GGRNA Home | Help | Advanced search

2019-03-24 20:43:06, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_199420               8787 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens polymerase (DNA directed), theta (POLQ), mRNA.
ACCESSION   NM_199420 NM_014125
VERSION     NM_199420.3  GI:139394647
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 8787)
  AUTHORS   Hogg,M., Sauer-Eriksson,A.E. and Johansson,E.
  TITLE     Promiscuous DNA synthesis by human DNA polymerase theta
  JOURNAL   Nucleic Acids Res. 40 (6), 2611-2622 (2012)
   PUBMED   22135286
  REMARK    GeneRIF: POLQ possesses a DNA polymerase activity that appears to
            be template independent and allows efficient extension of
            single-stranded DNA as well as duplex DNA with either protruding or
            multiply mismatched 3'-OH termini.
REFERENCE   2  (bases 1 to 8787)
  AUTHORS   Lemee,F., Bergoglio,V., Fernandez-Vidal,A., Machado-Silva,A.,
            Pillaire,M.J., Bieth,A., Gentil,C., Baker,L., Martin,A.L.,
            Leduc,C., Lam,E., Magdeleine,E., Filleron,T., Oumouhou,N.,
            Kaina,B., Seki,M., Grimal,F., Lacroix-Triki,M., Thompson,A.,
            Roche,H., Bourdon,J.C., Wood,R.D., Hoffmann,J.S. and Cazaux,C.
  TITLE     DNA polymerase theta up-regulation is associated with poor survival
            in breast cancer, perturbs DNA replication, and promotes genetic
            instability
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 107 (30), 13390-13395 (2010)
   PUBMED   20624954
  REMARK    GeneRIF: Data show that POLQ overexpression may be a promising
            genetic instability and prognostic marker for breast cancer.
REFERENCE   3  (bases 1 to 8787)
  AUTHORS   Higgins,G.S., Harris,A.L., Prevo,R., Helleday,T., McKenna,W.G. and
            Buffa,F.M.
  TITLE     Overexpression of POLQ confers a poor prognosis in early breast
            cancer patients
  JOURNAL   Oncotarget 1 (3), 175-184 (2010)
   PUBMED   20700469
  REMARK    GeneRIF: overexpression in breast cancer confers an adverse
            prognosis and is associated with key cancer pathways
REFERENCE   4  (bases 1 to 8787)
  AUTHORS   Hussain,S.K., Mu,L.N., Cai,L., Chang,S.C., Park,S.L., Oh,S.S.,
            Wang,Y., Goldstein,B.Y., Ding,B.G., Jiang,Q., Rao,J., You,N.C.,
            Yu,S.Z., Papp,J.C., Zhao,J.K., Wang,H. and Zhang,Z.F.
  TITLE     Genetic variation in immune regulation and DNA repair pathways and
            stomach cancer in China
  JOURNAL   Cancer Epidemiol. Biomarkers Prev. 18 (8), 2304-2309 (2009)
   PUBMED   19661089
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   5  (bases 1 to 8787)
  AUTHORS   Michiels,S., Laplanche,A., Boulet,T., Dessen,P., Guillonneau,B.,
            Mejean,A., Desgrandchamps,F., Lathrop,M., Sarasin,A. and
            Benhamou,S.
  TITLE     Genetic polymorphisms in 85 DNA repair genes and bladder cancer
            risk
  JOURNAL   Carcinogenesis 30 (5), 763-768 (2009)
   PUBMED   19237606
  REMARK    GeneRIF: Observational study of gene-disease association, gene-gene
            interaction, and gene-environment interaction. (HuGE Navigator)
REFERENCE   6  (bases 1 to 8787)
  AUTHORS   Kawamura,K., Bahar,R., Seimiya,M., Chiyo,M., Wada,A., Okada,S.,
            Hatano,M., Tokuhisa,T., Kimura,H., Watanabe,S., Honda,I.,
            Sakiyama,S., Tagawa,M. and O-Wang,J.
  TITLE     DNA polymerase theta is preferentially expressed in lymphoid
            tissues and upregulated in human cancers
  JOURNAL   Int. J. Cancer 109 (1), 9-16 (2004)
   PUBMED   14735462
  REMARK    GeneRIF: DNA Pol theta has a specialized function in lymphocytes
            and in tumor progression
REFERENCE   7  (bases 1 to 8787)
  AUTHORS   Seki,M., Marini,F. and Wood,R.D.
  TITLE     POLQ (Pol theta), a DNA polymerase and DNA-dependent ATPase in
            human cells
  JOURNAL   Nucleic Acids Res. 31 (21), 6117-6126 (2003)
   PUBMED   14576298
  REMARK    GeneRIF: the isolation of the full-length human DNA POLQ gene, and
            an initial characterization of its gene product, DNA polymerase
            theta
REFERENCE   8  (bases 1 to 8787)
  AUTHORS   Maga,G., Shevelev,I., Ramadan,K., Spadari,S. and Hubscher,U.
  TITLE     DNA polymerase theta purified from human cells is a high-fidelity
            enzyme
  JOURNAL   J. Mol. Biol. 319 (2), 359-369 (2002)
   PUBMED   12051913
  REMARK    GeneRIF: DNA polymerase theta purified from human cells is a
            high-fidelity enzyme.
REFERENCE   9  (bases 1 to 8787)
  AUTHORS   Sharief,F.S., Vojta,P.J., Ropp,P.A. and Copeland,W.C.
  TITLE     Cloning and chromosomal mapping of the human DNA polymerase theta
            (POLQ), the eighth human DNA polymerase
  JOURNAL   Genomics 59 (1), 90-96 (1999)
   PUBMED   10395804
REFERENCE   10 (bases 1 to 8787)
  AUTHORS   Robertson,N.G., Khetarpal,U., Gutierrez-Espeleta,G.A., Bieber,F.R.
            and Morton,C.C.
  TITLE     Isolation of novel and known genes from a human fetal cochlear cDNA
            library using subtractive hybridization and differential screening
  JOURNAL   Genomics 23 (1), 42-50 (1994)
   PUBMED   7829101
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AY338826.2, AC069239.16, AB209867.1, AC079841.10 and AA767021.1.
            On Apr 3, 2007 this sequence version replaced gi:76881816.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data because no single transcript matching the
            genomic sequence was available for the full length of the gene. The
            extent of this transcript is supported by transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY338826.2, AB209867.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025082, ERS025083 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-325               AY338826.2         1-325
            326-326             AC069239.16        53292-53292
            327-1079            AY338826.2         327-1079
            1080-1277           AB209867.1         1008-1205
            1278-1565           AY338826.2         1278-1565
            1566-1566           AC069239.16        78263-78263
            1567-3073           AY338826.2         1567-3073
            3074-3074           AC079841.10        147708-147708       c
            3075-7666           AY338826.2         3075-7666
            7667-7667           AC079841.10        93849-93849         c
            7668-8775           AY338826.2         7668-8775
            8776-8787           AA767021.1         1-12                c
FEATURES             Location/Qualifiers
     source          1..8787
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3q13.33"
     gene            1..8787
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="polymerase (DNA directed), theta"
                     /db_xref="GeneID:10721"
                     /db_xref="HGNC:9186"
                     /db_xref="MIM:604419"
     exon            1..292
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     CDS             130..7902
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /EC_number="2.7.7.7"
                     /note="DNA polymerase eta"
                     /codon_start=1
                     /product="DNA polymerase theta"
                     /protein_id="NP_955452.3"
                     /db_xref="GI:139394648"
                     /db_xref="CCDS:CCDS33833.1"
                     /db_xref="GeneID:10721"
                     /db_xref="HGNC:9186"
                     /db_xref="MIM:604419"
                     /translation="
MNLLRRSGKRRRSESGSDSFSGSGGDSSASPQFLSGSVLSPPPGLGRCLKAAAAGECKPTVPDYERDKLLLANWGLPKAVLEKYHSFGVKKMFEWQAECLLLGQVLEGKNLVYSAPTSAGKTLVAELLILKRVLEMRKKALFILPFVSVAKEKKYYLQSLFQEVGIKVDGYMGSTSPSRHFSSLDIAVCTIERANGLINRLIEENKMDLLGMVVVDELHMLGDSHRGYLLELLLTKICYITRKSASCQADLASSLSNAVQIVGMSATLPNLELVASWLNAELYHTDFRPVPLLESVKVGNSIYDSSMKLVREFEPMLQVKGDEDHVVSLCYETICDNHSVLLFCPSKKWCEKLADIIAREFYNLHHQAEGLVKPSECPPVILEQKELLEVMDQLRRLPSGLDSVLQKTVPWGVAFHHAGLTFEERDIIEGAFRQGLIRVLAATSTLSSGVNLPARRVIIRTPIFGGRPLDILTYKQMVGRAGRKGVDTVGESILICKNSEKSKGIALLQGSLKPVRSCLQRREGEEVTGSMIRAILEIIVGGVASTSQDMHTYAACTFLAASMKEGKQGIQRNQESVQLGAIEACVMWLLENEFIQSTEASDGTEGKVYHPTHLGSATLSSSLSPADTLDIFADLQRAMKGFVLENDLHILYLVTPMFEDWTTIDWYRFFCLWEKLPTSMKRVAELVGVEEGFLARCVKGKVVARTERQHRQMAIHKRFFTSLVLLDLISEVPLREINQKYGCNRGQIQSLQQSAAVYAGMITVFSNRLGWHNMELLLSQFQKRLTFGIQRELCDLVRVSLLNAQRARVLYASGFHTVADLARANIVEVEVILKNAVPFKSARKAVDEEEEAVEERRNMRTIWVTGRKGLTEREAAALIVEEARMILQQDLVEMGVQWNPCALLHSSTCSLTHSESEVKEHTFISQTKSSYKKLTSKNKSNTIFSDSYIKHSPNIVQDLNKSREHTSSFNCNFQNGNQEHQTCSIFRARKRASLDINKEKPGASQNEGKTSDKKVVQTFSQKTKKAPLNFNSEKMSRSFRSWKRRKHLKRSRDSSPLKDSGACRIHLQGQTLSNPSLCEDPFTLDEKKTEFRNSGPFAKNVSLSGKEKDNKTSFPLQIKQNCSWNITLTNDNFVEHIVTGSQSKNVTCQATSVVSEKGRGVAVEAEKINEVLIQNGSKNQNVYMKHHDIHPINQYLRKQSHEQTSTITKQKNIIERQMPCEAVSSYINRDSNVTINCERIKLNTEENKPSHFQALGDDISRTVIPSEVLPSAGAFSKSEGQHENFLNISRLQEKTGTYTTNKTKNNHVSDLGLVLCDFEDSFYLDTQSEKIIQQMATENAKLGAKDTNLAAGIMQKSLVQQNSMNSFQKECHIPFPAEQHPLGATKIDHLDLKTVGTMKQSSDSHGVDILTPESPIFHSPILLEENGLFLKKNEVSVTDSQLNSFLQGYQTQETVKPVILLIPQKRTPTGVEGECLPVPETSLNMSDSLLFDSFSDDYLVKEQLPDMQMKEPLPSEVTSNHFSDSLCLQEDLIKKSNVNENQDTHQQLTCSNDESIIFSEMDSVQMVEALDNVDIFPVQEKNHTVVSPRALELSDPVLDEHHQGDQDGGDQDERAEKSKLTGTRQNHSFIWSGASFDLSPGLQRILDKVSSPLENEKLKSMTINFSSLNRKNTELNEEQEVISNLETKQVQGISFSSNNEVKSKIEMLENNANHDETSSLLPRKESNIVDDNGLIPPTPIPTSASKLTFPGILETPVNPWKTNNVLQPGESYLFGSPSDIKNHDLSPGSRNGFKDNSPISDTSFSLQLSQDGLQLTPASSSSESLSIIDVASDQNLFQTFIKEWRCKKRFSISLACEKIRSLTSSKTATIGSRFKQASSPQEIPIRDDGFPIKGCDDTLVVGLAVCWGGRDAYYFSLQKEQKHSEISASLVPPSLDPSLTLKDRMWYLQSCLRKESDKECSVVIYDFIQSYKILLLSCGISLEQSYEDPKVACWLLDPDSQEPTLHSIVTSFLPHELPLLEGMETSQGIQSLGLNAGSEHSGRYRASVESILIFNSMNQLNSLLQKENLQDVFRKVEMPSQYCLALLELNGIGFSTAECESQKHIMQAKLDAIETQAYQLAGHSFSFTSSDDIAEVLFLELKLPPNREMKNQGSKKTLGSTRRGIDNGRKLRLGRQFSTSKDVLNKLKALHPLPGLILEWRRITNAITKVVFPLQREKCLNPFLGMERIYPVSQSHTATGRITFTEPNIQNVPRDFEIKMPTLVGESPPSQAVGKGLLPMGRGKYKKGFSVNPRCQAQMEERAADRGMPFSISMRHAFVPFPGGSILAADYSQLELRILAHLSHDRRLIQVLNTGADVFRSIAAEWKMIEPESVGDDLRQQAKQICYGIIYGMGAKSLGEQMGIKENDAACYIDSFKSRYTGINQFMTETVKNCKRDGFVQTILGRRRYLPGIKDNNPYRKAHAERQAINTIVQGSAADIVKIATVNIQKQLETFHSTFKSHGHREGMLQSDQTGLSRKRKLQGMFCPIRGGFFILQLHDELLYEVAEEDVVQVAQIVKNEMESAVKLSVKLKVKVKIGASWGELKDFDV
"
     misc_feature    355..2628
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="ski2-like helicase; Provisional; Region: PRK02362"
                     /db_xref="CDD:179415"
     misc_feature    454..933
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="DEAD-like helicases superfamily. A diverse family
                     of proteins involved in ATP-dependent RNA or DNA
                     unwinding. This domain contains the ATP-binding region;
                     Region: DEXDc; cd00046"
                     /db_xref="CDD:28927"
     misc_feature    481..495
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:28927"
     misc_feature    775..786
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O75417.2);
                     Region: DEAH box"
     misc_feature    775..786
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="putative Mg++ binding site [ion binding]; other
                     site"
                     /db_xref="CDD:28927"
     misc_feature    1087..1584
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="Helicase superfamily c-terminal domain; associated
                     with DEXDc-, DEAD-, and DEAH-box proteins, yeast
                     initiation factor 4A, Ski2p, and Hepatitis C virus NS3
                     helicases; this domain is found in a wide variety of
                     helicases and helicase related proteins; may...; Region:
                     HELICc; cd00079"
                     /db_xref="CDD:28960"
     misc_feature    order(1162..1173,1378..1383,1456..1464)
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="nucleotide binding region [chemical binding]; other
                     site"
                     /db_xref="CDD:28960"
     misc_feature    order(1480..1482,1555..1557,1567..1569,1576..1578)
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="ATP-binding site [chemical binding]; other site"
                     /db_xref="CDD:28960"
     misc_feature    3097..3099
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N6-acetyllysine; propagated from
                     UniProtKB/Swiss-Prot (O75417.2); acetylation site"
     misc_feature    5827..7887
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="DNA polymerase I - 3'-5' exonuclease and polymerase
                     domains [DNA replication, recombination, and repair];
                     Region: PolA; COG0749"
                     /db_xref="CDD:31092"
     misc_feature    5827..6384
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="DnaQ-like (or DEDD) 3'-5' exonuclease domain
                     superfamily; Region: DnaQ_like_exo; cl10012"
                     /db_xref="CDD:211457"
     misc_feature    order(6022..6027,6031..6039,6262..6264)
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="active site"
                     /db_xref="CDD:176647"
     misc_feature    order(6022..6027,6031..6036,6262..6264)
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:176647"
     misc_feature    order(6037..6039,6262..6264)
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="catalytic site [active]"
                     /db_xref="CDD:176647"
     misc_feature    6400..>6486
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="Family A polymerase primarily fills DNA gaps that
                     arise during DNA repair, recombination and replication;
                     Region: DNA_pol_A; cl02626"
                     /db_xref="CDD:207677"
     misc_feature    6661..7884
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="DNA polymerase theta is a low-fidelity family A
                     enzyme implicated in translesion synthesis and in somatic
                     hypermutation; Region: DNA_pol_A_theta; cd08638"
                     /db_xref="CDD:176475"
     misc_feature    order(6730..6732,6742..6744,6751..6756,6838..6846,
                     6850..6852,6856..6867,7117..7122,7204..7206,7264..7266,
                     7276..7278,7528..7530,7549..7551,7741..7749)
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="active site"
                     /db_xref="CDD:176475"
     misc_feature    order(6730..6732,6742..6744,6751..6756,6838..6846,
                     6850..6852,6856..6867,7300..7302,7525..7530,7537..7539,
                     7549..7551,7741..7749)
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:176475"
     misc_feature    order(7117..7122,7126..7128,7204..7206,7264..7266,
                     7276..7278,7747..7749)
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /note="catalytic site [active]"
                     /db_xref="CDD:176475"
     exon            293..472
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       326
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:702017"
     exon            473..603
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            604..760
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       672
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:36065146"
     variation       719
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:41545723"
     exon            761..869
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            870..1089
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       1002
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41390550"
     exon            1090..1237
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            1238..1384
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            1385..1597
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       1452
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:35766343"
     variation       1566
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:702018"
     exon            1598..1740
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       1675
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34624267"
     exon            1741..1945
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            1946..2088
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            2089..2282
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            2283..2407
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            2408..2651
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            2652..5758
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     STS             2739..3426
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /standard_name="csnppolq-pcr1-2"
                     /db_xref="UniSTS:243094"
     variation       2892
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3218646"
     variation       3009
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3218641"
     variation       3013
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218636"
     variation       3020
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3218633"
     variation       3074
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3218649"
     variation       3201..3203
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace=""
                     /replace="aaa"
                     /db_xref="dbSNP:41547220"
     variation       3279
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34246901"
     variation       3296
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34778629"
     STS             3307..4086
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /standard_name="csnppolq-pcr1-3"
                     /db_xref="UniSTS:243095"
     variation       3731
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218651"
     variation       3896
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218640"
     variation       3899
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218644"
     STS             3940..4668
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /standard_name="csnppolq-pcr1-4"
                     /db_xref="UniSTS:243096"
     variation       4024
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218632"
     variation       4146
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34240370"
     variation       4186
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218631"
     variation       4270
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3218642"
     STS             4530..5280
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /standard_name="csnppolq-pcr1-5"
                     /db_xref="UniSTS:243097"
     variation       4649
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35877350"
     variation       4764
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3218652"
     variation       4813
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3218643"
     variation       4824
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3218639"
     variation       5380
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35775179"
     exon            5759..5902
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            5903..6099
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       5987
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218637"
     exon            6100..6340
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            6341..6534
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            6535..6672
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            6673..6847
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       6676
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218648"
     exon            6848..6974
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            6975..7096
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       7011
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:532326"
     variation       7040
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:532411"
     exon            7097..7281
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            7282..7393
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            7394..7518
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       7422
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218645"
     variation       7498
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:1142917"
     exon            7519..7672
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     variation       7519
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41540016"
     variation       7522
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3218635"
     variation       7572
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:199513251"
     exon            7673..7788
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     exon            7789..8780
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
                     /inference="alignment:Splign:1.39.8"
     polyA_signal    8754..8759
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
     polyA_site      8780
                     /gene="POLQ"
                     /gene_synonym="POLH; PRO0327"
ORIGIN      
gggcgggccgggaggtttgagtttgaagactggcgggaagatgtccgcagctgttgccaggccagggttctcccgagagggaggacgctgggactgtggcttgccctgatcggccgagaagagtttgccatgaatcttctgcgtcggagtgggaaacggcggcgttcagaatcaggctcagattcgttctcgggaagcggcggtgacagcagtgccagcccccagttcctctccgggtccgtgctgagcccgccgcccggccttggtcgctgcctgaaggccgcagctgcaggagaatgcaagcctacagttcctgactacgaaagagacaagctactattggcaaactggggacttcctaaagcagttctggaaaaataccacagttttggtgtaaaaaagatgtttgaatggcaggcagagtgccttttgcttggacaagtcctggaaggaaagaatttagtttattcagctcctacaagtgctgggaagactcttgtggcagaattacttattttgaagcgggttttggaaatgcggaagaaagctttgtttattcttccctttgtttctgtggctaaagagaagaaatactacctccagagtctgtttcaggaagtaggaataaaagtagacggttatatgggcagcacctctccatcaaggcatttctcttcattggatattgcagtctgcacaattgagagagccaatggtctgatcaatcgcctcatagaggaaaataagatggatctgttaggaatggtggttgtggatgaattacatatgctgggagactctcaccgagggtatctgctggaacttttgctgaccaagatttgctatattactcggaaatcagcatcttgtcaggcagatctagccagttctctgtctaatgctgtgcaaatcgttggcatgagtgctacccttcctaatttggagcttgtggcttcctggttgaatgctgaactctaccataccgactttcgccctgtaccgcttttggagtcagtaaaagttggaaattccatatatgactcttcaatgaaacttgtgagggaatttgagcccatgctacaagtgaagggagatgaggaccatgttgttagtttatgttatgagacgatttgtgataaccattcagtattacttttttgtccatcaaagaaatggtgtgagaagctggcagatatcattgctcgagagttttataatctacatcatcaagctgagggattggtgaaaccctctgaatgcccaccagtaattctggaacaaaaagaactcctggaagtgatggatcagttaagacgtttgccttcaggactggactctgtattacagaaaactgtaccatggggagtagcatttcatcatgcaggtcttacttttgaggagagggatatcattgaaggagcctttcgtcaaggtctcattcgggtcttggcggcaacttctactctttcttctggggtgaatttacctgcacgtcgtgtgattattcgaacccctatttttggtggtcgacctctagatattcttacttataagcagatggttggccgtgctggcaggaaaggagtggacacagtaggcgagagtatcttaatttgtaagaactctgagaaatcaaaaggcatagctctccttcagggttctctaaagcctgttcgcagctgtctgcaaagacgagaaggagaagaagtaactggcagcatgatacgagctattctggagataatagttggtggagtggcaagtacatcacaagatatgcatacttatgctgcctgcacatttttggctgcaagtatgaaagaagggaagcaaggaattcagagaaatcaagagtctgttcagcttggagcgattgaggcctgtgtgatgtggctactagaaaatgaattcatccagagtacagaagccagtgatggaacagaaggaaaggtgtatcatccaacacatcttggttcggccactctttcttcttcactttctccagctgatactttagatatttttgctgacctgcaaagagcaatgaagggctttgttttagagaatgatcttcatattctctatctggttacacctatgtttgaggattggactactattgattggtatcgatttttctgtttatgggagaagttgccaacttcaatgaaaagggtggcagagctagtgggagttgaagaggggttcttggcccgttgtgtgaaaggaaaagtagtagccagaactgagagacagcatcgacaaatggccatccataaaaggtttttcaccagtcttgtgctattagatttaatcagtgaagttcccttaagggaaataaatcagaaatatggatgcaatcgtgggcagattcaatctttgcaacagtcagctgctgtttatgcagggatgattacagtattttccaaccgtctgggctggcacaacatggaactactactttcccaatttcagaagcgtcttacgtttggcatccagagggagctgtgtgacctggttcgggtatccttactaaatgctcagagagccagggttctctatgcttctggctttcatactgtggcagaccttgctagagcaaatattgtggaggtggaggtgattctgaaaaatgctgtgcctttcaaaagtgcccggaaggcagtggatgaggaagaggaagcagttgaagaacgtcgcaatatgcgaactatctgggtgactggcagaaaaggtttaactgaaagggaagcagcagcccttatagtggaagaagccagaatgattctgcagcaggacttagttgaaatgggagtgcaatggaatccatgtgccctgttacattctagtacatgctcattgactcatagtgagtccgaagtaaaggaacacacatttatatcccaaactaagagttcttataaaaaattaacatcaaagaacaaaagtaacacaatatttagtgattcttatattaagcattcaccaaatatagtgcaagacttaaataaaagtagagagcatacaagttcctttaattgtaatttccagaatgggaatcaagaacatcagacatgttccattttcagagcaagaaaacgggcctctttagatataaataaagagaagccaggagcctctcagaatgaggggaaaacaagtgataagaaagttgttcagactttttcacagaaaacaaaaaaggcacctttgaatttcaattcagaaaagatgagcagaagttttcgatcttggaaacgtagaaagcatctaaagcgatctagggacagcagccccctgaaagactctggagcgtgtagaatccatttacaaggacagactctgtctaatcctagtctttgtgaagacccgtttaccttagatgagaagaaaacggaatttagaaattcagggccatttgctaaaaatgtatctttgagtggtaaggaaaaagataataaaacatcattcccattacaaataaagcaaaattgttcatggaacataacactaactaatgataattttgtggagcatattgtcacaggatctcagagtaaaaatgtgacttgtcaggccactagtgtggttagtgaaaagggcagaggagtagctgttgaggcagaaaaaataaatgaagtgctgatacaaaatggttcaaaaaaccagaatgtttatatgaaacaccatgacatccatccaattaaccagtacctgcgaaagcaatctcatgaacagacaagcactattaccaaacagaaaaatataatagagagacaaatgccctgtgaagcagtcagtagttacataaatagagactcaaatgttactatcaattgtgaaaggataaagcttaatacagaggaaaataaaccaagtcattttcaggcattaggagatgatataagcagaactgtgatacccagtgaagtacttccatcagctggagcatttagcaaatcagaaggccagcatgagaattttctaaatatttctagactacaagaaaaaacaggtacttatacaacaaacaaaactaaaaataatcatgtttctgacttaggtttagtcctctgtgattttgaagatagtttctatctggatactcagtcagagaaaataatacaacagatggcaactgaaaatgccaaactaggagcaaaggacaccaacctggcagcagggataatgcagaagagcttagtccaacagaactcaatgaactcttttcagaaggagtgtcacattccttttcctgctgaacagcaccctctaggagcgactaagatagatcatttggaccttaagactgtaggtactatgaaacaaagcagtgattcacatggggttgatatcctgactccagaaagcccgattttccattctccaatactattggaggaaaatggtctttttttaaaaaagaatgaagtttctgttactgattcacaattaaatagttttcttcaaggttatcaaacacaagaaactgtgaaaccagttatacttctgattcctcaaaagagaactcccactggtgtagaaggagaatgtcttccagttcctgaaacaagtttgaatatgagtgatagtttactatttgatagcttcagtgatgactatctagtaaaagaacaattacctgatatgcaaatgaaagaaccccttccttcagaagtaacatcaaaccattttagtgattctctgtgtctacaagaagacctaattaaaaaatcaaatgtaaatgagaatcaagatacccaccagcagttgacttgttccaatgatgaatctattatattttcagaaatggattctgttcagatggttgaagctttggacaatgtggatatatttcctgtccaagagaagaatcatactgtagtatctcctagagcattagaactaagtgatccagtacttgatgagcaccaccaaggtgatcaagatggaggagatcaagatgaaagggctgaaaaatcaaaattaactgggaccaggcaaaatcattcattcatatggtcaggggcatcatttgatctaagtccaggactgcaaaggattttagataaagtatccagtcctctagaaaatgaaaagctaaaatcaatgactataaacttttccagtttgaatagaaaaaatacagagttaaatgaagaacaagaagttatttcaaacttggagacaaaacaagtgcagggaatttcattttcttctaataatgaagtaaaaagcaagattgagatgctagaaaacaatgccaatcatgatgaaacctcatccctcttacctcgtaaagaaagtaatatagttgatgataatggtctcattcctcctacacccattccaacatctgcttctaagctgacatttccagggattcttgaaacacctgtaaacccttggaaaactaataatgttttacaacctggtgaaagttatttatttggctcaccttcagatattaaaaaccacgatttaagtccagggagtagaaatgggttcaaagacaacagccctattagtgacacaagcttttcacttcagttatcacaggatggattacagttaactccagcctcaagcagttcagaaagtttgtccataattgatgtagcaagtgaccaaaatcttttccaaacattcattaaggagtggcggtgcaaaaagcgattttccatctcactggcttgtgaaaagattagaagtttgacatcttctaaaactgctactattggcagtaggtttaagcaagctagctcacctcaggaaattcctattagagatgatggatttcccattaaaggttgtgatgacaccttggtggttggactggcagtatgctggggtggaagggatgcctattatttttcactgcagaaggaacaaaagcattctgaaattagtgccagtttggttccaccttctttagatccaagcctgactttgaaagacaggatgtggtaccttcaatcttgcttgcgaaaggaatctgataaagaatgttctgttgtcatctatgacttcatccagagctataaaattcttcttctttcttgtggcatctccttggagcaaagttatgaagatcctaaggtggcatgctggttactagatccagattctcaggagccgactcttcatagcatagttaccagttttcttcctcatgagcttccactcctagaagggatggagaccagccaagggattcaaagcctggggctaaatgctggcagtgagcattctgggcgatacagagcatctgtggagtccattctcatcttcaactctatgaatcagctcaactctttgttgcagaaggaaaaccttcaagatgttttccgtaaggtggaaatgccctctcagtactgcttggccttgctagaactaaatggaattggctttagtactgcagaatgtgaaagtcagaaacatataatgcaagccaagctggatgcaattgagacccaggcctatcaactagctggccacagtttttctttcaccagttcagatgacatcgctgaggttttatttttggaattgaagttgcccccaaatagagagatgaaaaaccaaggcagcaagaaaactctgggttctaccagaagagggattgacaatggacgcaagctaaggctgggaagacagttcagcactagtaaggacgttttaaataaattaaaggcattacatcctttaccaggcttgatattagaatggagaagaatcactaatgctattaccaaagtggtctttccccttcagcgggaaaagtgtcttaatccttttcttggaatggaaagaatctatcctgtatcacagtcgcacactgctacaggacgaataacctttacagaaccaaatattcagaatgtgccaagagattttgaaatcaaaatgccaacactagtaggagaaagcccaccttctcaagctgtaggcaaaggcctacttcccatgggcagaggaaaatataagaagggtttcagcgtgaatcctagatgccaggcacagatggaggagagagctgcagacagaggaatgccattttcaattagcatgcgacatgcctttgtgcctttcccaggtggttcaatactggctgctgactactctcagcttgaactgaggatcttggctcatttatcccatgatcgtcgtctcattcaagtgttaaacactggagctgatgttttcaggagcattgcagcagagtggaagatgattgagccagagtctgttggggatgatctgaggcagcaggcaaaacagatttgctatgggatcatttatggaatgggagctaaatctttgggagagcagatgggcattaaagaaaatgatgctgcatgctatattgactccttcaaatccagatacacagggattaatcaattcatgacagagacagtgaagaattgtaaaagagacggatttgttcagaccattttgggaaggcgtagatatttgccaggaatcaaagacaacaacccttatcgtaaagctcacgctgagcgtcaagctatcaacacaatagtccaaggatcagcagctgatattgtcaaaatagccacagttaacattcagaagcaattagagaccttccactcaaccttcaaatcccatggtcatcgagagggtatgctccaaagtgaccaaacaggattgtcacgaaagagaaaactgcaagggatgttctgcccaatcagaggaggcttcttcatccttcaactccatgatgaactcctatatgaagtggcagaagaagatgttgttcaggtagctcagattgtcaagaatgaaatggaaagtgctgtaaaactgtctgtgaaattgaaagtgaaagtgaaaataggcgccagctggggagagctaaaggactttgatgtgtaactgtgctgttgatgaagtcctcccagggaagcctgtgcagatgcagtcacctggaaagaacagagattaccctttcacctacctcagcaaaacaaactttcaagtcttgatagacttagcctagtaattttatagtgagagtttcaaactatatatcagtgtctatagcatcaaaaacttctgggggcgtgggggaagtagaataccaagtataatagttacattcactttcaaagagcatctatgaatttgccttttgtaacttactgtggctttaaacatattcagaacagatgcttgaaatatgcacttagcactttggttccacatctgtctgggtaaaccatgaagaaaatgaagctgctgcctcaatcgacccagacagcagccataggcagataaagatttggtttcaccctggtggtggtaggcatcgtgtgtgactttttttcctctaatatcaattttacagtacggaaatagtattttaaaatagtattggctaataaattatgaattctataaagtagtaagacttggtatggttggagtgtaggaatgaatattcatgaaatgtttcttattgcttttccttccctaattcatacaatgaatgtatttggaatacttacatattataaaataaactatacctcttcaagaggtatcctgttctgtaagatcagatgtttttattgcaggtcaatataatactgccagagacagaaaatacccccttatcagtcccttagtgcctctttctgtttgtggcatggtgagaaaacccatgctgaaaagattgtactttgtgatcccaatcagagggatggagctaatctttttgctgttgaaataaaatgaatttatgagaaactttaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:10721 -> Molecular function: GO:0003684 [damaged DNA binding] evidence: TAS
            GeneID:10721 -> Molecular function: GO:0003887 [DNA-directed DNA polymerase activity] evidence: IDA
            GeneID:10721 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:10721 -> Molecular function: GO:0008026 [ATP-dependent helicase activity] evidence: IEA
            GeneID:10721 -> Molecular function: GO:0043142 [single-stranded DNA-dependent ATPase activity] evidence: IDA
            GeneID:10721 -> Biological process: GO:0006260 [DNA replication] evidence: IEA
            GeneID:10721 -> Biological process: GO:0006281 [DNA repair] evidence: IEA
            GeneID:10721 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_955452 -> EC 2.7.7.7

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.