GGRNA Home | Help | Advanced search

2019-03-20 12:06:59, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_194300               4030 bp    mRNA    linear   PRI 18-APR-2013
DEFINITION  Homo sapiens coiled-coil domain containing 129 (CCDC129),
            transcript variant 2, mRNA.
ACCESSION   NM_194300 XM_167336 XM_353571
VERSION     NM_194300.3  GI:384875917
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4030)
  AUTHORS   Rose,J.E., Behm,F.M., Drgon,T., Johnson,C. and Uhl,G.R.
  TITLE     Personalized smoking cessation: interactions between nicotine dose,
            dependence and quit-success genotype score
  JOURNAL   Mol. Med. 16 (7-8), 247-253 (2010)
   PUBMED   20379614
  REMARK    GeneRIF: Clinical trial of gene-disease association and
            gene-environment interaction. (HuGE Navigator)
            Erratum:[Mol Med. 2012;18(1):729]
REFERENCE   2  (bases 1 to 4030)
  AUTHORS   Kimura,K., Wakamatsu,A., Suzuki,Y., Ota,T., Nishikawa,T.,
            Yamashita,R., Yamamoto,J., Sekine,M., Tsuritani,K., Wakaguri,H.,
            Ishii,S., Sugiyama,T., Saito,K., Isono,Y., Irie,R., Kushida,N.,
            Yoneyama,T., Otsuka,R., Kanda,K., Yokoi,T., Kondo,H., Wagatsuma,M.,
            Murakawa,K., Ishida,S., Ishibashi,T., Takahashi-Fujii,A.,
            Tanase,T., Nagai,K., Kikuchi,H., Nakai,K., Isogai,T. and Sugano,S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC006044.2, BC132719.1 and AK128026.1.
            On Apr 20, 2012 this sequence version replaced gi:154937345.
            
            Transcript Variant: This variant (2) differs in the 5' UTR and
            coding region, compared to variant 1. These differences cause
            translation initiation at a downstream AUG and result in an isoform
            (2) with a shorter N-terminus, compared to isoform 1.
            
            Sequence Note: This RefSeq record was created from transcript and
            genomic sequence data to make the sequence consistent with the
            reference genome assembly. The genomic coordinates used for the
            transcript record were based on transcript alignments.
            
            ##Evidence-Data-START##
            CDS exon combination :: BC132719.1 [ECO:0000331]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-12                AC006044.2         19179-19190
            13-14               AC006044.2         27185-27186
            15-129              BC132719.1         18-132
            130-130             AC006044.2         27302-27302
            131-889             BC132719.1         134-892
            890-890             AC006044.2         52302-52302
            891-1164            BC132719.1         894-1167
            1165-1165           AC006044.2         52577-52577
            1166-1503           BC132719.1         1169-1506
            1504-1504           AC006044.2         117022-117022
            1505-2460           BC132719.1         1508-2463
            2461-2461           AC006044.2         117979-117979
            2462-3266           BC132719.1         2465-3269
            3267-3696           AK128026.1         3781-4210
            3697-3697           AC006044.2         127539-127539
            3698-4030           AK128026.1         4212-4544
FEATURES             Location/Qualifiers
     source          1..4030
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="7"
                     /map="7p14.3"
     gene            1..4030
                     /gene="CCDC129"
                     /note="coiled-coil domain containing 129"
                     /db_xref="GeneID:223075"
                     /db_xref="HGNC:27363"
     exon            1..12
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       2
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:141862699"
     exon            13..198
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       24
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368232809"
     CDS             36..3170
                     /gene="CCDC129"
                     /note="isoform 2 is encoded by transcript variant 2;
                     coiled-coil domain-containing protein 129"
                     /codon_start=1
                     /product="coiled-coil domain-containing protein 129
                     isoform 2"
                     /protein_id="NP_919276.2"
                     /db_xref="GI:154937346"
                     /db_xref="CCDS:CCDS5435.2"
                     /db_xref="GeneID:223075"
                     /db_xref="HGNC:27363"
                     /translation="
MMAQKSQGSDNLQEGQEKSKREILKCTKSAWAPLDEWLPPDPEEESQSLTIPMLEDSKQESIQQWLDSGFFVSANENFQQVIDRTVSLYEQGMVQMTVKDYMRSLHQFSETPILSRGTSFNSCYSTASVPQSIPEWLEFWEIDPVEILLDLGFGADEPDICMQIPARFLGCGSAARGINIRVFLEAQKQRMDIENPNLYGRFRQLEILDHVTNAFSSLLSDVSILPNRAEEKAGGESVQRTSVSAAKEHRRRMGKLLRRASKQNIRRDCNPEVSESFKVKDEVFVPFTKPWDCGAELAATSINHKQNHLSLSVEHQSLQACDDLLPYPPHGLLSKQWPCSSMPAKQAPPSCVSEGSVKGRTQKENLFQTNKLKSLSHLAGKGPDSFEMEEVQSFEEETGNPLDMTSGTVGARVDRANSCQSDSSGFLEEPLEPLPLQMPSLPNSQSPAENGGRKPRDQSHSLVSSQDCQLESDGPDSKSRASMSFSSQEANALEQRASVSVMEEEFLLEAMEGPPELYIPDMACAKTTTRGECPRKDSHLWQLLPMPHAEYEVTRPTATSKYDHPLGFMVTHVTEMQDSFVRPEGAGKVQSHHNESQRSPGNDHTQDKFLHVDSEAPREEESSGFCPHTNHSLLVPESSSQCIPKHSEITPYATDLAQTSEKLIPHLHKLPGDPAQVKSRSGTLGQILPGTEAEMENLPLNTGSSRSVMTQMSSSLVSAAQRAVALGTGPRGTSLECTVCDPVTATETRLGTKARQLNDASIQTSALSNKTLTHGPQPLTKSVSLDSGFSSICPMGTCHAIPAHCCICCHHHPHCHGERQSPGPEPSVCRHCLCSLTGHQEAQFMTTLKALQDTTVRELCSCTVHEMEAMKTICQSFREYLEEIEQHLMGQQALFSRDMSEEEREEAEQLQTLREALRQQVAELEFQLGDRAQQIREGILLQLEVLTAEPPEHYSNLHQYNWIEESNGQTSCSKIHPGMAPRTVFPPDDGQEAPCSGGTQLAAFTPPTLENSTRMSPSSSAWAKLGPTPLSNCPVGEKDADVFL
"
     variation       74
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114739660"
     variation       96
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368587451"
     variation       103
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371959143"
     variation       116
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147399119"
     variation       123
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374470226"
     variation       130
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:7811042"
     variation       133
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143690079"
     variation       134
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372303441"
     variation       161
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371511395"
     variation       177
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112921112"
     variation       189
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376118062"
     exon            199..247
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       224
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200034335"
     exon            248..291
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       249
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372723381"
     variation       273
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377546776"
     variation       284
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2286711"
     variation       285
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201211575"
     exon            292..343
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       301
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149696374"
     variation       326
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145529826"
     variation       337
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374187154"
     exon            344..430
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       344..345
                     /gene="CCDC129"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:35551867"
     variation       386
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:67930674"
     variation       387
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369866067"
     variation       389
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146605019"
     variation       390
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141438918"
     variation       391
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:202157240"
     variation       395
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374063664"
     variation       411
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201415095"
     exon            431..633
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       432
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370418381"
     variation       438
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372753433"
     variation       459
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200366088"
     variation       486
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376020926"
     variation       537
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370670531"
     variation       576
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187352726"
     variation       603
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199790271"
     variation       619
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371060962"
     variation       627
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191694538"
     variation       628
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375679267"
     variation       632
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143370840"
     exon            634..1205
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       637
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151254328"
     variation       663
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200848834"
     variation       693
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140428776"
     variation       726
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200031625"
     variation       754
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373956174"
     variation       771
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376757677"
     variation       784
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201901788"
     variation       796
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:184653370"
     variation       814
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373138016"
     variation       824
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200960115"
     variation       834
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201177934"
     variation       835
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370395768"
     variation       837
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372951947"
     variation       839
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111332081"
     variation       859
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186789215"
     variation       890
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:6945679"
     variation       905
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368881766"
     variation       906
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:111510506"
     variation       916
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371421598"
     variation       964
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373943918"
     variation       1001
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200119465"
     variation       1038
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368169623"
     variation       1063
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372420153"
     variation       1099
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192536493"
     variation       1108
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375575625"
     variation       1110
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:369963496"
     variation       1127
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372373590"
     variation       1165
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10252720"
     variation       1187
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:368760577"
     exon            1206..1263
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1230
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188006642"
     variation       1261
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374799170"
     exon            1264..1346
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1307
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370130726"
     variation       1317
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367919427"
     variation       1325
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373855014"
     variation       1326
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368202210"
     exon            1347..2618
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       1374
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:372684457"
     variation       1375
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150398844"
     variation       1376
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:185577476"
     variation       1386
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369485544"
     variation       1387
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138418545"
     variation       1394
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143912195"
     variation       1434
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201060776"
     variation       1451
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146986060"
     variation       1459
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190307572"
     variation       1476
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376801262"
     variation       1477
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138066602"
     variation       1478
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143751428"
     variation       1486
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:115087893"
     variation       1504
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4141001"
     variation       1510
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182124848"
     variation       1525
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148685966"
     variation       1526
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141164020"
     variation       1545
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376345625"
     variation       1546
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200626153"
     variation       1567
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377326064"
     variation       1581
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150717357"
     variation       1606
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:139246994"
     variation       1621
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144022203"
     variation       1646
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76357748"
     variation       1652
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:38396"
     variation       1680
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:73686905"
     variation       1704
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:77197319"
     variation       1726
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371473428"
     variation       1795
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375287000"
     variation       1816
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368084998"
     variation       1822
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116406137"
     variation       1824
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147656859"
     variation       1874
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143660819"
     variation       1887
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199508649"
     variation       1895
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201778549"
     variation       1898
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200300960"
     variation       1904
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:38397"
     variation       1937
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:186727343"
     variation       1938
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375104335"
     variation       1949
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138128234"
     variation       1959
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148074341"
     variation       1978
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:150134204"
     variation       2054
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200026024"
     variation       2087
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181108787"
     variation       2105
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:117782044"
     variation       2177
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377002952"
     variation       2189
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185363516"
     variation       2216
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:372213107"
     variation       2225
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375422464"
     variation       2291
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149320755"
     variation       2302
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141868591"
     variation       2319
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200809374"
     variation       2342
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137859522"
     variation       2382
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146267805"
     variation       2398
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369385676"
     variation       2418
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189731201"
     variation       2424
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202078186"
     variation       2433
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145959636"
     variation       2459
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139858209"
     variation       2461
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10247620"
     variation       2483
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76733226"
     variation       2484
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139431992"
     variation       2519
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150049545"
     variation       2572
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147673017"
     variation       2612
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377331865"
     variation       2617
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142323942"
     exon            2619..2746
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       2623
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201917207"
     variation       2650
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200617855"
     variation       2667
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142885665"
     variation       2668
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144601428"
     variation       2694
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7799540"
     variation       2699
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148953571"
     variation       2727
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370201894"
     exon            2747..2858
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       2756
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374114030"
     variation       2758
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143151561"
     variation       2766
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201354762"
     variation       2775
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148236609"
     variation       2776
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80081783"
     variation       2801
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141259951"
     exon            2859..4030
                     /gene="CCDC129"
                     /inference="alignment:Splign:1.39.8"
     variation       2869
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186386347"
     variation       2908
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:137892596"
     variation       2971
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142389938"
     variation       2973
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377589498"
     variation       2978
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145933301"
     variation       2996
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368179579"
     variation       2997
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:111514975"
     variation       3011
                     /gene="CCDC129"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:371362733"
     variation       3031
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149268880"
     variation       3035
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371944763"
     variation       3036
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:115873834"
     variation       3054
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201005039"
     variation       3059
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200065011"
     variation       3070
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77915580"
     variation       3073
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:374464304"
     variation       3084
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148552563"
     variation       3109
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183033798"
     variation       3118
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:142016406"
     variation       3136
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:34177136"
     variation       3142
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201675506"
     variation       3150
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140998733"
     variation       3179
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368704382"
     variation       3181
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:201768075"
     variation       3208
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371845154"
     variation       3210
                     /gene="CCDC129"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371968855"
     variation       3212
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138001179"
     variation       3221
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:369807067"
     variation       3223
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143478742"
     variation       3287
                     /gene="CCDC129"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:187942842"
     variation       3323
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374773487"
     variation       3392
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:60432519"
     variation       3406
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147140713"
     variation       3420
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140268517"
     variation       3496
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371842462"
     variation       3618
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:77503219"
     variation       3697
                     /gene="CCDC129"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2159513"
     variation       3707
                     /gene="CCDC129"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376168188"
     variation       3793
                     /gene="CCDC129"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:182206184"
     variation       3836
                     /gene="CCDC129"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202091748"
ORIGIN      
tgccttccaggattagtttgcagaattactctcctatgatggcacagaaatcacaaggatctgacaaccttcaggaaggccaggaaaagagcaagagagagatcctgaagtgcaccaaaagcgcgtgggctccgctggatgagtggctgccccctgaccctgaggaggaaagccagagtctcaccatccccatgctggaagattccaagcaagaaagtattcagcagtggctggactctggattctttgtctctgcaaatgaaaactttcaacaagtcattgaccgcactgtttctttgtatgaacaagggatggttcaaatgactgtgaaagactacatgagatctttgcatcagttttcagaaactcccatcctatccagagggaccagtttcaactcttgctattctactgcaagtgtaccacaaagcattcctgaatggctggaattttgggagatagatccagtggagattctcttggatctggggtttggtgctgatgagccagacatctgcatgcaaatcccagccagattccttggttgtggctcagcagccagaggaatcaacatccgtgtttttcttgaagctcaaaagcagcgaatggacattgagaaccccaacttgtacggtcgtttccgacagctggaaatcctggaccatgtgaccaatgccttctcatctctgctgagtgatgtcagcatcctgccaaacagagctgaagagaaagctggaggagagagtgtgcaaagaacctcagtgagtgccgccaaagagcatcgaagaagaatgggtaaactcttaaggagagcttccaaacagaacatcaggcgggattgtaacccagaggtatcagagtccttcaaggtgaaggatgaagtttttgttccctttacaaaaccatgggattgtggagcagagctagcagcaacctcaatcaaccacaagcaaaatcatttgtctctgtcagtagaacatcagtctctccaagcctgtgatgatttgctaccttatcctcctcatggtcttctgagcaagcagtggccttgctcatctatgccggccaagcaggctcctccttcctgtgtgtctgaggggtcagtcaagggcagaactcagaaggagaacttatttcagactaacaagctcaagagcttgtctcatcttgcaggcaaaggaccagactcatttgaaatggaagaggtccaaagctttgaagaagagactggtaatcctcttgacatgacttcaggaactgtaggtgccagggtggacagagcaaatagctgccagtctgacagcagcgggttcctggaggagccgctggaaccgctgcccctccagatgccttccttgccaaacagccagagtcctgctgagaatggaggtagaaagccaagagatcagagccacagcttagtatcatcccaggactgtcagctagagtcggatgggccagattccaaaagtagggcgagcatgtctttttcaagccaagaagcgaatgccttggaacaaagggcctcagtatctgtgatggaggaagagtttctgcttgaggccatggaggggccaccagagctgtatatcccagacatggcctgtgccaagaccaccacgaggggagaatgcccaaggaaagacagccatctgtggcagcttctgccaatgccccatgctgagtatgaggtcaccagacccacagccacttccaaatatgatcatcctctggggtttatggtaacccacgtcacagaaatgcaggacagttttgtgaggcctgagggagctggcaaagtgcaaagccaccacaatgagtctcaaaggtcacctggaaatgatcatactcaagacaagttccttcatgttgactctgaggccccacgagaagaggaaagcagtggattctgtcctcacaccaaccacagcttactcgtaccagaaagctcatcacagtgtatccccaagcacagtgaaatcacaccttatgcaactgaccttgctcaaacatctgaaaagctcattccccacctccataaactgcctggagatcctgcccaggtgaagtcaaggtctggtactttgggtcagatactacctgggacagaagctgagatggaaaaccttcctctaaatactggcagctccaggtctgtaatgacccagatgtcctccagcctggtgtcggctgctcagagggctgtggccttggggactggtcccagaggaacatctttagaatgcactgtgtgtgatcctgttaccgcaacagaaacaagactggggacaaaagcaagacagttaaatgatgcttccattcagacttcagctctaagcaacaagaccttgacacatgggccccagcccctcaccaaatccgtctctctagactcaggcttctctagtatctgcccaatgggcacctgccatgctatacctgcccactgctgcatctgctgtcatcaccaccctcactgccacggggagaggcaaagccctggccctgaaccctcagtctgtaggcactgcctgtgttcactaactggtcaccaggaagcccagttcatgacgactttgaaagcccttcaggacactacagtgagggagctatgttcctgcacagtccatgagatggaagccatgaagacgatatgccaaagtttccgggagtatttagaagaaattgaacagcaccttatgggacagcaggccctcttttccagggacatgtcagaggaggaaagggaggaggccgagcaactgcaaacgttacgtgaggccctgaggcagcaggtggcagagttggaatttcagttaggagaccgggctcagcaaatcagagaagggattttactgcagctggaggttctcacagcagagccacctgaacactattcaaatctgcatcaatataactggatagaagaaagcaatgggcagacttcatgttctaaaatccacccaggcatggccccgaggactgtgtttcctcccgatgatggccaggaggctccctgttcaggtgggacccagttggctgccttcactccacccaccttggagaacagcaccaggatgtctccttcatcatcagcttgggcaaagttaggtccaacccctttgtcaaattgtcctgttggagaaaaggatgcagatgtcttcctctagatcagagcaggtttgttaaccttcatacaaaatataaaggcccagaacagatgtagcaaggaaatttcaattttccccaaggagaagggtctgccaacccattgtcagctatatctctcatattctaccctttggttaaacccaagaggagtttagaatactctaatactcattcagtatagaataactgagcacctagtatgtgcctggcacagagtatgcaacagtgactaaatagtatacggtctctgccctgctagaacttacagtgtagtgggggagatagaattgcaaacaaaaagtatctgagacagacctcagtcaatatagaagtttattttgccaaggttaaggatacacacccagaagacaggtctgtgcctttctccaaagatgattttgaggccttcaacatttagtggggaaagggtgctaatggggaaagaggtgtgggtacataggaggcaaacagttgcatttttttgagtctgatcagcttttctcatgagagaaggggtagaggaactgtcacttatgcattcacctagctcagtggatctgcacttttacagaaggtaaaataaacatagggcagaggaagcaatcagatatgcatttgtctcgggggagcagagggatggctttgagttctgttctttgtcctgtacctattaagagaagctatcaatatactttgtcaggataaaattcaacagaactgttttagactaaagattttagggaccacaaggaatttcccagtgggcaaattgtgagggaggtatttagcttttaaaaaaatctttgtagctatctcatttagaaataaaatgggaggcagattgcctgatgcagctcct
//

Annotations:



by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.