Home |
Help |
Advanced search
2024-04-20 15:16:49, GGRNA : RefSeq release 60 (20130726)
LOCUS NR_024438 1988 bp RNA linear PRI 17-JUL-2013
DEFINITION Homo sapiens actin, gamma 1 pseudogene 4 (ACTG1P4), non-coding RNA.
ACCESSION NR_024438 XR_018995 XR_038169
VERSION NR_024438.2 GI:219802466
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1988)
AUTHORS Samuelson,L.C., Wiebauer,K., Snow,C.M. and Meisler,M.H.
TITLE Retroviral and pseudogene insertion sites reveal the lineage of
human salivary and pancreatic amylase genes from a single gene
during primate evolution
JOURNAL Mol. Cell. Biol. 10 (6), 2513-2520 (1990)
PUBMED 1692956
REFERENCE 2 (bases 1 to 1988)
AUTHORS Samuelson,L.C., Wiebauer,K., Gumucio,D.L. and Meisler,M.H.
TITLE Expression of the human amylase genes: recent origin of a salivary
amylase promoter from an actin pseudogene
JOURNAL Nucleic Acids Res. 16 (17), 8261-8276 (1988)
PUBMED 2458567
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AY129015.1 and AC105272.2.
On Jan 8, 2009 this sequence version replaced gi:212549740.
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript is intronless :: AY129015.1 [ECO:0000345]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-78 AY129015.1 1-78
79-231 AY129015.1 80-232
232-1745 AY129015.1 234-1747
1746-1988 AC105272.2 21456-21698
FEATURES Location/Qualifiers
source 1..1988
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1p21.1"
gene 1..1988
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/note="actin, gamma 1 pseudogene 4"
/pseudo
/db_xref="GeneID:648740"
/db_xref="HGNC:149"
misc_RNA 1..1988
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/product="actin, gamma 1 pseudogene 4"
/pseudo
/db_xref="GeneID:648740"
/db_xref="HGNC:149"
exon 1..1988
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/inference="alignment:Splign:1.39.8"
/pseudo
variation 30..31
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace=""
/replace="gt"
/db_xref="dbSNP:58457409"
variation 79
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="c"
/db_xref="dbSNP:190701357"
variation 168
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:113695654"
variation 175
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:183268316"
variation 255
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="g"
/db_xref="dbSNP:189208271"
variation 262
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:74776140"
variation 434
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:3762407"
variation 467
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:192896538"
variation 655
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:183777813"
variation 671
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="t"
/db_xref="dbSNP:187913470"
variation 781
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:191831804"
variation 784
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:371628291"
variation 864
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:183616642"
variation 919
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:144628009"
variation 920
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:75516768"
variation 998
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="g"
/replace="t"
/db_xref="dbSNP:188326986"
variation 1003
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:191587590"
variation 1030
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="c"
/db_xref="dbSNP:185544258"
variation 1122
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:138520891"
variation 1133
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:12132911"
variation 1136
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="c"
/db_xref="dbSNP:368294030"
variation 1157
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:141667811"
variation 1171
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="g"
/replace="t"
/db_xref="dbSNP:190759660"
variation 1257
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:146220621"
variation 1411
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:147998703"
variation 1430
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="g"
/db_xref="dbSNP:181682266"
variation 1482..1483
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace=""
/replace="c"
/db_xref="dbSNP:35720318"
variation 1514
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:11807489"
variation 1623
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:141522949"
variation 1698
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:17532330"
variation 1702
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="g"
/db_xref="dbSNP:188428536"
variation 1741
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="c"
/db_xref="dbSNP:371438424"
variation 1787
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="c"
/replace="t"
/db_xref="dbSNP:181204320"
variation 1874
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:184908191"
variation 1881
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:189666520"
variation 1918
/gene="ACTG1P4"
/gene_synonym="ACTGP4"
/replace="a"
/replace="g"
/db_xref="dbSNP:369575068"
ORIGIN
gtgtgtgtgtgtgtgtgtgtgtgtgtgtgtacactgccagaggtttaaaaaggttaagattttatcagtaagaaaaaaccagtcacctctgccagcccatgcaccatgttgtcctgccgctccactgtcccactcctccaccagtcgcaatggaagaagagattgccgtactggtgattgacaatggctccagcatgtgcaaagctggctttgctggggacgacaacccccagccatgtttccttccatcatcggtgcccccggcaccagggcatgatggtgggcatgggccagagggactcctatgtgggctacatggctgagagcaagcacagtatcctgaccctgaagtacccccattaagcatggtatcatgaccaactgggatgacatagagaagatctggcatcacaccttctacaagggactgcacatggccttggaggagcacctggtgctgctgaccgaggaccccctgaacctcaaggccaacagagagaagatgactcagatcatgtttgataccttcaacaccctggccatgtacgtggccatccaggctaggctgtccctctacacctgtggttgcacactggcattgtcatgggctttggagatggggtcacccacatggtgcccatctataagggctacgccctccctgacaccattctgcatctggacctggctggccaggacctgaccaactacctcatgaagatccttaccaaggttggctatagcttcagcaccactgccgagcgggagatcagacactacgtcaaggagaaactgtgctatgttgccctggactttgagcagtagatggccactgccacatcctcctcctccctggagaagagatatgagctgcctgatggccatgtcatcaccatcggcaatgaggttgcagtgtcccgagacgctgttccagccttccttcctggacatggaatcttgtggcatccacccagaccatcttcaactccatcatgaagtgtgacgtggacatccgcaaagacctgtaggccaacacggtgctatctggtggcaacatgtacccaggcatcaccgacaggatgcagaaggagatcaccacccgggcacctagcaccatgaagatcaagatgatcgcatccccagagcacaagtactccgtgtggatcagcggctccatcctggcctcactgtcagccttccagcagatgtggattagcaagcaatagtacaatgacttggccccctccatcgtccaccgcaaatgcttctaaatggactgtgagcagatggctagcaattgcttcatgggttaattcagaagtaaaaatttgcccctggcaaatgcatacacctcatgctagcctcaccaaactggaataagccttagaaaataagttgtctttaaagcttgtatctgatatcagcactggattgtagaacttgttcctgattttgacattgtattcaagttaactgttccccttggtatctgtacatatctttgatttcagtctttagtacatgtggcttggtcacttcatggctaaaaacgtacttgtggaagacaagtctggcttggtgagtctgcatggccagcagtctctgatctgtgcagggtattaatgtgtcaggactgagtgttctgggatttgtctacaggctggtaagggctccttaaccagttgtttctgtcctgtcggtctgtcagggttggaaagtccaagccataggacccagtttcctttcttagcttctgttgtctgccagaacaccatgggctgttactcgccttgagttggaagcggtttgcatttatacctataaatgtattcatccttttaatttatgtaaagtttttttgtatgcaattctcgatctttaaagagatgacaacaaattttggttttctactgttacgtgagaacattaggccccagcaatatatcattgtgtatggaaaaataaaagtgctgccagaaccaaaaaaa
//
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.