Home |
Help |
Advanced search
2024-04-26 15:24:03, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_181762 1709 bp mRNA linear PRI 22-JUN-2013
DEFINITION Homo sapiens ubiquitin-conjugating enzyme E2A (UBE2A), transcript
variant 2, mRNA.
ACCESSION NM_181762
VERSION NM_181762.1 GI:32967275
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 1709)
AUTHORS Jahanshad,N., Rajagopalan,P., Hua,X., Hibar,D.P., Nir,T.M.,
Toga,A.W., Jack,C.R. Jr., Saykin,A.J., Green,R.C., Weiner,M.W.,
Medland,S.E., Montgomery,G.W., Hansell,N.K., McMahon,K.L., de
Zubicaray,G.I., Martin,N.G., Wright,M.J. and Thompson,P.M.
CONSRTM Alzheimer's Disease Neuroimaging Initiative
TITLE Genome-wide scan of healthy human connectome discovers SPON1 gene
variant influencing dementia severity
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 110 (12), 4768-4773 (2013)
PUBMED 23471985
REFERENCE 2 (bases 1 to 1709)
AUTHORS Shchebet,A., Karpiuk,O., Kremmer,E., Eick,D. and Johnsen,S.A.
TITLE Phosphorylation by cyclin-dependent kinase-9 controls
ubiquitin-conjugating enzyme-2A function
JOURNAL Cell Cycle 11 (11), 2122-2127 (2012)
PUBMED 22592529
REMARK GeneRIF: UBE2A specifically interacts with CDK9, but not CDK2 and
is phosphorylated by CDK9 in vitro.
REFERENCE 3 (bases 1 to 1709)
AUTHORS Chen,S., Wang,D.L., Liu,Y., Zhao,L. and Sun,F.L.
TITLE RAD6 regulates the dosage of p53 by a combination of
transcriptional and posttranscriptional mechanisms
JOURNAL Mol. Cell. Biol. 32 (2), 576-587 (2012)
PUBMED 22083959
REMARK GeneRIF: RAD6 can form a ternary complex with MDM2 and p53 that
contributes to the degradation of p53.
REFERENCE 4 (bases 1 to 1709)
AUTHORS de Leeuw,N., Bulk,S., Green,A., Jaeckle-Santos,L., Baker,L.A.,
Zinn,A.R., Kleefstra,T., van der Smagt,J.J., Vianne Morgante,A.M.,
de Vries,B.B., van Bokhoven,H. and de Brouwer,A.P.
TITLE UBE2A deficiency syndrome: Mild to severe intellectual disability
accompanied by seizures, absent speech, urogenital, and skin
anomalies in male patients
JOURNAL Am. J. Med. Genet. A 152A (12), 3084-3090 (2010)
PUBMED 21108393
REMARK GeneRIF: UBE2A deficiency syndrome is reported in two male
patients.
REFERENCE 5 (bases 1 to 1709)
AUTHORS Park,H.K., Wang,H., Zhang,J., Datta,S. and Fei,P.
TITLE Convergence of Rad6/Rad18 and Fanconi anemia tumor suppressor
pathways upon DNA damage
JOURNAL PLoS ONE 5 (10), E13313 (2010)
PUBMED 20967207
REMARK GeneRIF: showed that the function of FA signaling pathway is at
least partly mediated through coupling with hRad6/hRad18 signaling
(HHR6 pathway)
Publication Status: Online-Only
REFERENCE 6 (bases 1 to 1709)
AUTHORS Xin,H., Lin,W., Sumanasekera,W., Zhang,Y., Wu,X. and Wang,Z.
TITLE The human RAD18 gene product interacts with HHR6A and HHR6B
JOURNAL Nucleic Acids Res. 28 (14), 2847-2854 (2000)
PUBMED 10908344
REFERENCE 7 (bases 1 to 1709)
AUTHORS Tateishi,S., Sakuraba,Y., Masuyama,S., Inoue,H. and Yamaizumi,M.
TITLE Dysfunction of human Rad18 results in defective postreplication
repair and hypersensitivity to multiple mutagens
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (14), 7927-7932 (2000)
PUBMED 10884424
REFERENCE 8 (bases 1 to 1709)
AUTHORS Kato,S., Sekine,S., Oh,S.W., Kim,N.S., Umezawa,Y., Abe,N.,
Yokoyama-Kobayashi,M. and Aoki,T.
TITLE Construction of a human full-length cDNA bank
JOURNAL Gene 150 (2), 243-250 (1994)
PUBMED 7821789
REFERENCE 9 (bases 1 to 1709)
AUTHORS Koken,M.H., Smit,E.M., Jaspers-Dekker,I., Oostra,B.A.,
Hagemeijer,A., Bootsma,D. and Hoeijmakers,J.H.
TITLE Localization of two human homologs, HHR6A and HHR6B, of the yeast
DNA repair gene RAD6 to chromosomes Xq24-q25 and 5q23-q31
JOURNAL Genomics 12 (3), 447-453 (1992)
PUBMED 1559696
REFERENCE 10 (bases 1 to 1709)
AUTHORS Koken,M.H., Reynolds,P., Jaspers-Dekker,I., Prakash,L., Prakash,S.,
Bootsma,D. and Hoeijmakers,J.H.
TITLE Structural and functional conservation of two human homologs of the
yeast DNA repair gene RAD6
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 88 (20), 8865-8869 (1991)
PUBMED 1717990
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from M74524.1, AL701289.1 and
BI093289.1.
Summary: The modification of proteins with ubiquitin is an
important cellular mechanism for targeting abnormal or short-lived
proteins for degradation. Ubiquitination involves at least three
classes of enzymes: ubiquitin-activating enzymes, or E1s,
ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein
ligases, or E3s. This gene encodes a member of the E2
ubiquitin-conjugating enzyme family. This enzyme is required for
post-replicative DNA damage repair. Multiple alternatively spliced
transcript variants have been found for this gene and they encode
distinct isoforms. [provided by RefSeq, Jul 2008].
Transcript Variant: This variant (2) lacks an in-frame coding exon,
as compared to variant 1. Isoform 2 thus lacks an internal segment,
as compared to isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AK297696.1, BI517680.1 [ECO:0000332]
RNAseq introns :: single sample supports all introns
ERS025084, ERS025085 [ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
FEATURES Location/Qualifiers
source 1..1709
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="X"
/map="Xq24"
gene 1..1709
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/note="ubiquitin-conjugating enzyme E2A"
/db_xref="GeneID:7319"
/db_xref="HGNC:12472"
/db_xref="HPRD:02422"
/db_xref="MIM:312180"
exon 1..220
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/inference="alignment:Splign:1.39.8"
variation 118
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:188892019"
CDS 177..545
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/EC_number="6.3.2.19"
/note="isoform 2 is encoded by transcript variant 2;
ubiquitin-conjugating enzyme E2A (RAD6 homolog);
ubiquitin-protein ligase A; ubiquitin carrier protein A;
HR6A; RAD6 homolog A"
/codon_start=1
/product="ubiquitin-conjugating enzyme E2 A isoform 2"
/protein_id="NP_861427.1"
/db_xref="GI:32967276"
/db_xref="CCDS:CCDS14581.1"
/db_xref="GeneID:7319"
/db_xref="HGNC:12472"
/db_xref="HPRD:02422"
/db_xref="MIM:312180"
/translation="
MSTPARRRLMRDFKRLQEDPPAGVSGAPSENNIMVWNAVIFGPEGTPFEDVYADGSICLDILQNRWSPTYDVSSILTSIQSLLDEPNPNSPANSQAAQLYQENKREYEKRVSAIVEQSWRDC
"
misc_feature 195..509
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/note="Ubiquitin-conjugating enzyme E2, catalytic (UBCc)
domain. This is part of the ubiquitin-mediated protein
degradation pathway in which a thiol-ester linkage forms
between a conserved cysteine and the C-terminus of
ubiquitin and complexes with ubiquitin...; Region: UBCc;
cd00195"
/db_xref="CDD:238117"
misc_feature order(195..197,378..383)
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/note="E3 interaction residues; other site"
/db_xref="CDD:238117"
misc_feature order(327..329,333..335,345..353,357..362,372..377,
384..386,399..401,408..410,417..419,426..431,435..437,
441..446)
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/note="Ub thioester intermediate interaction residues;
other site"
/db_xref="CDD:238117"
misc_feature 348..350
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/note="active site cysteine"
/db_xref="CDD:238117"
misc_feature 444..446
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00302"
misc_feature 444..446
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
/db_xref="HPRD:00310"
variation 208
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="a"
/replace="g"
/db_xref="dbSNP:387906728"
exon 221..301
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/inference="alignment:Splign:1.39.8"
variation 260
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="g"
/replace="t"
/db_xref="dbSNP:202153801"
exon 302..327
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/inference="alignment:Splign:1.39.8"
variation 308
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="a"
/replace="g"
/db_xref="dbSNP:376915836"
exon 328..416
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/inference="alignment:Splign:1.39.8"
variation 393
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:111885581"
variation 407
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="a"
/replace="g"
/db_xref="dbSNP:61757566"
exon 417..1708
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/inference="alignment:Splign:1.39.8"
variation 468
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:104894952"
STS 488..610
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/standard_name="G44726"
/db_xref="UniSTS:95201"
variation 527
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="a"
/replace="g"
/db_xref="dbSNP:4234"
variation 548
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:376065272"
variation 564
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1803725"
variation 583..586
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace=""
/replace="atat"
/db_xref="dbSNP:370058300"
polyA_signal 635..640
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
variation 639
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="a"
/replace="g"
/db_xref="dbSNP:190231807"
polyA_site 655
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/experiment="experimental evidence, no additional details
recorded"
variation 664
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="g"
/replace="t"
/db_xref="dbSNP:143338897"
variation 703
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:35554236"
variation 1069
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="a"
/replace="c"
/db_xref="dbSNP:35570533"
variation 1080
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1803724"
variation 1125
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="a"
/replace="t"
/db_xref="dbSNP:35068848"
variation 1140
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:181367972"
variation 1230..1231
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace=""
/replace="g"
/db_xref="dbSNP:35317457"
variation 1237
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368813411"
variation 1250
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1803723"
variation 1251
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:186621711"
STS 1332..1575
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/standard_name="STS-M74524"
/db_xref="UniSTS:58149"
variation 1433
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="g"
/db_xref="dbSNP:190671903"
STS 1456..1592
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/standard_name="A009F17"
/db_xref="UniSTS:62018"
STS 1456..1592
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/standard_name="G32504"
/db_xref="UniSTS:117089"
variation 1586
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="a"
/replace="t"
/db_xref="dbSNP:1803722"
variation 1592
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="a"
/replace="g"
/db_xref="dbSNP:14982"
variation 1607
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1803726"
variation 1652
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
/replace="c"
/replace="t"
/db_xref="dbSNP:368008641"
polyA_signal 1690..1695
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
polyA_site 1708
/gene="UBE2A"
/gene_synonym="HHR6A; MRXS30; MRXSN; RAD6A; UBC2"
ORIGIN
acactggggtggtgcttagccggcgccagaccgaccctcgacttcggagaggcagcgcggttcctctgggtgcttccgcctccccttctcctgcttctccagcctcttcggcctcctcgcccgccgcgggaacccgagaccccagtgtatgccccacccctgaccccgctcgcgacatgtccaccccggctcggcggcgcctcatgcgggacttcaagaggttgcaggaggatcctccagccggagtcagcggggctccgtccgagaacaacataatggtgtggaacgcggtcattttcgggcctgaagggaccccgtttgaggatgtctatgcagatggtagtatatgtctggacatacttcagaaccgttggagtccaacctatgatgtgtcttccattctaacatccatacagtctctgttggatgaacccaatcccaatagtccagcaaacagccaggctgctcagctgtaccaggagaacaaacgggaatatgaaaagcgtgtttctgcaatagtagaacaaagctggcgtgattgttgaccccgggtacagtttaaagaagctggccataagaaaaatatatattgatgtgtttgtcacctccctactcctgtcattacatttactttattaaaagcaaaataactgttgtgctgtttccatcttccttgccaagttttcctaccccttctaccctctccttaaacatcagaaaacaccctctatgaaatcaaatgtactgtacctgggttacttgcaaaaattactaatgcttcagtttttctgttgtatttcatttccagttttcaggcagttatttttattattgtactttaagcttttaagatgaattgttatacaagaggtgcttatgcttagcttgatgaccaggatgttatttttaacaaaatgattgctgaagtgtttcatcctggctggtccttcacttgtgttggatttagaagtgaatgtgtttggaatatggcctacagagaatagaaacaaatccatgtaaacaattttgaaggaggcatgggagctaaaaatcctgtgatactaagatctcagtcatatgaattacaacgtagtatttactggcaagaaggagaaagttgaaggactcagctaaaggagtacagcaattgtagtaactgacacatcctctctttgcaagctgctgactgggcacactcatgccaagtttcagaattattggtcttctgggtttttgctttttaaaagaggtgtgggagcagaggaatggaaacaatcgtgagtttttgagctagggaaagttggagctcctttaatctttttaaaggatcagtgctgccctaagtgaataaactcaattgtccatctttattttagagttttaatgaattcaaggaagggagcatagcatatctgtggcaaactattttccactcaaatcctgagttattgctgcatgctttaatttcttccctttcagcatctgagaaccttaaagccaatgtctgcgatctttttttggatatttatacttttagatatatagtacctttaagtagcagtatgggacaaggcttgtaaatgttttgtctaatgttctattgtcaccttttatgcatttatcacttccaaatctaactttgcacaagtaacccatgtaaaaaaaaatgtacatttttcaaaagttgtaaataaaaataaccttaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:7319 -> Molecular function: GO:0004842 [ubiquitin-protein ligase activity] evidence: IDA
GeneID:7319 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:7319 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
GeneID:7319 -> Molecular function: GO:0031625 [ubiquitin protein ligase binding] evidence: IPI
GeneID:7319 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS
GeneID:7319 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
GeneID:7319 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS
GeneID:7319 -> Biological process: GO:0006281 [DNA repair] evidence: IGI
GeneID:7319 -> Biological process: GO:0006301 [postreplication repair] evidence: NAS
GeneID:7319 -> Biological process: GO:0006511 [ubiquitin-dependent protein catabolic process] evidence: NAS
GeneID:7319 -> Biological process: GO:0008284 [positive regulation of cell proliferation] evidence: IDA
GeneID:7319 -> Biological process: GO:0009411 [response to UV] evidence: IGI
GeneID:7319 -> Biological process: GO:0033522 [histone H2A ubiquitination] evidence: IDA
GeneID:7319 -> Biological process: GO:0051865 [protein autoubiquitination] evidence: IDA
GeneID:7319 -> Biological process: GO:0060135 [maternal process involved in female pregnancy] evidence: IEA
GeneID:7319 -> Biological process: GO:0070936 [protein K48-linked ubiquitination] evidence: IDA
GeneID:7319 -> Biological process: GO:0070979 [protein K11-linked ubiquitination] evidence: IDA
GeneID:7319 -> Cellular component: GO:0000785 [chromatin] evidence: ISS
GeneID:7319 -> Cellular component: GO:0000790 [nuclear chromatin] evidence: IEA
GeneID:7319 -> Cellular component: GO:0001741 [XY body] evidence: IEA
GeneID:7319 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
GeneID:7319 -> Cellular component: GO:0033503 [HULC complex] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_861427 -> EC 6.3.2.19
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.