GGRNA Home | Help | Advanced search

2024-04-27 09:29:47, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_198056               8504 bp    mRNA    linear   PRI 15-JUL-2013
DEFINITION  Homo sapiens sodium channel, voltage-gated, type V, alpha subunit
            (SCN5A), transcript variant 1, mRNA.
ACCESSION   NM_198056 XM_940695
VERSION     NM_198056.2  GI:124518659
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 8504)
  AUTHORS   Crotti,L., Tester,D.J., White,W.M., Bartos,D.C., Insolia,R.,
            Besana,A., Kunic,J.D., Will,M.L., Velasco,E.J., Bair,J.J.,
            Ghidoni,A., Cetin,I., Van Dyke,D.L., Wick,M.J., Brost,B.,
            Delisle,B.P., Facchinetti,F., George,A.L., Schwartz,P.J. and
            Ackerman,M.J.
  TITLE     Long QT syndrome-associated mutations in intrauterine fetal death
  JOURNAL   JAMA 309 (14), 1473-1482 (2013)
   PUBMED   23571586
  REMARK    GeneRIF: 5 intrauterine fetal deaths hosted SCN5A rare
            nonsynonymous genetic variants that conferred in vitro
            electrophysiological characteristics consistent with potentially
            proarrhythmic phenotypes.
REFERENCE   2  (bases 1 to 8504)
  AUTHORS   Ritchie MD, Denny JC, Zuvich RL, Crawford DC, Schildcrout JS,
            Bastarache L, Ramirez AH, Mosley JD, Pulley JM, Basford MA,
            Bradford Y, Rasmussen LV, Pathak J, Chute CG, Kullo IJ, McCarty CA,
            Chisholm RL, Kho AN, Carlson CS, Larson EB, Jarvik GP, Sotoodehnia
            N, Manolio TA, Li R, Masys DR, Haines JL and Roden DM.
  CONSRTM   Cohorts for Heart and Aging Research in Genomic Epidemiology
            (CHARGE) QRS Group
  TITLE     Genome- and phenome-wide analyses of cardiac conduction identifies
            markers of arrhythmia risk
  JOURNAL   Circulation 127 (13), 1377-1385 (2013)
   PUBMED   23463857
REFERENCE   3  (bases 1 to 8504)
  AUTHORS   Hu,R.M., Tan,B.H., Orland,K.M., Valdivia,C.R., Peterson,A., Pu,J.
            and Makielski,J.C.
  TITLE     Digenic inheritance novel mutations in SCN5a and SNTA1 increase
            late I(Na) contributing to LQT syndrome
  JOURNAL   Am. J. Physiol. Heart Circ. Physiol. 304 (7), H994-H1001 (2013)
   PUBMED   23376825
  REMARK    GeneRIF: Novel mutations in SCN5A and SNTA1 jointly increase the
            INa current late/peak ratio and time constants of current decay.
REFERENCE   4  (bases 1 to 8504)
  AUTHORS   Calloe,K., Refaat,M.M., Grubb,S., Wojciak,J., Campagna,J.,
            Thomsen,N.M., Nussbaum,R.L., Scheinman,M.M. and Schmitt,N.
  TITLE     Characterization and mechanisms of action of novel NaV1.5 channel
            mutations associated with Brugada syndrome
  JOURNAL   Circ Arrhythm Electrophysiol 6 (1), 177-184 (2013)
   PUBMED   23424222
  REMARK    GeneRIF: Na(V)1.5-S1218I and R811H are novel loss-of-function
            mutations in the SCN5A gene causing Brugada syndrome.
REFERENCE   5  (bases 1 to 8504)
  AUTHORS   Vanoye,C.G., Kunic,J.D., Ehring,G.R. and George,A.L. Jr.
  TITLE     Mechanism of sodium channel NaV1.9 potentiation by G-protein
            signaling
  JOURNAL   J. Gen. Physiol. 141 (2), 193-202 (2013)
   PUBMED   23359282
  REMARK    GeneRIF: Our results advance our understanding about the mechanism
            of Na(V)1.9 potentiation by G-protein signaling during
            inflammation.
REFERENCE   6  (bases 1 to 8504)
  AUTHORS   Olson,T.M. and Keating,M.T.
  TITLE     Mapping a cardiomyopathy locus to chromosome 3p22-p25
  JOURNAL   J. Clin. Invest. 97 (2), 528-532 (1996)
   PUBMED   8567977
REFERENCE   7  (bases 1 to 8504)
  AUTHORS   Wang,Q., Shen,J., Li,Z., Timothy,K., Vincent,G.M., Priori,S.G.,
            Schwartz,P.J. and Keating,M.T.
  TITLE     Cardiac sodium channel mutations in patients with long QT syndrome,
            an inherited cardiac arrhythmia
  JOURNAL   Hum. Mol. Genet. 4 (9), 1603-1607 (1995)
   PUBMED   8541846
REFERENCE   8  (bases 1 to 8504)
  AUTHORS   George,A.L. Jr., Varkony,T.A., Drabkin,H.A., Han,J., Knops,J.F.,
            Finley,W.H., Brown,G.B., Ward,D.C. and Haas,M.
  TITLE     Assignment of the human heart tetrodotoxin-resistant voltage-gated
            Na+ channel alpha-subunit gene (SCN5A) to band 3p21
  JOURNAL   Cytogenet. Cell Genet. 68 (1-2), 67-70 (1995)
   PUBMED   7956363
REFERENCE   9  (bases 1 to 8504)
  AUTHORS   Jiang,C., Atkinson,D., Towbin,J.A., Splawski,I., Lehmann,M.H.,
            Li,H., Timothy,K., Taggart,R.T., Schwartz,P.J., Vincent,G.M. et al.
  TITLE     Two long QT syndrome loci map to chromosomes 3 and 7 with evidence
            for further heterogeneity
  JOURNAL   Nat. Genet. 8 (2), 141-147 (1994)
   PUBMED   7842012
REFERENCE   10 (bases 1 to 8504)
  AUTHORS   Gellens,M.E., George,A.L. Jr., Chen,L.Q., Chahine,M., Horn,R.,
            Barchi,R.L. and Kallen,R.G.
  TITLE     Primary structure and functional expression of the human cardiac
            tetrodotoxin-insensitive voltage-dependent sodium channel
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 89 (2), 554-558 (1992)
   PUBMED   1309946
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BU845010.1, M77235.1,
            AB158469.2, AF482988.1 and AP006241.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Feb 7, 2007 this sequence version replaced gi:37622906.
            
            Summary: The protein encoded by this gene is an integral membrane
            protein and tetrodotoxin-resistant voltage-gated sodium channel
            subunit. This protein is found primarily in cardiac muscle and is
            responsible for the initial upstroke of the action potential in an
            electrocardiogram. Defects in this gene are a cause of long QT
            syndrome type 3 (LQT3), an autosomal dominant cardiac disease.
            Alternative splicing results in several transcript variants
            encoding different isoforms. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (1) encodes the longest isoform
            (a).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: M77235.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-44                BU845010.1         1-44
            45-280              M77235.1           1-236
            281-765             AB158469.2         129-613
            766-1033            M77235.1           722-989
            1034-2110           AB158469.2         882-1958
            2111-3422           AF482988.1         1926-3237
            3423-3445           M77235.1           3379-3401
            3446-6279           AF482988.1         3258-6091
            6280-8504           AP006241.1         56242-58466         c
FEATURES             Location/Qualifiers
     source          1..8504
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3p21"
     gene            1..8504
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="sodium channel, voltage-gated, type V, alpha
                     subunit"
                     /db_xref="GeneID:6331"
                     /db_xref="HGNC:10593"
                     /db_xref="MIM:600163"
     exon            1..142
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 1, numbering commonly used in
                     literature and the LOVD database."
     variation       130
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45608739"
     exon            143..467
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
     CDS             195..6245
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="isoform a is encoded by transcript variant 1;
                     cardiac tetrodotoxin-insensitive voltage-dependent sodium
                     channel alpha subunit; sodium channel protein type 5
                     subunit alpha; voltage-gated sodium channel subunit alpha
                     Nav1.5; sodium channel protein cardiac muscle subunit
                     alpha"
                     /codon_start=1
                     /product="sodium channel protein type 5 subunit alpha
                     isoform a"
                     /protein_id="NP_932173.1"
                     /db_xref="GI:37622907"
                     /db_xref="CCDS:CCDS46796.1"
                     /db_xref="GeneID:6331"
                     /db_xref="HGNC:10593"
                     /db_xref="MIM:600163"
                     /translation="
MANFLLPRGTSSFRRFTRESLAAIEKRMAEKQARGSTTLQESREGLPEEEAPRPQLDLQASKKLPDLYGNPPQELIGEPLEDLDPFYSTQKTFIVLNKGKTIFRFSATNALYVLSPFHPIRRAAVKILVHSLFNMLIMCTILTNCVFMAQHDPPPWTKYVEYTFTAIYTFESLVKILARGFCLHAFTFLRDPWNWLDFSVIIMAYTTEFVDLGNVSALRTFRVLRALKTISVISGLKTIVGALIQSVKKLADVMVLTVFCLSVFALIGLQLFMGNLRHKCVRNFTALNGTNGSVEADGLVWESLDLYLSDPENYLLKNGTSDVLLCGNSSDAGTCPEGYRCLKAGENPDHGYTSFDSFAWAFLALFRLMTQDCWERLYQQTLRSAGKIYMIFFMLVIFLGSFYLVNLILAVVAMAYEEQNQATIAETEEKEKRFQEAMEMLKKEHEALTIRGVDTVSRSSLEMSPLAPVNSHERRSKRRKRMSSGTEECGEDRLPKSDSEDGPRAMNHLSLTRGLSRTSMKPRSSRGSIFTFRRRDLGSEADFADDENSTAGESESHHTSLLVPWPLRRTSAQGQPSPGTSAPGHALHGKKNSTVDCNGVVSLLGAGDPEATSPGSHLLRPVMLEHPPDTTTPSEEPGGPQMLTSQAPCVDGFEEPGARQRALSAVSVLTSALEELEESRHKCPPCWNRLAQRYLIWECCPLWMSIKQGVKLVVMDPFTDLTITMCIVLNTLFMALEHYNMTSEFEEMLQVGNLVFTGIFTAEMTFKIIALDPYYYFQQGWNIFDSIIVILSLMELGLSRMSNLSVLRSFRLLRVFKLAKSWPTLNTLIKIIGNSVGALGNLTLVLAIIVFIFAVVGMQLFGKNYSELRDSDSGLLPRWHMMDFFHAFLIIFRILCGEWIETMWDCMEVSGQSLCLLVFLLVMVIGNLVVLNLFLALLLSSFSADNLTAPDEDREMNNLQLALARIQRGLRFVKRTTWDFCCGLLRQRPQKPAALAAQGQLPSCIATPYSPPPPETEKVPPTRKETRFEEGEQPGQGTPGDPEPVCVPIAVAESDTDDQEEDEENSLGTEEESSKQQESQPVSGGPEAPPDSRTWSQVSATASSEAEASASQADWRQQWKAEPQAPGCGETPEDSCSEGSTADMTNTAELLEQIPDLGQDVKDPEDCFTEGCVRRCPCCAVDTTQAPGKVWWRLRKTCYHIVEHSWFETFIIFMILLSSGALAFEDIYLEERKTIKVLLEYADKMFTYVFVLEMLLKWVAYGFKKYFTNAWCWLDFLIVDVSLVSLVANTLGFAEMGPIKSLRTLRALRPLRALSRFEGMRVVVNALVGAIPSIMNVLLVCLIFWLIFSIMGVNLFAGKFGRCINQTEGDLPLNYTIVNNKSQCESLNLTGELYWTKVKVNFDNVGAGYLALLQVATFKGWMDIMYAAVDSRGYEEQPQWEYNLYMYIYFVIFIIFGSFFTLNLFIGVIIDNFNQQKKKLGGQDIFMTEEQKKYYNAMKKLGSKKPQKPIPRPLNKYQGFIFDIVTKQAFDVTIMFLICLNMVTMMVETDDQSPEKINILAKINLLFVAIFTGECIVKLAALRHYYFTNSWNIFDFVVVILSIVGTVLSDIIQKYFFSPTLFRVIRLARIGRILRLIRGAKGIRTLLFALMMSLPALFNIGLLLFLVMFIYSIFGMANFAYVKWEAGIDDMFNFQTFANSMLCLFQITTSAGWDGLLSPILNTGPPYCDPTLPNSNGSRGDCGSPAVGILFFTTYIIISFLIVVNMYIAIILENFSVATEESTEPLSEDDFDMFYEIWEKFDPEATQFIEYSVLSDFADALSEPLRIAKPNQISLINMDLPMVSGDRIHCMDILFAFTKRVLGESGEMDALKIQMEEKFMAANPSKISYEPITTTLRRKHEEVSAMVIQRAFRRHLLQRSLKHASFLFRQQAGSGLSEEDAPEREGLIAYVMSENFSRPLGPPSSSSISSTSFPPSYDSVTRATSDNLQVRGSDYSHSEDLADFPPSPDRDRESIV
"
     misc_feature    573..644
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    669..>1067
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="Ion transport protein; Region: Ion_trans;
                     pfam00520"
                     /db_xref="CDD:201279"
     misc_feature    669..728
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    768..824
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    843..902
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    951..1022
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    <1200..1430
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="Ion transport protein; Region: Ion_trans;
                     pfam00520"
                     /db_xref="CDD:201279"
     misc_feature    1362..1439
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    1575..2198
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="Domain of unknown function (DUF3451); Region:
                     DUF3451; pfam11933"
                     /db_xref="CDD:204785"
     misc_feature    1731..1733
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Dimethylated arginine, alternate;
                     Omega-N-methylarginine, alternate; propagated from
                     UniProtKB/Swiss-Prot (Q14524.2); methylation site"
     misc_feature    1770..1772
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Dimethylated arginine, alternate;
                     Omega-N-methylarginine, alternate; propagated from
                     UniProtKB/Swiss-Prot (Q14524.2); methylation site"
     misc_feature    2232..2234
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Dimethylated arginine, alternate;
                     Omega-N-methylarginine, alternate; propagated from
                     UniProtKB/Swiss-Prot (Q14524.2); methylation site"
     misc_feature    2328..2402
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    2436..2507
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    2451..2972
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="Ion transport protein; Region: Ion_trans;
                     pfam00520"
                     /db_xref="CDD:201279"
     misc_feature    2532..2591
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    2610..2669
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    2718..2780
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    2934..3011
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    3051..>3212
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="Sodium ion transport-associated; Region:
                     Na_trans_assoc; pfam06512"
                     /db_xref="CDD:203469"
     misc_feature    <3579..3839
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="Sodium ion transport-associated; Region:
                     Na_trans_assoc; pfam06512"
                     /db_xref="CDD:203469"
     misc_feature    3795..3866
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    3906..3983
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    3915..4601
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="Ion transport protein; Region: Ion_trans;
                     pfam00520"
                     /db_xref="CDD:201279"
     misc_feature    4002..4067
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    4080..4145
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    4203..4271
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    4524..4604
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    4764..4835
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    4869..4940
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    4881..5507
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="Ion transport protein; Region: Ion_trans;
                     pfam00520"
                     /db_xref="CDD:201279"
     misc_feature    <4887..5528
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /note="Polycystin cation channel; Region: PKD_channel;
                     pfam08016"
                     /db_xref="CDD:203839"
     misc_feature    4959..5030
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    5061..5126
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    5172..5240
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    5436..5510
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     transmembrane region"
     misc_feature    6114..6125
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q14524.2);
                     Region: Interaction with NEDD4, NEDD4L and WWP2"
     exon            468..586
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
     STS             468..586
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /standard_name="GDB:624564"
                     /db_xref="UniSTS:158350"
     variation       548
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45533640"
     exon            587..676
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
     exon            677..805
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
     variation       680
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45489099"
     exon            806..897
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 6, numbering commonly used in
                     literature and the LOVD database."
     exon            898..1128
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 7, numbering commonly used in
                     literature and the LOVD database."
     variation       938
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45453395"
     variation       995
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45587735"
     variation       1034
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72549413"
     exon            1129..1192
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 8, numbering commonly used in
                     literature and the LOVD database."
     exon            1193..1334
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 9, numbering commonly used in
                     literature and the LOVD database."
     variation       1211
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17215493"
     variation       1259
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45570333"
     exon            1335..1532
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 10, numbering commonly used
                     in literature and the LOVD database."
     variation       1430
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45565936"
     exon            1533..1712
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 11, numbering commonly used
                     in literature and the LOVD database."
     variation       1541
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:45477694"
     exon            1713..2084
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 12, numbering commonly used
                     in literature and the LOVD database."
     variation       1781
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45624133"
     variation       1875
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45522138"
     variation       1896
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45600438"
     exon            2085..2217
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 13, numbering commonly used
                     in literature and the LOVD database."
     exon            2218..2456
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 14, numbering commonly used
                     in literature and the LOVD database."
     variation       2366
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:45583237"
     exon            2457..2630
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 15, numbering commonly used
                     in literature and the LOVD database."
     exon            2631..2981
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 16, numbering commonly used
                     in literature and the LOVD database."
     STS             2961..3833
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /standard_name="Scn5a"
                     /db_xref="UniSTS:516644"
     exon            2982..3422
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 17, numbering commonly used
                     in literature and the LOVD database."
     variation       3315
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45491996"
     variation       3362
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:45480800"
     exon            3423..3584
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 18, numbering commonly used
                     in literature and the LOVD database."
     exon            3585..3705
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 19, numbering commonly used
                     in literature and the LOVD database."
     exon            3706..3860
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 20, numbering commonly used
                     in literature and the LOVD database."
     variation       3758
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17221875"
     exon            3861..4034
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 21, numbering commonly used
                     in literature and the LOVD database."
     exon            4035..4157
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 22, numbering commonly used
                     in literature and the LOVD database."
     exon            4158..4439
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 23, numbering commonly used
                     in literature and the LOVD database."
     exon            4440..4493
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 24, numbering commonly used
                     in literature and the LOVD database."
     exon            4494..4631
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 25, numbering commonly used
                     in literature and the LOVD database."
     exon            4632..4736
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 26, numbering commonly used
                     in literature and the LOVD database."
     exon            4737..5007
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 27, numbering commonly used
                     in literature and the LOVD database."
     STS             4815..5207
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /standard_name="Scn3a"
                     /db_xref="UniSTS:516640"
     exon            5008..8504
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /inference="alignment:Splign:1.39.8"
                     /note="alternate designation 28, numbering commonly used
                     in literature and the LOVD database."
     variation       5018
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45437099"
     variation       5442
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:45606037"
     variation       5651
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1805126"
     STS             6107..6463
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /standard_name="GDB:555574"
                     /db_xref="UniSTS:157686"
     variation       6373
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45601739"
     STS             6451..6629
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /standard_name="D3S4190"
                     /db_xref="UniSTS:43452"
     STS             6496..6793
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /standard_name="GDB:624573"
                     /db_xref="UniSTS:158352"
     variation       6627
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45459402"
     variation       6797
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45615435"
     variation       6840
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4073687"
     variation       6904
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45446194"
     variation       6922
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45458203"
     variation       7067
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45600839"
     variation       7267
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45548632"
     variation       7449
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45502198"
     variation       7681
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45589543"
     variation       7813
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:45503498"
     variation       7854
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:45589940"
     variation       7866
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45512996"
     variation       7869
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45441103"
     STS             7919..8459
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /standard_name="SCN5A_3457"
                     /db_xref="UniSTS:471751"
     variation       7988
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45474195"
     variation       8045
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:45615238"
     variation       8065
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:45610536"
     variation       8129
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45624736"
     variation       8252
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45593136"
     variation       8380
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:45502793"
     variation       8390..8391
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
                     /replace=""
                     /replace="gagaagagagtaggaaaaaggaggg"
                     /db_xref="dbSNP:45592631"
     polyA_signal    8487..8492
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
     polyA_site      8504
                     /gene="SCN5A"
                     /gene_synonym="CDCD2; CMD1E; CMPD2; HB1; HB2; HBBD; HH1;
                     ICCD; IVF; LQT3; Nav1.5; PFHB1; SSS1; VF1"
ORIGIN      
agacggcggcggcgcccgtaggatgcagggatcgctcccccggggccgctgagcctgcgcccagtgccccgagccccgcgccgagccgagtccgcgccaagcagcagccgcccaccccggggcccggccgggggaccagcagcttccccacaggcaacgtgaggagagcctgtgcccagaagcaggatgagaagatggcaaacttcctattacctcggggcaccagcagcttccgcaggttcacacgggagtccctggcagccatcgagaagcgcatggcagagaagcaagcccgcggctcaaccaccttgcaggagagccgagaggggctgcccgaggaggaggctccccggccccagctggacctgcaggcctccaaaaagctgccagatctctatggcaatccaccccaagagctcatcggagagcccctggaggacctggaccccttctatagcacccaaaagactttcatcgtactgaataaaggcaagaccatcttccggttcagtgccaccaacgccttgtatgtcctcagtcccttccaccccatccggagagcggctgtgaagattctggttcactcgctcttcaacatgctcatcatgtgcaccatcctcaccaactgcgtgttcatggcccagcacgaccctccaccctggaccaagtatgtcgagtacaccttcaccgccatttacacctttgagtctctggtcaagattctggctcgaggcttctgcctgcacgcgttcactttccttcgggacccatggaactggctggactttagtgtgattatcatggcatacacaactgaatttgtggacctgggcaatgtctcagccttacgcaccttccgagtcctccgggccctgaaaactatatcagtcatttcagggctgaagaccatcgtgggggccctgatccagtctgtgaagaagctggctgatgtgatggtcctcacagtcttctgcctcagcgtctttgccctcatcggcctgcagctcttcatgggcaacctaaggcacaagtgcgtgcgcaacttcacagcgctcaacggcaccaacggctccgtggaggccgacggcttggtctgggaatccctggacctttacctcagtgatccagaaaattacctgctcaagaacggcacctctgatgtgttactgtgtgggaacagctctgacgctgggacatgtccggagggctaccggtgcctaaaggcaggcgagaaccccgaccacggctacaccagcttcgattcctttgcctgggcctttcttgcactcttccgcctgatgacgcaggactgctgggagcgcctctatcagcagaccctcaggtccgcagggaagatctacatgatcttcttcatgcttgtcatcttcctggggtccttctacctggtgaacctgatcctggccgtggtcgcaatggcctatgaggagcaaaaccaagccaccatcgctgagaccgaggagaaggaaaagcgcttccaggaggccatggaaatgctcaagaaagaacacgaggccctcaccatcaggggtgtggataccgtgtcccgtagctccttggagatgtcccctttggccccagtaaacagccatgagagaagaagcaagaggagaaaacggatgtcttcaggaactgaggagtgtggggaggacaggctccccaagtctgactcagaagatggtcccagagcaatgaatcatctcagcctcacccgtggcctcagcaggacttctatgaagccacgttccagccgcgggagcattttcacctttcgcaggcgagacctgggttctgaagcagattttgcagatgatgaaaacagcacagcgggggagagcgagagccaccacacatcactgctggtgccctggcccctgcgccggaccagtgcccagggacagcccagtcccggaacctcggctcctggccacgccctccatggcaaaaagaacagcactgtggactgcaatggggtggtctcattactgggggcaggcgacccagaggccacatccccaggaagccacctcctccgccctgtgatgctagagcacccgccagacacgaccacgccatcggaggagccaggcgggccccagatgctgacctcccaggctccgtgtgtagatggcttcgaggagccaggagcacggcagcgggccctcagcgcagtcagcgtcctcaccagcgcactggaagagttagaggagtctcgccacaagtgtccaccatgctggaaccgtctcgcccagcgctacctgatctgggagtgctgcccgctgtggatgtccatcaagcagggagtgaagttggtggtcatggacccgtttactgacctcaccatcactatgtgcatcgtactcaacacactcttcatggcgctggagcactacaacatgacaagtgaattcgaggagatgctgcaggtcggaaacctggtcttcacagggattttcacagcagagatgaccttcaagatcattgccctcgacccctactactacttccaacagggctggaacatcttcgacagcatcatcgtcatccttagcctcatggagctgggcctgtcccgcatgagcaacttgtcggtgctgcgctccttccgcctgctgcgggtcttcaagctggccaaatcatggcccaccctgaacacactcatcaagatcatcgggaactcagtgggggcactggggaacctgacactggtgctagccatcatcgtgttcatctttgctgtggtgggcatgcagctctttggcaagaactactcggagctgagggacagcgactcaggcctgctgcctcgctggcacatgatggacttctttcatgccttcctcatcatcttccgcatcctctgtggagagtggatcgagaccatgtgggactgcatggaggtgtcggggcagtcattatgcctgctggtcttcttgcttgttatggtcattggcaaccttgtggtcctgaatctcttcctggccttgctgctcagctccttcagtgcagacaacctcacagcccctgatgaggacagagagatgaacaacctccagctggccctggcccgcatccagaggggcctgcgctttgtcaagcggaccacctgggatttctgctgtggtctcctgcggcagcggcctcagaagcccgcagcccttgccgcccagggccagctgcccagctgcattgccaccccctactccccgccacccccagagacggagaaggtgcctcccacccgcaaggaaacacggtttgaggaaggcgagcaaccaggccagggcacccccggggatccagagcccgtgtgtgtgcccatcgctgtggccgagtcagacacagatgaccaagaagaagatgaggagaacagcctgggcacggaggaggagtccagcaagcagcaggaatcccagcctgtgtccggtggcccagaggcccctccggattccaggacctggagccaggtgtcagcgactgcctcctctgaggccgaggccagtgcatctcaggccgactggcggcagcagtggaaagcggaaccccaggccccagggtgcggtgagaccccagaggacagttgctccgagggcagcacagcagacatgaccaacaccgctgagctcctggagcagatccctgacctcggccaggatgtcaaggacccagaggactgcttcactgaaggctgtgtccggcgctgtccctgctgtgcggtggacaccacacaggccccagggaaggtctggtggcggttgcgcaagacctgctaccacatcgtggagcacagctggttcgagacattcatcatcttcatgatcctactcagcagtggagcgctggccttcgaggacatctacctagaggagcggaagaccatcaaggttctgcttgagtatgccgacaagatgttcacatatgtcttcgtgctggagatgctgctcaagtgggtggcctacggcttcaagaagtacttcaccaatgcctggtgctggctcgacttcctcatcgtagacgtctctctggtcagcctggtggccaacaccctgggctttgccgagatgggccccatcaagtcactgcggacgctgcgtgcactccgtcctctgagagctctgtcacgatttgagggcatgagggtggtggtcaatgccctggtgggcgccatcccgtccatcatgaacgtcctcctcgtctgcctcatcttctggctcatcttcagcatcatgggcgtgaacctctttgcggggaagtttgggaggtgcatcaaccagacagagggagacttgcctttgaactacaccatcgtgaacaacaagagccagtgtgagtccttgaacttgaccggagaattgtactggaccaaggtgaaagtcaactttgacaacgtgggggccgggtacctggcccttctgcaggtggcaacatttaaaggctggatggacattatgtatgcagctgtggactccagggggtatgaagagcagcctcagtgggaatacaacctctacatgtacatctattttgtcattttcatcatctttgggtctttcttcaccctgaacctctttattggtgtcatcattgacaacttcaaccaacagaagaaaaagttagggggccaggacatcttcatgacagaggagcagaagaagtactacaatgccatgaagaagctgggctccaagaagccccagaagcccatcccacggcccctgaacaagtaccagggcttcatattcgacattgtgaccaagcaggcctttgacgtcaccatcatgtttctgatctgcttgaatatggtgaccatgatggtggagacagatgaccaaagtcctgagaaaatcaacatcttggccaagatcaacctgctctttgtggccatcttcacaggcgagtgtattgtcaagctggctgccctgcgccactactacttcaccaacagctggaatatcttcgacttcgtggttgtcatcctctccatcgtgggcactgtgctctcggacatcatccagaagtacttcttctccccgacgctcttccgagtcatccgcctggcccgaataggccgcatcctcagactgatccgaggggccaaggggatccgcacgctgctctttgccctcatgatgtccctgcctgccctcttcaacatcgggctgctgctcttcctcgtcatgttcatctactccatctttggcatggccaacttcgcttatgtcaagtgggaggctggcatcgacgacatgttcaacttccagaccttcgccaacagcatgctgtgcctcttccagatcaccacgtcggccggctgggatggcctcctcagccccatcctcaacactgggccgccctactgcgaccccactctgcccaacagcaatggctctcggggggactgcgggagcccagccgtgggcatcctcttcttcaccacctacatcatcatctccttcctcatcgtggtcaacatgtacattgccatcatcctggagaacttcagcgtggccacggaggagagcaccgagcccctgagtgaggacgacttcgatatgttctatgagatctgggagaaatttgacccagaggccactcagtttattgagtattcggtcctgtctgactttgccgatgccctgtctgagccactccgtatcgccaagcccaaccagataagcctcatcaacatggacctgcccatggtgagtggggaccgcatccattgcatggacattctctttgccttcaccaaaagggtcctgggggagtctggggagatggacgccctgaagatccagatggaggagaagttcatggcagccaacccatccaagatctcctacgagcccatcaccaccacactccggcgcaagcacgaagaggtgtcggccatggttatccagagagccttccgcaggcacctgctgcaacgctctttgaagcatgcctccttcctcttccgtcagcaggcgggcagcggcctctccgaagaggatgcccctgagcgagagggcctcatcgcctacgtgatgagtgagaacttctcccgaccccttggcccaccctccagctcctccatctcctccacttccttcccaccctcctatgacagtgtcactagagccaccagcgataacctccaggtgcgggggtctgactacagccacagtgaagatctcgccgacttccccccttctccggacagggaccgtgagtccatcgtgtgagcctcggcctggctggccaggacacactgaaaagcagcctttttcaccatggcaaacctaaatgcagtcagtcacaaaccagcctggggccttcctggctttgggagtaagaaatgggcctcagccccgcggatcaaccaggcagagttctgtggcgccgcgtggacagccggagcagttggcctgtgcttggaggcctcagatagacctgtgacctggtctggtcaggcaatgccctgcggctctggaaagcaacttcatcccagctgctgaggcgaaatataaaactgagactgtatatgttgtgaatgggctttcataaatttattatatttgatatttttttacttgagcaaagaactaaggatttttccatggacatgggcagcaattcacgctgtctcttcttaaccctgaacaagagtgtctatggagcagccggaagtctgttctcaaagcagaagtggaatccagtgtggctcccacaggtcttcactgcccaggggtcgaatggggtccccctcccacttgacctgagatgctgggagggctgaacccccactcacacaagcacacacacacagtcctcacacacggaggccagacacaggccgtgggacccaggctcccagcctaagggagacaggcctttccctgccggccccccaaggatggggttcttgtccacggggctcactctggccccctattgtctccaaggtcccattttccccctgtgttttcacgcaggtcatattgtcagtcctacaaaaataaaaggcttccagaggagagtggcctgggtcccagggctggccctaggcactgatagttgccttttcttcccctcctgtaagagtattaacaaaaccaaaggacacaagggtgcaagccccattcacggcctggcatgcagcttgtccttgctcctggaacctggcaggccctgcccagccagccatcggaagagagggctgagccatgggggtttggggctaagaagttcaccagccctgagccatggcggcccctcagcctgcctgaagagaggaaactggcgatctcccagggctctctggaccatacgcggaggagttttctgtgtggtctccagctcctctccagacacagagacatgggagtggggagcggagcttggccctgcgccctgtgcagggaaagggatggtcaggcccagttctcgtgcccttagaggggaatgaaccatggcacctttgagagagggggcactgtggtcaggcccagcctctctggctcagcccgggatcctgatggcacccacacagaggacctctttggggcaagatccaggtggtcccataggtcttgtgaaaaggctttttcagggaaaaatattttactagtccaatcacccccaggacctcttcagctgctgacaatcctatttagcatatgcaaatcttttaacatagagaactgtcaccctgaggtaacagggtcaactggcgaagcctgagcaggcaggggcttggctgccccattccagctctcccatggagcccctccaccgggcgcatgcctcccaggccacctcagtctcacctgccggctctgggctggctgctcctaacctacctcgccgagctgtcggagggctggacatttgtggcagtgctgaagggggcattgccggcgagtaaagtattatgtttcttcttgtcaccccagttcccttggtggcaaccccagacccaacccatgcccctgacagatctagttctcttctcctgtgttccctttgagtccagtgtgggacacggtttaactgtcccagcgacatttctccaagtggaaatcctatttttgtagatctccatgctttgctctcaaggcttggagaggtatgtgcccctcctgggtgctcaccgcctgctacacaggcaggaatgcggttgggaggcaggtcgggctgccagcccagctggccggaaggagactgtggtttttgtgtgtgtggacagcccgggagctttgagacaggtgcctggggctggctgcagacggtgtggttgggggtgggaggtgagctagacccaacccttagcttttagcctggctgtcacctttttaatttccagaactgcacaatgaccagcaggagggaaggacagacatcaagtgccagatgttgtctgaactaatcgagcacttctcaccaaacttcatgtataaataaaatacatatttttaaaacaaaccaataaatggcttacatga
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:6331 -> Molecular function: GO:0005248 [voltage-gated sodium channel activity] evidence: IDA
            GeneID:6331 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:6331 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI
            GeneID:6331 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
            GeneID:6331 -> Molecular function: GO:0030506 [ankyrin binding] evidence: IDA
            GeneID:6331 -> Molecular function: GO:0044325 [ion channel binding] evidence: IPI
            GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IDA
            GeneID:6331 -> Molecular function: GO:0086006 [voltage-gated sodium channel activity involved in regulation of cardiac muscle cell action potential] evidence: IMP
            GeneID:6331 -> Molecular function: GO:0097110 [scaffold protein binding] evidence: IPI
            GeneID:6331 -> Biological process: GO:0002027 [regulation of heart rate] evidence: IMP
            GeneID:6331 -> Biological process: GO:0003231 [cardiac ventricle development] evidence: ISS
            GeneID:6331 -> Biological process: GO:0003360 [brainstem development] evidence: ISS
            GeneID:6331 -> Biological process: GO:0006814 [sodium ion transport] evidence: IDA
            GeneID:6331 -> Biological process: GO:0010765 [positive regulation of sodium ion transport] evidence: IDA
            GeneID:6331 -> Biological process: GO:0014894 [response to denervation involved in regulation of muscle adaptation] evidence: ISS
            GeneID:6331 -> Biological process: GO:0021537 [telencephalon development] evidence: ISS
            GeneID:6331 -> Biological process: GO:0021549 [cerebellum development] evidence: ISS
            GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IDA
            GeneID:6331 -> Biological process: GO:0035725 [sodium ion transmembrane transport] evidence: IMP
            GeneID:6331 -> Biological process: GO:0042475 [odontogenesis of dentin-containing tooth] evidence: ISS
            GeneID:6331 -> Biological process: GO:0045760 [positive regulation of action potential] evidence: ISS
            GeneID:6331 -> Biological process: GO:0050679 [positive regulation of epithelial cell proliferation] evidence: ISS
            GeneID:6331 -> Biological process: GO:0051899 [membrane depolarization] evidence: IDA
            GeneID:6331 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
            GeneID:6331 -> Biological process: GO:0060307 [regulation of ventricular cardiac muscle cell membrane repolarization] evidence: IMP
            GeneID:6331 -> Biological process: GO:0060371 [regulation of atrial cardiac muscle cell membrane depolarization] evidence: IMP
            GeneID:6331 -> Biological process: GO:0060372 [regulation of atrial cardiac muscle cell membrane repolarization] evidence: IMP
            GeneID:6331 -> Biological process: GO:0060373 [regulation of ventricular cardiac muscle cell membrane depolarization] evidence: IMP
            GeneID:6331 -> Biological process: GO:0071277 [cellular response to calcium ion] evidence: IDA
            GeneID:6331 -> Biological process: GO:0086002 [regulation of cardiac muscle cell action potential involved in contraction] evidence: IMP
            GeneID:6331 -> Biological process: GO:0086004 [regulation of cardiac muscle cell contraction] evidence: IMP
            GeneID:6331 -> Biological process: GO:0086005 [regulation of ventricular cardiac muscle cell action potential] evidence: IMP
            GeneID:6331 -> Biological process: GO:0086010 [membrane depolarization involved in regulation of action potential] evidence: IDA
            GeneID:6331 -> Biological process: GO:0086012 [membrane depolarization involved in regulation of cardiac muscle cell action potential] evidence: IMP
            GeneID:6331 -> Biological process: GO:0086046 [membrane depolarization involved in regulation of SA node cell action potential] evidence: ISS
            GeneID:6331 -> Biological process: GO:0086067 [AV node cell to bundle of His cell communication] evidence: IMP
            GeneID:6331 -> Biological process: GO:0086069 [bundle of His cell to Purkinje myocyte communication] evidence: IMP
            GeneID:6331 -> Biological process: GO:0086070 [SA node cell to atrial cardiac muscle cell communication] evidence: IMP
            GeneID:6331 -> Biological process: GO:0086091 [regulation of heart rate by cardiac conduction] evidence: IMP
            GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IC
            GeneID:6331 -> Cellular component: GO:0001518 [voltage-gated sodium channel complex] evidence: IDA
            GeneID:6331 -> Cellular component: GO:0005783 [endoplasmic reticulum] evidence: IDA
            GeneID:6331 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:6331 -> Cellular component: GO:0005901 [caveola] evidence: TAS
            GeneID:6331 -> Cellular component: GO:0009986 [cell surface] evidence: IDA
            GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: IDA
            GeneID:6331 -> Cellular component: GO:0014704 [intercalated disc] evidence: ISS
            GeneID:6331 -> Cellular component: GO:0016021 [integral to membrane] evidence: IDA
            GeneID:6331 -> Cellular component: GO:0030315 [T-tubule] evidence: IDA
            GeneID:6331 -> Cellular component: GO:0042383 [sarcolemma] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.