2024-04-23 19:00:34, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_178584 3187 bp mRNA linear PRI 17-APR-2013 DEFINITION Homo sapiens septin 10 (SEPT10), transcript variant 2, mRNA. ACCESSION NM_178584 VERSION NM_178584.2 GI:384871590 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3187) AUTHORS Xu,M., Takanashi,M., Oikawa,K., Nishi,H., Isaka,K., Yoshimoto,T., Ohyashiki,J. and Kuroda,M. TITLE Identification of a novel role of Septin 10 in paclitaxel-resistance in cancers through a functional genomics screen JOURNAL Cancer Sci. 103 (4), 821-827 (2012) PUBMED 22320903 REMARK GeneRIF: we found that paclitaxel-resistant tumors had decreased expression of SEPT10. REFERENCE 2 (bases 1 to 3187) AUTHORS Benedetti,D., Bomben,R., Dal-Bo,M., Marconi,D., Zucchetto,A., Degan,M., Forconi,F., Del-Poeta,G., Gaidano,G. and Gattei,V. TITLE Are surrogates of IGHV gene mutational status useful in B-cell chronic lymphocytic leukemia? The example of Septin-10 JOURNAL Leukemia 22 (1), 224-226 (2008) PUBMED 17657217 REMARK GeneRIF: Lack of SEPT10 transcript is associated with B-cell chronic lymphocytic leukemia REFERENCE 3 (bases 1 to 3187) AUTHORS Lamesch,P., Li,N., Milstein,S., Fan,C., Hao,T., Szabo,G., Hu,Z., Venkatesan,K., Bethel,G., Martin,P., Rogers,J., Lawlor,S., McLaren,S., Dricot,A., Borick,H., Cusick,M.E., Vandenhaute,J., Dunham,I., Hill,D.E. and Vidal,M. TITLE hORFeome v3.1: a resource of human open reading frames representing over 10,000 human genes JOURNAL Genomics 89 (3), 307-315 (2007) PUBMED 17207965 REFERENCE 4 (bases 1 to 3187) AUTHORS Hillier,L.W., Graves,T.A., Fulton,R.S., Fulton,L.A., Pepin,K.H., Minx,P., Wagner-McPherson,C., Layman,D., Wylie,K., Sekhon,M., Becker,M.C., Fewell,G.A., Delehaunty,K.D., Miner,T.L., Nash,W.E., Kremitzki,C., Oddy,L., Du,H., Sun,H., Bradshaw-Cordum,H., Ali,J., Carter,J., Cordes,M., Harris,A., Isak,A., van Brunt,A., Nguyen,C., Du,F., Courtney,L., Kalicki,J., Ozersky,P., Abbott,S., Armstrong,J., Belter,E.A., Caruso,L., Cedroni,M., Cotton,M., Davidson,T., Desai,A., Elliott,G., Erb,T., Fronick,C., Gaige,T., Haakenson,W., Haglund,K., Holmes,A., Harkins,R., Kim,K., Kruchowski,S.S., Strong,C.M., Grewal,N., Goyea,E., Hou,S., Levy,A., Martinka,S., Mead,K., McLellan,M.D., Meyer,R., Randall-Maher,J., Tomlinson,C., Dauphin-Kohlberg,S., Kozlowicz-Reilly,A., Shah,N., Swearengen-Shahid,S., Snider,J., Strong,J.T., Thompson,J., Yoakum,M., Leonard,S., Pearman,C., Trani,L., Radionenko,M., Waligorski,J.E., Wang,C., Rock,S.M., Tin-Wollam,A.M., Maupin,R., Latreille,P., Wendl,M.C., Yang,S.P., Pohl,C., Wallis,J.W., Spieth,J., Bieri,T.A., Berkowicz,N., Nelson,J.O., Osborne,J., Ding,L., Meyer,R., Sabo,A., Shotland,Y., Sinha,P., Wohldmann,P.E., Cook,L.L., Hickenbotham,M.T., Eldred,J., Williams,D., Jones,T.A., She,X., Ciccarelli,F.D., Izaurralde,E., Taylor,J., Schmutz,J., Myers,R.M., Cox,D.R., Huang,X., McPherson,J.D., Mardis,E.R., Clifton,S.W., Warren,W.C., Chinwalla,A.T., Eddy,S.R., Marra,M.A., Ovcharenko,I., Furey,T.S., Miller,W., Eichler,E.E., Bork,P., Suyama,M., Torrents,D., Waterston,R.H. and Wilson,R.K. TITLE Generation and annotation of the DNA sequences of human chromosomes 2 and 4 JOURNAL Nature 434 (7034), 724-731 (2005) PUBMED 15815621 REFERENCE 5 (bases 1 to 3187) AUTHORS Sui,L., Zhang,W., Liu,Q., Chen,T., Li,N., Wan,T., Yu,M. and Cao,X. TITLE Cloning and functional characterization of human septin 10, a novel member of septin family cloned from dendritic cells JOURNAL Biochem. Biophys. Res. Commun. 304 (2), 393-398 (2003) PUBMED 12711328 REMARK GeneRIF: Cloning and functional characterization of septin 10. COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AK021681.1, AC011753.6, BC020502.1, AF146760.1 and AC140485.3. On Apr 20, 2012 this sequence version replaced gi:30795192. Summary: This gene encodes a member of the septin family of cytoskeletal proteins with GTPase activity. This protein localizes to the cytoplasm and nucleus and displays GTP-binding and GTPase activity. A pseudogene for this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]. Transcript Variant: This variant (2) lacks an in-frame segment in the coding region, compared to variant 1. Isoform 2 is shorter than isoform 1. ##Evidence-Data-START## Transcript exon combination :: AK092033.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-161 AK021681.1 1-161 162-162 AC011753.6 69138-69138 c 163-409 AK021681.1 163-409 410-3002 BC020502.1 173-2765 3003-3185 AF146760.1 2821-3003 3186-3187 AC140485.3 45359-45360 c FEATURES Location/Qualifiers source 1..3187 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="2" /map="2q13" gene 1..3187 /gene="SEPT10" /note="septin 10" /db_xref="GeneID:151011" /db_xref="HGNC:14349" /db_xref="MIM:611737" exon 1..409 /gene="SEPT10" /inference="alignment:Splign:1.39.8" variation 291 /gene="SEPT10" /replace="a" /replace="t" /db_xref="dbSNP:3829700" misc_feature 344..346 /gene="SEPT10" /note="upstream in-frame stop codon" CDS 380..1675 /gene="SEPT10" /note="isoform 2 is encoded by transcript variant 2; septin-10" /codon_start=1 /product="septin-10 isoform 2" /protein_id="NP_848699.1" /db_xref="GI:30795193" /db_xref="CCDS:CCDS42726.1" /db_xref="GeneID:151011" /db_xref="HGNC:14349" /db_xref="MIM:611737" /translation="
MASSEVARHLKRENIRSLTMSGHVGFESLPDQLVNRSIQQGFCFNILCVGETGIGKSTLIDTLFNTNFEDYESSHFCPNVKLKAQTYELQESNVQLKLTIVNTVGFGDQINKEESYQPIVDYIDAQFEAYLQEELKIKRSLFTYHDSRIHVCLYFISPTGHSLKTLDLLTMKNLDSKVNIIPVIAKADTVSKTELQKFKIKLMSELVSNGVQIYQFPTDDDTIAKVNAAMNGQLPFAVVGSMDEVKVGNKMVKARQYPWGVVQVENENHCDFVKLREMLICTNMEDLREQTHTRHYELYRRCKLEEMGFTDVGPENKPVSVQETYEAKRHEFHGERQRKEEEMKQMFVQRVKEKEAILKEAERELQAKFEHLKRLHQEERMKLEEKRRLLEEEIIAFSKKKATSEIFHSQSFLATGSNLRKDKDRKNSNFL
" misc_feature 497..1303 /gene="SEPT10" /note="CDC/Septin GTPase family; Region: CDC_Septin; cd01850" /db_xref="CDD:206649" misc_feature 500..1303 /gene="SEPT10" /note="Septin; Region: Septin; pfam00735" /db_xref="CDD:201420" misc_feature 527..550 /gene="SEPT10" /note="G1 box; other site" /db_xref="CDD:206649" misc_feature order(533..553,683..685,692..694,932..937,941..943, 1097..1102) /gene="SEPT10" /note="GTP/Mg2+ binding site [chemical binding]; other site" /db_xref="CDD:206649" misc_feature 617..634 /gene="SEPT10" /note="Switch I region; other site" /db_xref="CDD:206649" misc_feature 683..694 /gene="SEPT10" /note="G3 box; other site" /db_xref="CDD:206649" misc_feature order(689..805,809..832) /gene="SEPT10" /note="Switch II region; other site" /db_xref="CDD:206649" misc_feature 932..943 /gene="SEPT10" /note="G4 box; other site" /db_xref="CDD:206649" misc_feature 1097..1105 /gene="SEPT10" /note="G5 box; other site" /db_xref="CDD:206649" exon 410..527 /gene="SEPT10" /inference="alignment:Splign:1.39.8" exon 528..723 /gene="SEPT10" /inference="alignment:Splign:1.39.8" exon 724..910 /gene="SEPT10" /inference="alignment:Splign:1.39.8" variation 876 /gene="SEPT10" /replace="c" /replace="t" /db_xref="dbSNP:3829701" exon 911..1072 /gene="SEPT10" /inference="alignment:Splign:1.39.8" exon 1073..1169 /gene="SEPT10" /inference="alignment:Splign:1.39.8" exon 1170..1338 /gene="SEPT10" /inference="alignment:Splign:1.39.8" exon 1339..1471 /gene="SEPT10" /inference="alignment:Splign:1.39.8" exon 1472..1659 /gene="SEPT10" /inference="alignment:Splign:1.39.8" exon 1660..3187 /gene="SEPT10" /inference="alignment:Splign:1.39.8" variation 2154 /gene="SEPT10" /replace="c" /replace="t" /db_xref="dbSNP:3886070" ORIGIN
cacttccggcctcgcgagggccgcaatcactgctccgcagttcccgcctgcattcctcgcgccgtcttcctggagtcccagctctccttcagcccgccccaacgctgacgctcagtcctcaggcgtcgagggtagctcctgtgaggggctcgcttggcgcaggcaaaacgctcagcgcgcaccacagggcgtccgccccaaccccgcccccggaggcctccagctcggccccgcccctgtcccttccccgtcgcggaggcagcctagcctcgcgccccgcccgttgcttctgccctccggccttcccgccgccgtcgccgggaccagccgctcggggccgggctgatacagccgcttcaccgtgcccctgcccgcgaccatggcctcctccgaggtggcgcggcacctgaaaagagaaaacattcgttcgttgactatgtctggccatgttggttttgagagtttgcctgatcagctggtgaacagatccattcagcaaggtttctgctttaatattctctgtgtgggggaaactggaattggaaaatcaacactgattgacacattgtttaatactaattttgaagactatgaatcctcacatttttgcccaaatgttaaacttaaagctcagacatatgaactccaggaaagtaatgttcaattgaaattgaccattgtgaatacagtgggatttggtgaccaaataaataaagaagagagctaccaaccaatagttgactacatagatgctcagtttgaggcctatctccaagaagaactgaagattaagcgttctctctttacctaccatgattctcgcatccatgtgtgtctctacttcatttcaccgacaggccactctctgaagacacttgatctcttaaccatgaagaaccttgacagcaaggtaaacattataccagtgattgccaaagcagatacggtttctaaaactgaattacagaagtttaagatcaagctcatgagtgaattggtcagcaatggcgtccagatataccagttcccaacggatgatgacactattgctaaggtcaacgctgcaatgaatggacagttgccgtttgctgttgtgggaagtatggatgaggtaaaagtcggaaacaagatggtcaaagctcgccagtacccttggggtgttgtacaagtggaaaatgaaaaccactgtgactttgtaaagctgcgggaaatgctcatttgtacaaatatggaggacctgcgagagcagacccataccaggcactatgagctttacaggcgctgcaaactggaggaaatgggctttacagatgtgggcccagaaaacaagccagtcagtgttcaagagacctatgaagccaaaagacatgagttccatggtgaacgtcagaggaaggaagaagaaatgaaacagatgtttgtgcagcgagtaaaggagaaagaagccatattgaaagaagctgagagagagctacaggccaaatttgagcaccttaagagacttcaccaagaagagagaatgaagcttgaagaaaagagaagacttttggaagaagaaataattgctttctctaaaaagaaagctacctccgagatatttcacagccagtcctttctggcaacaggcagcaacctgaggaaggacaaggaccgtaagaactccaattttttgtaaaacagaagttccagagcacagaaggtcatcatcacaagcaaactttattaaaaaaaaactagaagtgtgctttgattttgctgttatttgttttatcacttctatatttggtgaacagccacagttactgatatttatggaaaagtactttcaagtacaaggtcaatacataagccagagtgaatgatactacaagttgagcatctctaattcaaaaatctgaaatccagaagcttcaaaatctgaatctttttgagcactgacttgaccccacaagtggaaaattccccacccgacacctttgctttctgatggttcagtttaaacagattttgtttcttgcacaaaatttttgtataaattactttcaggctatatgtataaggtggatgtgaaacatgaattatgtaattagagtcgggtcccgttgtgtatatgcagatattccaaacctgaaatccaaaacacttctggtccctagcattttggataagggatactcagcttgtacctatatattcatatatattcactgttgttagaaatgtttaagttgctgttctgtgatgaatctaaatcttttctcttgctaccaagctattgtcactgcagtgcattataccaaagagcgaagtcagtgccactgaaaatacagaacccattaatatcgtggctatctgattacatttatattccaagatgaaccttttttatatatgctaaaaattttggggaatatgttttgggatgtattatggagctaaaactctaacctcttaatagttttatagaacttaaaaattttttatacaattacccaattggtgatatgatcttaagcttttgtgtcagattatttaatatgatgacttcatgctttattatgccttattatggctgacgtattactgtggtgaaacaaaatatctttaaaagttaaaacatccagatatataagctattttttcctaaggataaagtacctttgagcatgagtgtatcacagctttcattaggaaaacttttcattacatacttgtttaaactctgtcttccagggtaaaaataataaggttgaatcattttattaaaaatactttttaagaaaataactatgaacatctgaatattaaagatataaaaatgcacataattcatatttcaggtggtatttgcattcagtgccttactggtattctcagaacattttaatgatttctaacatttcttaacagtcatagatatatacattttcattttttgtacttgaatattctaaataaaactgacatttactcttgacaaataaaacatatatttactaaaatgtgtttaattttcctttctgaaaactctcattttaaaaacgttcatttaattatgtatttgaattattttggagatgaggtattttatgagtattttcagacaatgaaacttattagtctgtgtcagattctgagcaatcatagagtcatctaagttgtaaataaaaccttgcatagcacaatt
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:151011 -> Molecular function: GO:0005525 [GTP binding] evidence: IEA GeneID:151011 -> Biological process: GO:0007049 [cell cycle] evidence: IEA GeneID:151011 -> Biological process: GO:0051301 [cell division] evidence: IEA GeneID:151011 -> Cellular component: GO:0031105 [septin complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.