly,M., Ely,D., Esparham,S., Fosler,C.,
            Gire,H., Glanowski,S., Glasser,K., Glodek,A., Gorokhov,M.,
            Graham,K., Gropman,B., Harris,M., Heil,J., Henderson,S., Hoover,J.,
            Jennings,D., Jordan,C., Jordan,J., Kasha,J., Kagan,L., Kraft,C.,
            Levitsky,A., Lewis,M., Liu,X., Lopez,J., Ma,D., Majoros,W.,
            McDaniel,J., Murphy,S., Newman,M., Nguyen,T., Nguyen,N., Nodell,M.,
            Pan,S., Peck,J., Peterson,M., Rowe,W., Sanders,R., Scott,J.,
            Simpson,M., Smith,T., Sprague,A., Stockwell,T., Turner,R.,
            Venter,E., Wang,M., Wen,M., Wu,D., Wu,M., Xia,A., Zandieh,A. and
            Zhu,X.
  TITLE     The sequence of the human genome
  JOURNAL   Science 291 (5507), 1304-1351 (2001)
   PUBMED   11181995
  REMARK    Erratum:[Science 2001 Jun 5;292(5523):1838]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC051649.21.
            On Nov 20, 2008 this sequence version replaced gi:169203258.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX377297.2 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025084 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-95                AC051649.21        8097-8191
            96-294              AC051649.21        12376-12574
            295-427             AC051649.21        13035-13167
            428-1904            AC051649.21        13332-14808
FEATURES             Location/Qualifiers
     source          1..1904
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11p15.5"
     gene            1..1904
                     /gene="MRPL23-AS1"
                     /note="MRPL23 antisense RNA 1"
                     /db_xref="GeneID:100133545"
                     /db_xref="HGNC:42812"
     misc_RNA        1..1904
                     /gene="MRPL23-AS1"
                     /product="MRPL23 antisense RNA 1"
                     /db_xref="GeneID:100133545"
                     /db_xref="HGNC:42812"
     exon            1..95
                     /gene="MRPL23-AS1"
                     /inference="alignment:Splign:1.39.8"
     variation       7
                     /gene="MRPL23-AS1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:217716"
     exon            96..294
                     /gene="MRPL23-AS1"
                     /inference="alignment:Splign:1.39.8"
     exon            295..427
                     /gene="MRPL23-AS1"
                     /inference="alignment:Splign:1.39.8"
     exon            428..1904
                     /gene="MRPL23-AS1"
                     /inference="alignment:Splign:1.39.8"
     variation       1724
                     /gene="MRPL23-AS1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:11564747"
ORIGIN      


ggtggcagcatggcctgggggtcctggcaccgctgctcctctgcccaccctaacttcccggcatggcggctgccccctctgagcgtccccaaccaaactgcaggggatatgaagcaagctggacttggggagacatctctgctcgagtgcacgttggcctgatgacgactgctcttgggttcacgggttccaggctctgcccgggagcctcatgcaaactggtcccgttctacagacgaggaaactgaggcacagagtgattacggctgtccctgagctcctgcagccagtaagtgtctctgaggatgaactgccatgtgcccggcggggatgccgtccctggcccttgctgagtgcctctgggacgaggtcagctgagcctgccatcctaactcagacaccatctcactctccaagtcccttctcggcccagcaaattctcacctccagaggccaggtctgccccgcaggtcttaggaaatacagccctacttccatccagcacaccaacccaaggaagtgcctcggagccctggggcccgaggggggcctggccttggtctcacggcggcagctccacctggagaggagtgaactcaagccaggacgccccgtctccacagcggaaaccgtgttgccggctgctccctcctggggactctgggcctgaggttcctgtgggagttggggggatagctgagtcctatggaggtgcccctctcctccccgcccagtggagcttggggtggggacaggcgaagacagggtgagaagcacggggcattccccctccacacagcgctgagaaagtaagggagcatccagaaaacggtgcccacttccgcgtcaggcggatatcacgggcaccagctccaggtgaccctagcccagccagagaacaaggaccaggttgtgccgcaaagcccgtgtccgctccctcccgcctgggaccactgtggcgaggggaagggagcgtggtggccctctcctgactcctgaggcctgaagtccaagctcccggccctcaggcaggccagggtctagacaccgctgccccaaacacaccccccagtccccgcccgcaggcttcctgcaggatcccccagtgcacctgggggctgaggagagtgagcagggcgcaaagaagcttcgtcgggagggcggtccccacccgccttggacccccggggatagtgtcctggggcctgggctcagatgcaccctgggaggaatggtgcggaggctgttttttgctccaagaggacattgcctcagcagagggctgccgagctgggaggacccacagtgcaaggccgcagaaccccctaggaagcctcagagccttcaggttccgggctgaggctgtgggcgtggacccttgtgcaaaccccactggaagaaaaaccttacagctcaggaggaggaggggccccacccgctcccagagcccgtaaacgaggggtggtgcccacatgaggcctggggaagggctggggctgggacaccccctcaccacccccagataccccaggcagcccctccctccacagagagacccactgggcctgaccctgccctgggcacagggtcgagccagggacggcccgtgggagaaagacggcttcatgggccgctggccgggccaggtgcgtccttccccagttctaggtggcaaatggggtggggccagagccttctggctagggaagacactggcctggttggtgtggcaggggcagcgaaggagggtcaaaggccactctggcctggaagagtccccagccacctggacgggggtagccaggcctggtccctgcccccactctccaaggggtcggggcagccgggcagagccagtaagtgtttgttttcagatgacatttgtaaagaaaaacagcctccca
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.