GGRNA Home | Help | Advanced search

2019-03-26 16:04:53, GGRNA : RefSeq release 60 (20130726)

LOCUS       NR_002763               2306 bp    RNA     linear   PRI 16-JUL-2013
DEFINITION  Homo sapiens CPS1 intronic transcript 1 (non-protein coding)
            (CPS1-IT1), non-coding RNA.
ACCESSION   NR_002763 XR_001024 XR_001224
VERSION     NR_002763.2  GI:192807280
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2306)
  AUTHORS   Strausberg RL, Feingold EA, Grouse LH, Derge JG, Klausner RD,
            Collins FS, Wagner L, Shenmen CM, Schuler GD, Altschul SF, Zeeberg
            B, Buetow KH, Schaefer CF, Bhat NK, Hopkins RF, Jordan H, Moore T,
            Max SI, Wang J, Hsieh F, Diatchenko L, Marusina K, Farmer AA, Rubin
            GM, Hong L, Stapleton M, Soares MB, Bonaldo MF, Casavant TL,
            Scheetz TE, Brownstein MJ, Usdin TB, Toshiyuki S, Carninci P,
            Prange C, Raha SS, Loquellano NA, Peters GJ, Abramson RD, Mullahy
            SJ, Bosak SA, McEwan PJ, McKernan KJ, Malek JA, Gunaratne PH,
            Richards S, Worley KC, Hale S, Garcia AM, Gay LJ, Hulyk SW,
            Villalon DK, Muzny DM, Sodergren EJ, Lu X, Gibbs RA, Fahey J,
            Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M,
            Madan A, Young AC, Shevchenko Y, Bouffard GG, Blakesley RW,
            Touchman JW, Green ED, Dickson MC, Rodriguez AC, Grimwood J,
            Schmutz J, Myers RM, Butterfield YS, Krzywinski MI, Skalska U,
            Smailus DE, Schnerch A, Schein JE, Jones SJ and Marra MA.
  CONSRTM   Mammalian Gene Collection Program Team
  TITLE     Generation and initial analysis of more than 15,000 full-length
            human and mouse cDNA sequences
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002)
   PUBMED   12477932
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC008172.2.
            On Jun 25, 2008 this sequence version replaced gi:84872040.
            
            Summary: This gene does not encode a protein, and it is located
            within an intron of the gene encoding carbamoyl-phosphate
            synthetase 1. [provided by RefSeq, Jul 2008].
            
            Sequence Note: The RefSeq transcript was derived from genomic
            sequence to make the sequence consistent with the reference genome
            assembly. The genomic coordinates used for the transcript record
            were based on alignments.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-2306              AC008172.2         86617-88922         c
FEATURES             Location/Qualifiers
     source          1..2306
                     /organism="Homo sapiens"
                     /mol_type="transcribed RNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q34"
     gene            1..2306
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /note="CPS1 intronic transcript 1 (non-protein coding)"
                     /db_xref="GeneID:29034"
                     /db_xref="HGNC:30102"
     misc_RNA        1..2306
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /product="CPS1 intronic transcript 1 (non-protein coding)"
                     /db_xref="GeneID:29034"
                     /db_xref="HGNC:30102"
     exon            1..2306
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /inference="alignment:Splign:1.39.8"
     variation       2
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3770684"
     variation       16
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190044776"
     variation       106
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3770683"
     variation       138
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:181695139"
     variation       204
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370500605"
     variation       345
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370968228"
     variation       355
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:148371292"
     variation       512
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141602082"
     variation       526
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186655963"
     variation       651
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:189981705"
     variation       653
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150875886"
     variation       677..678
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:35804978"
     variation       903
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181215111"
     variation       916
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113259035"
     variation       963
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185488558"
     variation       1048
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375761436"
     variation       1087
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368936000"
     variation       1128
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10932345"
     variation       1218
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112033125"
     variation       1259
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371934076"
     variation       1268
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73984652"
     variation       1414
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117714391"
     variation       1517
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117065979"
     variation       1622
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139364817"
     variation       1623
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114030723"
     variation       1642
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142412131"
     variation       1645
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183395816"
     variation       1665
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372723984"
     variation       1773
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:374948149"
     variation       1792
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112758705"
     variation       1796
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145976847"
     variation       1802
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368851694"
     variation       1885
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139882581"
     variation       2061
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187248748"
     variation       2088
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143139688"
     variation       2177
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73076005"
     variation       2196
                     /gene="CPS1-IT1"
                     /gene_synonym="CPS1-IT; CPS1IT; CPS1IT1; PRO0132"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146678638"
ORIGIN      


aataaaacacttgcttttctttttgagaaaaattaggttctttttcatctatttaattattgcccatgtcaaatgcttggttttgaaaactgaggaattctatctgacaaagatgaaaccagctatagttgcttgtaaatcatcctttctagtgatcacataaaatgaacagtagacagcaaataatttaggaattgaacctatacatttatcttataattttgctgacttaagtttccctttcttggtttatgatgccagcagaacttctgtgtaaaattatagtctgttctactgttctcagtttcaggcaactgatttcaaatgcctatgaaaccactccaattaagccacatgggggtgctagaaacttatagtatgccagtcacagcagtggaaaagacctggggtggaaaatagcagatgttattgtgatttaaatttccacttgacatacgttctgatttttggacaaattcaatgttttaattgaatagttttcgttacaaccagaaggcaggttgagattctaactaagcataaataagggtatattgatagtgaaaaaggtccttggaggattaaaacaacacactgttacagatcatttataatatttttctgacttccacattctgttgcatttatttgccgacaatttgacattttcaatctccattttctggcataaatatatttgtaaatagggatattttctattgttcataatgatctacatttaaaactctttatgtaaagctttatatcatttcaaaaatttcaaaaacttacacttaaaatcatctctactgtataaatttgtttttgatccagggaggttgaagtgtctattatatagcaaaagctaaagtaaacctgaagtggaactcacagatgatccacggcgttagcaaacctaaaccctgaactcattatctgagtgtcactttatggtttaattcctttctttttgaagtgtcattgatgcacgcatagcaatttgataatgattgttatttagcggtattagataaataacaagaatagatggccactaaagctacctgtctccatcattttgtggcacataggggtctgaagttgaaagaatacgacagctgatggaatgaatgttaagtatgtaaggccttgagtttccttgccctattttaattatactcaccattagtctgggtctgagtcctctgctttttctcggcccctcaatatccagggaggcttagtcatcaaggtacgtactgctccaacagtaacaagagctccctattaatgacctatagctgacttacatattgcgagtttggagagaggctgagaagattagttgttctttttcatttgtatttatttatggtttactttgaagatctcaactgcttctgtgttagaatggctgtctttagctgtaggcctaggagctagcgatttatttggtgtgcgttcagagaactccaaaattctcctgcctcaacatctatctctgctgccaatgtaccgcactccctttgtacttttcatagagatccttgagaagacaggcagtggggctctcacttgggaaaagagaagtaaattaagagaaaaaatatagaatgctagacgtgggttttctggttccacccttgtgcattggaaggagcagactatggagccagagattggtgcgcagtcctccccactgtagaatcagacgtacatcacctctttcatttctccagattcatgttctttctcttaatctctgcttctagtttttttgtgaagcttaatttatataagtataaatgacatctgacatattgtgagggcccaagaaaatttttcctcttttcccctgaaaataaaaatgctacttgttgtaataaaggttactttatgattttagatatgtattatatattatgattttagatatgtagatatgatagttaaatatttaaagattcattttcagactcacaatttttatttgcttttatattttgcaatgtatcatttcttaatttcctttatgatgcatcacttattttaatatcagacctattttttaaaggaagcaattgatagctacgatgcaaatgctattcttattaaaagataaatagctttcccttatgctaatgaataaaaattcctactctacagttgttaatcaatctcgagttctaaagtccgataaacacatttaatagcagaggatgagcatatcattaaattgatggtcagtctctgacttgtgtttacatatagtcatctgaaatgaagttcagaatttgagtcccaaa
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.