GGRNA Home | Help | Advanced search

2020-10-26 19:36:35, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_182658               1454 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens BPI fold containing family B, member 3 (BPIFB3), mRNA.
ACCESSION   NM_182658
VERSION     NM_182658.1  GI:32964822
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1454)
  AUTHORS   Bingle,C.D., Seal,R.L. and Craven,C.J.
  TITLE     Systematic nomenclature for the PLUNC/PSP/BSP30/SMGB proteins as a
            subfamily of the BPI fold-containing superfamily
  JOURNAL   Biochem. Soc. Trans. 39 (4), 977-983 (2011)
   PUBMED   21787333
REFERENCE   2  (bases 1 to 1454)
  AUTHORS   Davila,S., Froeling,F.E., Tan,A., Bonnard,C., Boland,G.J.,
            Snippe,H., Hibberd,M.L. and Seielstad,M.
  TITLE     New genetic associations detected in a host response study to
            hepatitis B vaccine
  JOURNAL   Genes Immun. 11 (3), 232-238 (2010)
   PUBMED   20237496
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   3  (bases 1 to 1454)
  AUTHORS   Andrault,J.B., Gaillard,I., Giorgi,D. and Rouquier,S.
  TITLE     Expansion of the BPI family by duplication on human chromosome 20:
            characterization of the RY gene cluster in 20q11.21 encoding
            olfactory transporters/antimicrobial-like peptides
  JOURNAL   Genomics 82 (2), 172-184 (2003)
   PUBMED   12837268
REFERENCE   4  (bases 1 to 1454)
  AUTHORS   Bingle,C.D. and Craven,C.J.
  TITLE     PLUNC: a novel family of candidate host defence proteins expressed
            in the upper airways and nasopharynx
  JOURNAL   Hum. Mol. Genet. 11 (8), 937-943 (2002)
   PUBMED   11971875
REFERENCE   5  (bases 1 to 1454)
  AUTHORS   Deloukas,P., Matthews,L.H., Ashurst,J., Burton,J., Gilbert,J.G.,
            Jones,M., Stavrides,G., Almeida,J.P., Babbage,A.K., Bagguley,C.L.,
            Bailey,J., Barlow,K.F., Bates,K.N., Beard,L.M., Beare,D.M.,
            Beasley,O.P., Bird,C.P., Blakey,S.E., Bridgeman,A.M., Brown,A.J.,
            Buck,D., Burrill,W., Butler,A.P., Carder,C., Carter,N.P.,
            Chapman,J.C., Clamp,M., Clark,G., Clark,L.N., Clark,S.Y.,
            Clee,C.M., Clegg,S., Cobley,V.E., Collier,R.E., Connor,R.,
            Corby,N.R., Coulson,A., Coville,G.J., Deadman,R., Dhami,P.,
            Dunn,M., Ellington,A.G., Frankland,J.A., Fraser,A., French,L.,
            Garner,P., Grafham,D.V., Griffiths,C., Griffiths,M.N., Gwilliam,R.,
            Hall,R.E., Hammond,S., Harley,J.L., Heath,P.D., Ho,S., Holden,J.L.,
            Howden,P.J., Huckle,E., Hunt,A.R., Hunt,S.E., Jekosch,K.,
            Johnson,C.M., Johnson,D., Kay,M.P., Kimberley,A.M., King,A.,
            Knights,A., Laird,G.K., Lawlor,S., Lehvaslaiho,M.H., Leversha,M.,
            Lloyd,C., Lloyd,D.M., Lovell,J.D., Marsh,V.L., Martin,S.L.,
            McConnachie,L.J., McLay,K., McMurray,A.A., Milne,S., Mistry,D.,
            Moore,M.J., Mullikin,J.C., Nickerson,T., Oliver,K., Parker,A.,
            Patel,R., Pearce,T.A., Peck,A.I., Phillimore,B.J.,
            Prathalingam,S.R., Plumb,R.W., Ramsay,H., Rice,C.M., Ross,M.T.,
            Scott,C.E., Sehra,H.K., Shownkeen,R., Sims,S., Skuce,C.D.,
            Smith,M.L., Soderlund,C., Steward,C.A., Sulston,J.E., Swann,M.,
            Sycamore,N., Taylor,R., Tee,L., Thomas,D.W., Thorpe,A., Tracey,A.,
            Tromans,A.C., Vaudin,M., Wall,M., Wallis,J.M., Whitehead,S.L.,
            Whittaker,P., Willey,D.L., Williams,L., Williams,S.A., Wilming,L.,
            Wray,P.W., Hubbard,T., Durbin,R.M., Bentley,D.R., Beck,S. and
            Rogers,J.
  TITLE     The DNA sequence and comparative analysis of human chromosome 20
  JOURNAL   Nature 414 (6866), 865-871 (2001)
   PUBMED   11780052
COMMENT     PROVISIONAL REFSEQ: This record has not yet been subject to final
            NCBI review. The reference sequence was derived from AF549189.1.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF549189.1, BC113398.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025085 [ECO:0000350]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..1454
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="20"
                     /map="20q11.21"
     gene            1..1454
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /note="BPI fold containing family B, member 3"
                     /db_xref="GeneID:359710"
                     /db_xref="HGNC:16178"
                     /db_xref="HPRD:16644"
     CDS             1..1431
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /note="long palate, lung and nasal epithelium carcinoma
                     associated 3; long palate, lung and nasal epithelium
                     carcinoma-associated protein 3; ligand-binding protein
                     RYA3; BPI fold-containing family B member 3"
                     /codon_start=1
                     /product="BPI fold-containing family B member 3 precursor"
                     /protein_id="NP_872599.1"
                     /db_xref="GI:32964823"
                     /db_xref="CCDS:CCDS13212.1"
                     /db_xref="GeneID:359710"
                     /db_xref="HGNC:16178"
                     /db_xref="HPRD:16644"
                     /translation="
MQPVMLALWSLLLLWGLATPCQELLETVGTLARIDKDELGKAIQNSLVGEPILQNVLGSVTAVNRGLLGSGGLLGGGGLLGHGGVFGVVEELSGLKIEELTLPKVLLKLLPGFGVQLSLHTKVGMHCSGPLGGLLQLAAEVNVTSRVALAVSSRGTPILILKRCSTLLGHISLFSGLLPTPLFGVVEQMLFKVLPGLLCPVVDSVLGVVNELLGAVLGLVSLGALGSVEFSLATLPLISNQYIELDINPIVKSVAGDIIDFPKSRAPAKVPPKKDHTSQVMVPLYLFNTTFGLLQTNGALDMDITPELVPSDVPLTTTDLAALLPEALGKLPLHQQLLLFLRVREAPTVTLHNKKALVSLPANIHVLFYVPKGTPESLFELNSVMTVRAQLAPSATKLHISLSLERLSVKVASSFTHAFDGSRLEEWLSHVVGAVYAPKLNVALDVGIPLPKVLNINFSNSVLEIVENAVVLTVAS
"
     sig_peptide     1..60
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     mat_peptide     61..1428
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /product="BPI fold-containing family B member 3"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P59826.2)"
     misc_feature    85..756
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /note="BPI/LBP/CETP domain; Bactericidal
                     permeability-increasing protein (BPI) /
                     Lipopolysaccharide-binding protein (LBP) / Cholesteryl
                     ester transfer protein (CETP) domain; binds to and
                     neutralizes lipopolysaccharides from the outer membrane of
                     Gram-negative...; Region: BPI; cl00188"
                     /db_xref="CDD:206887"
     misc_feature    85..105
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /note="BPI dimerizatation interface [polypeptide binding];
                     other site"
                     /db_xref="CDD:29339"
     misc_feature    order(100..102,115..117,124..126,136..138,145..147,
                     328..330,439..441,445..447,475..477,604..606,616..618,
                     628..630,727..729)
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /note="apolar binding pocket; other site"
                     /db_xref="CDD:29339"
     misc_feature    826..1422
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /note="BPI/LBP/CETP domain; Bactericidal
                     permeability-increasing protein (BPI) /
                     Lipopolysaccharide-binding protein (LBP) / Cholesteryl
                     ester transfer protein (CETP) domain; binds to and
                     neutralizes lipopolysaccharides from the outer membrane of
                     Gram-negative...; Region: BPI; cl00188"
                     /db_xref="CDD:206887"
     misc_feature    order(859..861,868..870,880..882,889..891,1066..1068,
                     1165..1167,1171..1173,1198..1200,1306..1308,1318..1320,
                     1330..1332,1408..1410)
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /note="apolar binding pocket; other site"
                     /db_xref="CDD:29339"
     exon            1..124
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       13
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202172895"
     variation       14
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:138045241"
     variation       30
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:375833464"
     variation       62
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369950926"
     variation       81
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149497264"
     variation       93
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144150108"
     variation       94
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138919082"
     variation       108
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147346398"
     variation       110
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368960556"
     exon            125..281
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       143
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201501868"
     variation       176
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:112217883"
     variation       177
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:150528981"
     variation       178
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138897849"
     variation       187
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150025342"
     variation       196
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145431597"
     variation       213
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:35539872"
     variation       237
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143621529"
     variation       262
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202072797"
     variation       267
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146783248"
     variation       274
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368603025"
     exon            282..386
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       304
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371677418"
     variation       361
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140480951"
     variation       366
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143710366"
     variation       374
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:73123554"
     exon            387..527
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       405
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:150139646"
     variation       412
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138957506"
     variation       415
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199504781"
     variation       417
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35242985"
     variation       421
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:147000729"
     variation       435
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371950669"
     variation       436
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137930923"
     variation       463
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376567897"
     variation       464
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370279306"
     variation       488
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199515506"
     variation       497
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149445561"
     exon            528..591
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       529
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187451498"
     variation       543
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34032795"
     variation       556
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148635670"
     variation       581
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:147720727"
     variation       585
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201726387"
     exon            592..652
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       596
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146116881"
     variation       600
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140200538"
     variation       643
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:143918747"
     exon            653..744
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       682
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:4911290"
     variation       705
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:117989719"
     variation       738
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149980236"
     exon            745..924
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       751
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142043656"
     variation       780
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:143149440"
     variation       786
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147827868"
     variation       793
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376328599"
     variation       811
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201111989"
     variation       850
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200771603"
     variation       863
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375933547"
     variation       869
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2093066"
     variation       870
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:17124073"
     variation       891
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147358664"
     variation       892
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200354205"
     variation       894
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199598368"
     variation       895
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200406115"
     variation       901
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139513207"
     variation       914
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141651092"
     exon            925..978
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       933
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150087753"
     variation       942
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370006680"
     variation       945
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:138544042"
     variation       950
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:202121541"
     variation       961
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372453694"
     exon            979..1149
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       982
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113939875"
     variation       983
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149267742"
     variation       1002
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:6057717"
     variation       1024
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199722228"
     variation       1032
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368197516"
     variation       1036
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140130224"
     variation       1043
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372397063"
     variation       1044
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369843384"
     variation       1060
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142099629"
     variation       1067
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201582304"
     variation       1089
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369561547"
     variation       1106
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6059063"
     exon            1150..1217
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       1154
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76298021"
     variation       1181
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79150816"
     variation       1182
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368164662"
     variation       1183
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375472654"
     variation       1192
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369835006"
     variation       1200
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142822628"
     variation       1208
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:151032238"
     variation       1217
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372182848"
     exon            1218..1260
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       1234
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144741997"
     variation       1242
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374762335"
     variation       1257
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:116723328"
     variation       1260
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141344367"
     exon            1261..1324
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       1268
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147653729"
     variation       1273
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149106895"
     variation       1278
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:45499201"
     variation       1292
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371368870"
     variation       1303
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73262178"
     exon            1325..1401
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       1327
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140066843"
     variation       1332
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145354732"
     variation       1345
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:378098"
     variation       1347
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375331770"
     variation       1370
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200749582"
     variation       1395
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201462422"
     variation       1396
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376787900"
     exon            1402..1454
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /inference="alignment:Splign:1.39.8"
     variation       1419
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114341725"
     variation       1420
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149644176"
     variation       1438
                     /gene="BPIFB3"
                     /gene_synonym="C20orf185; dJ726C3.4; LPLUNC3; RYA3"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199827585"
ORIGIN      
atgcagccagtcatgctggccctgtggtccctgcttctgctctggggcctggcgactccatgccaggagctgctagagacggtgggcacgctcgctcggattgacaaggatgaactcggcaaagccatccagaactcactggttggggagcccattctgcagaatgtgctgggatcggtcacagctgtgaaccggggcctcttgggctcaggagggctgcttggaggaggcggcttgctgggccacggaggggtttttggcgttgtcgaggagctctctggtctgaagattgaggagctcacgctgccaaaggtgttgctgaagctgctgccgggatttggggtgcagctgagcctgcacaccaaagtgggcatgcattgctccggcccccttggtggccttctgcagctggctgcggaggtgaacgtgacatcgcgggtggcgctggccgtgagctcaaggggcacacccatccttatcctcaagcgctgcagcacgctcctgggccacatcagcctgttctcagggctgctgcccacaccactctttggggtcgtggaacagatgctcttcaaggtgcttccgggactgctgtgccccgtggtggacagtgtgctgggtgtggtgaatgagctcctgggggctgtgctgggcctggtgtcccttggggctcttgggtccgtggaattctctctggccacattgcctctcatctccaaccagtacatagaactggacatcaaccctatcgtgaagagtgtagctggtgatatcattgacttccccaagtcccgtgccccagccaaggtgccccccaagaaggaccacacatcccaggtgatggtgccactgtacctcttcaacaccacgtttggactcctgcagaccaacggcgccctcgacatggacatcacccctgagctggttcccagcgatgtcccactgacaactacagacctggcagctttgctccctgaggccctggggaagctgcccctgcaccagcaactcctactgttcctgcgggtgagggaagctcccacggtcacactccacaacaagaaggccttggtctccctcccagccaacatccatgtgctgttctatgtccctaaggggacccctgaatccctctttgagctgaactccgtcatgactgtgcgtgcccagctggctccctcggctaccaagctgcacatctccctgtccctggaacggctcagtgtcaaggtggcctcctcctttacccatgcctttgacggatcgcgtttagaagaatggctcagccatgtggtcggggcagtgtatgcaccaaagcttaacgtggccctggatgttggaattcccctgcctaaggttcttaatatcaatttttccaattcagttctggagatcgtagagaatgctgttgtgctgaccgtggcatcctgaggctgagacatggccaccagcct
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:359710 -> Molecular function: GO:0008289 [lipid binding] evidence: IEA
            GeneID:359710 -> Biological process: GO:0045087 [innate immune response] evidence: NAS
            GeneID:359710 -> Cellular component: GO:0005576 [extracellular region] evidence: IEA
            GeneID:359710 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.