GGRNA Home | Help | Advanced search

2019-03-25 14:47:40, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_153613               1908 bp    mRNA    linear   PRI 12-MAY-2013
DEFINITION  Homo sapiens lysophosphatidylcholine acyltransferase 4 (LPCAT4),
            mRNA.
ACCESSION   NM_153613
VERSION     NM_153613.2  GI:87116680
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1908)
  AUTHORS   Cao,J., Shan,D., Revett,T., Li,D., Wu,L., Liu,W., Tobin,J.F. and
            Gimeno,R.E.
  TITLE     Molecular identification of a novel mammalian brain isoform of
            acyl-CoA:lysophospholipid acyltransferase with prominent
            ethanolamine lysophospholipid acylating activity, LPEAT2
  JOURNAL   J. Biol. Chem. 283 (27), 19049-19057 (2008)
   PUBMED   18458083
  REMARK    GeneRIF: LPEAT2 as an important enzyme in the biosynthesis of
            ethanolamine-containing phospholipids, especially in brain.
REFERENCE   2  (bases 1 to 1908)
  AUTHORS   Ye,G.M., Chen,C., Huang,S., Han,D.D., Guo,J.H., Wan,B. and Yu,L.
  TITLE     Cloning and characterization a novel human
            1-acyl-sn-glycerol-3-phosphate acyltransferase gene AGPAT7
  JOURNAL   DNA Seq. 16 (5), 386-390 (2005)
   PUBMED   16243729
  REMARK    GeneRIF: report the cloning and characterization of a novel human
            1-acyl-sn-glycerol-3-phosphate acyltransferase member AGPAT7
            (1-acyl-sn-glycerol-3-phosphate acyltransferase 7) gene, which was
            mapped to human chromosome 15q14
REFERENCE   3  (bases 1 to 1908)
  AUTHORS   Adams,M.D., Kerlavage,A.R., Fleischmann,R.D., Fuldner,R.A.,
            Bult,C.J., Lee,N.H., Kirkness,E.F., Weinstock,K.G., Gocayne,J.D.,
            White,O. et al.
  TITLE     Initial assessment of human gene diversity and expression patterns
            based upon 83 million nucleotides of cDNA sequence
  JOURNAL   Nature 377 (6547 SUPPL), 3-174 (1995)
   PUBMED   7566098
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC048430.1, BC092463.1 and T29943.1.
            On Feb 10, 2006 this sequence version replaced gi:23957707.
            
            Summary: Members of the 1-acylglycerol-3-phosphate
            O-acyltransferase (EC 2.3.1.51) family, such as AGPAT7, catalyze
            the conversion of lysophosphatidic acid (LPA) to phosphatidic acid
            (PA), a precursor in the biosynthesis of all glycerolipids. Both
            LPA and PA are involved in signal transduction (Ye et al., 2005
            [PubMed 16243729]).[supplied by OMIM, May 2008].
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC048430.1, AL832237.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-3                 BC048430.1         3-5
            4-1887              BC092463.1         1-1884
            1888-1908           T29943.1           290-310
FEATURES             Location/Qualifiers
     source          1..1908
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="15"
                     /map="15q14"
     gene            1..1908
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /note="lysophosphatidylcholine acyltransferase 4"
                     /db_xref="GeneID:254531"
                     /db_xref="HGNC:30059"
                     /db_xref="MIM:612039"
     exon            1..208
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     STS             26..1231
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /db_xref="UniSTS:486579"
     STS             73..1285
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /db_xref="UniSTS:494902"
     CDS             95..1669
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /EC_number="2.3.1.25"
                     /note="acyl-CoA:lysophosphatidylethanolamine
                     acyltransferase 2; acyltransferase like 3;
                     1-acylglycerol-3-phosphate O-acyltransferase 7
                     (lysophosphatidic acid acyltransferase, eta); plasmalogen
                     synthase; PLSC domain containing protein; 1-AGPAT 7;
                     acyltransferase-like 3; 1-AGP acyltransferase 7"
                     /codon_start=1
                     /product="lysophospholipid acyltransferase LPCAT4"
                     /protein_id="NP_705841.2"
                     /db_xref="GI:87116681"
                     /db_xref="CCDS:CCDS32191.1"
                     /db_xref="GeneID:254531"
                     /db_xref="HGNC:30059"
                     /db_xref="MIM:612039"
                     /translation="
MSQGSPGDWAPLDPTPGPPASPNPFVHELHLSRLQRVKFCLLGALLAPIRVLLAFIVLFLLWPFAWLQVAGLSEEQLQEPITGWRKTVCHNGVLGLSRLLFFLLGFLRIRVRGQRASRLQAPVLVAAPHSTFFDPIVLLPCDLPKVVSRAENLSVPVIGALLRFNQAILVSRHDPASRRRVVEEVRRRATSGGKWPQVLFFPEGTCSNKKALLKFKPGAFIAGVPVQPVLIRYPNSLDTTSWAWRGPGVLKVLWLTASQPCSIVDVEFLPVYHPSPEESRDPTLYANNVQRVMAQALGIPATECEFVGSLPVIVVGRLKVALEPQLWELGKVLRKAGLSAGYVDAGAEPGRSRMISQEEFARQLQLSDPQTVAGAFGYFQQDTKGLVDFRDVALALAALDGGRSLEELTRLAFELFAEEQAEGPNRLLYKDGFSTILHLLLGSPHPAATALHAELCQAGSSQGLSLCQFQNFSLHDPLYGKLFSTYLRPPHTSRGTSQTPNASSPGNPTALANGTVQAPKQKGD
"
     misc_feature    212..280
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q643R3.1);
                     transmembrane region"
     misc_feature    353..415
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q643R3.1);
                     transmembrane region"
     misc_feature    434..1012
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /note="Lysophospholipid Acyltransferases (LPLATs) of
                     Glycerophospholipid Biosynthesis: LPCAT1-like; Region:
                     LPLAT_LPCAT1-like; cd07991"
                     /db_xref="CDD:153253"
     misc_feature    <452..>805
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /note="1-acyl-sn-glycerol-3-phosphate acyltransferase
                     [Lipid metabolism]; Region: PlsC; COG0204"
                     /db_xref="CDD:30553"
     misc_feature    order(479..481,488..490,494..496,536..547,704..712)
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /note="putative acyl-acceptor binding pocket; other site"
                     /db_xref="CDD:153253"
     misc_feature    479..496
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q643R3.1);
                     Region: HXXXXD motif"
     exon            209..351
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            352..572
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            573..685
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            686..746
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            747..805
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            806..840
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            841..895
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            896..978
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            979..1104
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            1105..1237
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            1238..1336
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            1337..1493
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     exon            1494..1908
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /inference="alignment:Splign:1.39.8"
     STS             1535..1677
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /standard_name="RH102924"
                     /db_xref="UniSTS:97258"
     variation       1779
                     /gene="LPCAT4"
                     /gene_synonym="AGPAT7; AYTL3; LPAAT-eta; LPEAT2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202247617"
ORIGIN      
agcgccgccgccgccgctgctgcagcagcagctgctctgcagagtggtggccggggccagggccggggtgccctccctcccaccttctcccgccatgagccagggaagtccgggggactgggcccccctagatcccacccccggacccccagcatcccccaaccccttcgtgcatgagttacatctctctcgcctccagagggttaagttctgcctcctgggggcattgctggcccccatccgagtgcttctggcctttatcgtcctctttctcctctggccctttgcctggcttcaagtggccggtcttagtgaggagcagcttcaggagccaattacaggatggaggaagactgtgtgccacaacggggtgctaggcctgagccgcctgctgtttttcctgctgggcttcctccggattcgcgttcgtggccagcgagcctctcgccttcaagcccctgtccttgttgctgccccacactccactttctttgaccccattgttctgctgccctgtgacctgcccaaagttgtgtcccgagctgagaacctttccgttcctgtcattggagcccttcttcgattcaaccaagccatcctggtatcccggcatgacccggcttctcgacgcagagtggtggaggaggtccgaaggcgggccacctcaggaggcaagtggccgcaggtgctattctttcctgagggcacctgttccaacaagaaggctttgcttaagttcaaaccaggagccttcatcgcaggggtgcctgtgcagcctgtcctcatccgctaccccaacagtctggacaccaccagctgggcatggaggggtcctggagtactcaaagtcctctggctcacagcctctcagccctgcagcattgtggatgtggagttccttcctgtgtatcaccccagccctgaggagagcagggaccccaccctctatgccaacaatgttcagagggtcatggcacaggctctgggcattccagccaccgaatgtgagtttgtagggagcttacctgtgattgtggtgggccggctgaaggtggcgttggaaccacagctctgggaactgggaaaagtgcttcggaaggctgggctgtccgctggctatgtggacgctggggcagagccaggccggagtcgaatgatcagccaggaagagtttgccaggcagctacagctctctgatcctcagacggtggctggtgcctttggctacttccagcaggataccaagggtttggtggacttccgagatgtggcccttgcactagcagctctggatgggggcaggagcctggaagagctaactcgtctggcctttgagctctttgctgaagagcaagcagagggtcccaaccgcctgctgtacaaagacggcttcagcaccatcctgcacctgctgctgggttcaccccaccctgctgccacagctttgcatgctgagctgtgccaggcaggatccagccaaggcctctccctctgtcagttccagaacttctccctccatgacccactctatgggaaactcttcagcacctacctgcgccccccacacacctctcgaggcacctcccagacaccaaatgcctcatccccaggcaaccccactgctctggccaatgggactgtgcaagcacccaagcagaagggagactgagtgcctcagcctctcaccccctcctcctcagggcagcgctaggggcctcccctatgcctcagccccatctctgctcctgtttgaattttgttattgttgtttggttgttgtttttttaagttgattttaattttttgtttggttgatttttttgtaaaaaactattttatatataaatataaatctatatctatatctattaaaaaaaatgaagtccagtcatattgatgttaccatta
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:254531 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA
            GeneID:254531 -> Molecular function: GO:0050200 [plasmalogen synthase activity] evidence: IEA
            GeneID:254531 -> Biological process: GO:0006644 [phospholipid metabolic process] evidence: TAS
            GeneID:254531 -> Biological process: GO:0006654 [phosphatidic acid biosynthetic process] evidence: TAS
            GeneID:254531 -> Biological process: GO:0019432 [triglyceride biosynthetic process] evidence: TAS
            GeneID:254531 -> Biological process: GO:0036148 [phosphatidylglycerol acyl-chain remodeling] evidence: TAS
            GeneID:254531 -> Biological process: GO:0036150 [phosphatidylserine acyl-chain remodeling] evidence: TAS
            GeneID:254531 -> Biological process: GO:0036151 [phosphatidylcholine acyl-chain remodeling] evidence: TAS
            GeneID:254531 -> Biological process: GO:0036152 [phosphatidylethanolamine acyl-chain remodeling] evidence: TAS
            GeneID:254531 -> Biological process: GO:0044255 [cellular lipid metabolic process] evidence: TAS
            GeneID:254531 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
            GeneID:254531 -> Biological process: GO:0046474 [glycerophospholipid biosynthetic process] evidence: TAS
            GeneID:254531 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS
            GeneID:254531 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_705841 -> EC 2.3.1.25
            NP_705841 -> EC 2.3.1.51

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.