2024-04-26 15:24:03, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_181762 1709 bp mRNA linear PRI 22-JUN-2013 DEFINITION Homo sapiens ubiquitin-conjugating enzyme E2A (UBE2A), transcript variant 2, mRNA. ACCESSION NM_181762 VERSION NM_181762.1 GI:32967275 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1709) AUTHORS Jahanshad,N., Rajagopalan,P., Hua,X., Hibar,D.P., Nir,T.M., Toga,A.W., Jack,C.R. Jr., Saykin,A.J., Green,R.C., Weiner,M.W., Medland,S.E., Montgomery,G.W., Hansell,N.K., McMahon,K.L., de Zubicaray,G.I., Martin,N.G., Wright,M.J. and Thompson,P.M. CONSRTM Alzheimer's Disease Neuroimaging Initiative TITLE Genome-wide scan of healthy human connectome discovers SPON1 gene variant influencing dementia severity JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (12), 4768-4773 (2013) PUBMED 23471985 REFERENCE 2 (bases 1 to 1709) AUTHORS Shchebet,A., Karpiuk,O., Kremmer,E., Eick,D. and Johnsen,S.A. TITLE Phosphorylation by cyclin-dependent kinase-9 controls ubiquitin-conjugating enzyme-2A function JOURNAL Cell Cycle 11 (11), 2122-2127 (2012) PUBMED 22592529 REMARK GeneRIF: UBE2A specifically interacts with CDK9, but not CDK2 and is phosphorylated by CDK9 in vitro. REFERENCE 3 (bases 1 to 1709) AUTHORS Chen,S., Wang,D.L., Liu,Y., Zhao,L. and Sun,F.L. TITLE RAD6 regulates the dosage of p53 by a combination of transcriptional and posttranscriptional mechanisms JOURNAL Mol. Cell. Biol. 32 (2), 576-587 (2012) PUBMED 22083959 REMARK GeneRIF: RAD6 can form a ternary complex with MDM2 and p53 that contributes to the degradation of p53. REFERENCE 4 (bases 1 to 1709) AUTHORS de Leeuw,N., Bulk,S., Green,A., Jaeckle-Santos,L., Baker,L.A., Zinn,A.R., Kleefstra,T., van der Smagt,J.J., Vianne Morgante,A.M., de Vries,B.B., van Bokhoven,H. and de Brouwer,A.P. TITLE UBE2A deficiency syndrome: Mild to severe intellectual disability accompanied by seizures, absent speech, urogenital, and skin anomalies in male patients JOURNAL Am. J. Med. Genet. A 152A (12), 3084-3090 (2010) PUBMED 21108393 REMARK GeneRIF: UBE2A deficiency syndrome is reported in two male patients. REFERENCE 5 (bases 1 to 1709) AUTHORS Park,H.K., Wang,H., Zhang,J., Datta,S. and Fei,P. TITLE Convergence of Rad6/Rad18 and Fanconi anemia tumor suppressor pathways upon DNA damage JOURNAL PLoS ONE 5 (10), E13313 (2010) PUBMED 20967207 REMARK GeneRIF: showed that the function of FA signaling pathway is at least partly mediated through coupling with hRad6/hRad18 signaling (HHR6 pathway) Publication Status: Online-Only REFERENCE 6 (bases 1 to 1709) AUTHORS Xin,H., Lin,W., Sumanasekera,W., Zhang,Y., Wu,X. and Wang,Z. TITLE The human RAD18 gene product interacts with HHR6A and HHR6B JOURNAL Nucleic Acids Res. 28 (14), 2847-2854 (2000) PUBMED 10908344 REFERENCE 7 (bases 1 to 1709) AUTHORS Tateishi,S., Sakuraba,Y., Masuyama,S., Inoue,H. and Yamaizumi,M. TITLE Dysfunction of human Rad18 results in defective postreplication repair and hypersensitivity to multiple mutagens JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (14), 7927-7932 (2000) PUBMED 10884424 REFERENCE 8 (bases 1 to 1709) AUTHORS Kato,S., Sekine,S., Oh,S.W., Kim,N.S., Umezawa,Y., Abe,N., Yokoyama-Kobayashi,M. and Aoki,T. TITLE Construction of a human full-length cDNA bank JOURNAL Gene 150 (2), 243-250 (1994) PUBMED 7821789 REFERENCE 9 (bases 1 to 1709) AUTHORS Koken,M.H., Smit,E.M., Jaspers-Dekker,I., Oostra,B.A., Hagemeijer,A., Bootsma,D. and Hoeijmakers,J.H. TITLE Localization of two human homologs, HHR6A and HHR6B, of the yeast DNA repair gene RAD6 to chromosomes Xq24-q25 and 5q23-q31 JOURNAL Genomics 12 (3), 447-453 (1992) PUBMED 1559696 REFERENCE 10 (bases 1 to 1709) AUTHORS Koken,M.H., Reynolds,P., Jaspers-Dekker,I., Prakash,L., Prakash,S., Bootsma,D. and Hoeijmakers,J.H. TITLE Structural and functional conservation of two human homologs of the yeast DNA repair gene RAD6 JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (20), 8865-8869 (1991) PUBMED 1717990 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from M74524.1, AL701289.1 and BI093289.1. Summary: The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Multiple alternatively spliced transcript variants have been found for this gene and they encode distinct isoforms. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) lacks an in-frame coding exon, as compared to variant 1. Isoform 2 thus lacks an internal segment, as compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK297696.1, BI517680.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025085 [ECO:0000348] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. FEATURES Location/Qualifiers source 1..1709 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="X" /map="Xq24" gene 1..1709 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /note="ubiquitin-conjugating enzyme E2A" /db_xref="GeneID:7319" /db_xref="HGNC:12472" /db_xref="HPRD:02422" /db_xref="MIM:312180" exon 1..220 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /inference="alignment:Splign:1.39.8" variation 118 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:188892019" CDS 177..545 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /EC_number="6.3.2.19" /note="isoform 2 is encoded by transcript variant 2; ubiquitin-conjugating enzyme E2A (RAD6 homolog); ubiquitin-protein ligase A; ubiquitin carrier protein A; HR6A; RAD6 homolog A" /codon_start=1 /product="ubiquitin-conjugating enzyme E2 A isoform 2" /protein_id="NP_861427.1" /db_xref="GI:32967276" /db_xref="CCDS:CCDS14581.1" /db_xref="GeneID:7319" /db_xref="HGNC:12472" /db_xref="HPRD:02422" /db_xref="MIM:312180" /translation="
MSTPARRRLMRDFKRLQEDPPAGVSGAPSENNIMVWNAVIFGPEGTPFEDVYADGSICLDILQNRWSPTYDVSSILTSIQSLLDEPNPNSPANSQAAQLYQENKREYEKRVSAIVEQSWRDC
" misc_feature 195..509 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /note="Ubiquitin-conjugating enzyme E2, catalytic (UBCc) domain. This is part of the ubiquitin-mediated protein degradation pathway in which a thiol-ester linkage forms between a conserved cysteine and the C-terminus of ubiquitin and complexes with ubiquitin...; Region: UBCc; cd00195" /db_xref="CDD:238117" misc_feature order(195..197,378..383) /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /note="E3 interaction residues; other site" /db_xref="CDD:238117" misc_feature order(327..329,333..335,345..353,357..362,372..377, 384..386,399..401,408..410,417..419,426..431,435..437, 441..446) /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /note="Ub thioester intermediate interaction residues; other site" /db_xref="CDD:238117" misc_feature 348..350 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /note="active site cysteine" /db_xref="CDD:238117" misc_feature 444..446 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00302" misc_feature 444..446 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" /db_xref="HPRD:00310" variation 208 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="a" /replace="g" /db_xref="dbSNP:387906728" exon 221..301 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /inference="alignment:Splign:1.39.8" variation 260 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="g" /replace="t" /db_xref="dbSNP:202153801" exon 302..327 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /inference="alignment:Splign:1.39.8" variation 308 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="a" /replace="g" /db_xref="dbSNP:376915836" exon 328..416 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /inference="alignment:Splign:1.39.8" variation 393 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:111885581" variation 407 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="a" /replace="g" /db_xref="dbSNP:61757566" exon 417..1708 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /inference="alignment:Splign:1.39.8" variation 468 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:104894952" STS 488..610 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /standard_name="G44726" /db_xref="UniSTS:95201" variation 527 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="a" /replace="g" /db_xref="dbSNP:4234" variation 548 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:376065272" variation 564 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="g" /replace="t" /db_xref="dbSNP:1803725" variation 583..586 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="" /replace="atat" /db_xref="dbSNP:370058300" polyA_signal 635..640 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" variation 639 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="a" /replace="g" /db_xref="dbSNP:190231807" polyA_site 655 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /experiment="experimental evidence, no additional details recorded" variation 664 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="g" /replace="t" /db_xref="dbSNP:143338897" variation 703 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:35554236" variation 1069 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="a" /replace="c" /db_xref="dbSNP:35570533" variation 1080 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="g" /replace="t" /db_xref="dbSNP:1803724" variation 1125 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="a" /replace="t" /db_xref="dbSNP:35068848" variation 1140 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:181367972" variation 1230..1231 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="" /replace="g" /db_xref="dbSNP:35317457" variation 1237 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:368813411" variation 1250 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="g" /replace="t" /db_xref="dbSNP:1803723" variation 1251 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:186621711" STS 1332..1575 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /standard_name="STS-M74524" /db_xref="UniSTS:58149" variation 1433 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="g" /db_xref="dbSNP:190671903" STS 1456..1592 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /standard_name="A009F17" /db_xref="UniSTS:62018" STS 1456..1592 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /standard_name="G32504" /db_xref="UniSTS:117089" variation 1586 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="a" /replace="t" /db_xref="dbSNP:1803722" variation 1592 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="a" /replace="g" /db_xref="dbSNP:14982" variation 1607 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:1803726" variation 1652 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" /replace="c" /replace="t" /db_xref="dbSNP:368008641" polyA_signal 1690..1695 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" polyA_site 1708 /gene="UBE2A" /gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2" ORIGIN
acactggggtggtgcttagccggcgccagaccgaccctcgacttcggagaggcagcgcggttcctctgggtgcttccgcctccccttctcctgcttctccagcctcttcggcctcctcgcccgccgcgggaacccgagaccccagtgtatgccccacccctgaccccgctcgcgacatgtccaccccggctcggcggcgcctcatgcgggacttcaagaggttgcaggaggatcctccagccggagtcagcggggctccgtccgagaacaacataatggtgtggaacgcggtcattttcgggcctgaagggaccccgtttgaggatgtctatgcagatggtagtatatgtctggacatacttcagaaccgttggagtccaacctatgatgtgtcttccattctaacatccatacagtctctgttggatgaacccaatcccaatagtccagcaaacagccaggctgctcagctgtaccaggagaacaaacgggaatatgaaaagcgtgtttctgcaatagtagaacaaagctggcgtgattgttgaccccgggtacagtttaaagaagctggccataagaaaaatatatattgatgtgtttgtcacctccctactcctgtcattacatttactttattaaaagcaaaataactgttgtgctgtttccatcttccttgccaagttttcctaccccttctaccctctccttaaacatcagaaaacaccctctatgaaatcaaatgtactgtacctgggttacttgcaaaaattactaatgcttcagtttttctgttgtatttcatttccagttttcaggcagttatttttattattgtactttaagcttttaagatgaattgttatacaagaggtgcttatgcttagcttgatgaccaggatgttatttttaacaaaatgattgctgaagtgtttcatcctggctggtccttcacttgtgttggatttagaagtgaatgtgtttggaatatggcctacagagaatagaaacaaatccatgtaaacaattttgaaggaggcatgggagctaaaaatcctgtgatactaagatctcagtcatatgaattacaacgtagtatttactggcaagaaggagaaagttgaaggactcagctaaaggagtacagcaattgtagtaactgacacatcctctctttgcaagctgctgactgggcacactcatgccaagtttcagaattattggtcttctgggtttttgctttttaaaagaggtgtgggagcagaggaatggaaacaatcgtgagtttttgagctagggaaagttggagctcctttaatctttttaaaggatcagtgctgccctaagtgaataaactcaattgtccatctttattttagagttttaatgaattcaaggaagggagcatagcatatctgtggcaaactattttccactcaaatcctgagttattgctgcatgctttaatttcttccctttcagcatctgagaaccttaaagccaatgtctgcgatctttttttggatatttatacttttagatatatagtacctttaagtagcagtatgggacaaggcttgtaaatgttttgtctaatgttctattgtcaccttttatgcatttatcacttccaaatctaactttgcacaagtaacccatgtaaaaaaaaatgtacatttttcaaaagttgtaaataaaaataaccttaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:7319 -> Molecular function: GO:0004842 [ubiquitin-protein ligase activity] evidence: IDA GeneID:7319 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:7319 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA GeneID:7319 -> Molecular function: GO:0031625 [ubiquitin protein ligase binding] evidence: IPI GeneID:7319 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS GeneID:7319 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA GeneID:7319 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS GeneID:7319 -> Biological process: GO:0006281 [DNA repair] evidence: IGI GeneID:7319 -> Biological process: GO:0006301 [postreplication repair] evidence: NAS GeneID:7319 -> Biological process: GO:0006511 [ubiquitin-dependent protein catabolic process] evidence: NAS GeneID:7319 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: IDA GeneID:7319 -> Biological process: GO:0009411 [response to UV] evidence: IGI GeneID:7319 -> Biological process: GO:0033522 [histone H2A ubiquitination] evidence: IDA GeneID:7319 -> Biological process: GO:0051865 [protein autoubiquitination] evidence: IDA GeneID:7319 -> Biological process: GO:0060135 [maternal process involved in female pregnancy] evidence: IEA GeneID:7319 -> Biological process: GO:0070936 [protein K48-linked ubiquitination] evidence: IDA GeneID:7319 -> Biological process: GO:0070979 [protein K11-linked ubiquitination] evidence: IDA GeneID:7319 -> Cellular component: GO:0000785 [chromatin] evidence: ISS GeneID:7319 -> Cellular component: GO:0000790 [nuclear chromatin] evidence: IEA GeneID:7319 -> Cellular component: GO:0001741 [XY body] evidence: IEA GeneID:7319 -> Cellular component: GO:0005829 [cytosol] evidence: TAS GeneID:7319 -> Cellular component: GO:0033503 [HULC complex] evidence: IDA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_861427 -> EC 6.3.2.19
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.