GGRNA Home | Help | Advanced search

2019-03-25 14:33:28, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_153448               1591 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens ESX homeobox 1 (ESX1), mRNA.
ACCESSION   NM_153448
VERSION     NM_153448.3  GI:283806665
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1591)
  AUTHORS   Bonaparte,E., Moretti,M., Colpi,G.M., Nerva,F., Contalbi,G.,
            Vaccalluzzo,L., Tabano,S., Grati,F.R., Gazzano,G., Sirchia,S.M.,
            Simoni,G., Gallina,A. and Miozzo,M.
  TITLE     ESX1 gene expression as a robust marker of residual spermatogenesis
            in azoospermic men
  JOURNAL   Hum. Reprod. 25 (6), 1398-1403 (2010)
   PUBMED   20356899
  REMARK    GeneRIF: ESX1 emerges as a potentially reliable molecular marker of
            residual spermatogenesis in azoospermic men
REFERENCE   2  (bases 1 to 1591)
  AUTHORS   Wang,X. and Zhang,J.
  TITLE     Rapid evolution of primate ESX1, an X-linked placenta- and
            testis-expressed homeobox gene
  JOURNAL   Hum. Mol. Genet. 16 (17), 2053-2060 (2007)
   PUBMED   17588961
REFERENCE   3  (bases 1 to 1591)
  AUTHORS   Loschiavo,M., Nguyen,Q.K., Duselis,A.R. and Vrana,P.B.
  TITLE     Mapping and identification of candidate loci responsible for
            Peromyscus hybrid overgrowth
  JOURNAL   Mamm. Genome 18 (1), 75-85 (2007)
   PUBMED   17242862
REFERENCE   4  (bases 1 to 1591)
  AUTHORS   Murthi,P., Doherty,V.L., Said,J.M., Donath,S., Brennecke,S.P. and
            Kalionis,B.
  TITLE     Homeobox gene ESX1L expression is decreased in human pre-term
            idiopathic fetal growth restriction
  JOURNAL   Mol. Hum. Reprod. 12 (5), 335-340 (2006)
   PUBMED   16613891
  REMARK    GeneRIF: In FGR-affected placentae, ESX1L levels were lower than in
            gestation-matched controls, indicating a potential role for the
            ESX1L gene within the growth control mechanism of the fetus,
            through its effect on placental function.
REFERENCE   5  (bases 1 to 1591)
  AUTHORS   Yanagihara,M., Ishikawa,S., Naito,M., Nakajima,J., Aburatani,H. and
            Hatakeyama,M.
  TITLE     Paired-like homeoprotein ESXR1 acts as a sequence-specific
            transcriptional repressor of the human K-ras gene
  JOURNAL   Oncogene 24 (38), 5878-5887 (2005)
   PUBMED   15897875
REFERENCE   6  (bases 1 to 1591)
  AUTHORS   Figueiredo,A.L., Salles,M.G., Albano,R.M. and Porto,L.C.
  TITLE     Molecular and morphologic analyses of expression of ESX1L in
            different stages of human placental development
  JOURNAL   J. Cell. Mol. Med. 8 (4), 545-550 (2004)
   PUBMED   15601583
  REMARK    GeneRIF: ESX1L is expressed during all stages of placental
            development and is localized to sparse areas of trophoblast in
            terminal villi in association with cytotrophoblastic cells
REFERENCE   7  (bases 1 to 1591)
  AUTHORS   Ozawa,H., Ashizawa,S., Naito,M., Yanagihara,M., Ohnishi,N.,
            Maeda,T., Matsuda,Y., Jo,Y., Higashi,H., Kakita,A. and
            Hatakeyama,M.
  TITLE     Paired-like homeodomain protein ESXR1 possesses a cleavable
            C-terminal region that inhibits cyclin degradation
  JOURNAL   Oncogene 23 (39), 6590-6602 (2004)
   PUBMED   15235584
  REMARK    GeneRIF: proteolytic processing of ESXR1 plays a role in concerted
            regulation of the cell cycle and transcription in human cells
REFERENCE   8  (bases 1 to 1591)
  AUTHORS   Fohn,L.E. and Behringer,R.R.
  TITLE     ESX1L, a novel X chromosome-linked human homeobox gene expressed in
            the placenta and testis
  JOURNAL   Genomics 74 (1), 105-108 (2001)
   PUBMED   11374906
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AK097704.1 and BC053599.1.
            This sequence is a reference standard in the RefSeqGene project.
            On Jan 13, 2010 this sequence version replaced gi:38455418.
            
            Summary: This gene encodes a dual-function 65 kDa protein that
            undergoes proteolytic cleavage to produce a 45 kDa N-terminal
            fragment with a paired-like homeodomain and a 20 kDa C-terminal
            fragment with a proline-rich domain. The C-terminal fragment
            localizes to the cytoplasm while the N-terminal fragment localizes
            exclusively to the nucleus. In contrast to human, the mouse homolog
            has a novel PN/PF motif in the C-terminus and is paternally
            imprinted in placental tissue. This gene likely plays a role in
            placental development and spermatogenesis. [provided by RefSeq, Jan
            2010].
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC053599.1, BC042633.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-11                AK097704.1         16-26
            12-1027             BC053599.1         1-1016
            1028-1108           AK097704.1         1043-1123
            1109-1591           BC053599.1         1098-1580
FEATURES             Location/Qualifiers
     source          1..1591
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xq22.1"
     gene            1..1591
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /note="ESX homeobox 1"
                     /db_xref="GeneID:80712"
                     /db_xref="HGNC:14865"
                     /db_xref="HPRD:06503"
                     /db_xref="HPRD:08945"
                     /db_xref="MIM:300154"
     exon            1..151
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(12)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376260931"
     variation       complement(22)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377423337"
     variation       complement(59)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373167155"
     variation       complement(60)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369664343"
     misc_feature    64..66
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /note="upstream in-frame stop codon"
     CDS             70..1290
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /note="ESX1-related protein; extraembryonic,
                     spermatogenesis, homeobox 1 homolog"
                     /codon_start=1
                     /product="homeobox protein ESX1"
                     /protein_id="NP_703149.1"
                     /db_xref="GI:23592228"
                     /db_xref="CCDS:CCDS14516.1"
                     /db_xref="GeneID:80712"
                     /db_xref="HGNC:14865"
                     /db_xref="HPRD:06503"
                     /db_xref="HPRD:08945"
                     /db_xref="MIM:300154"
                     /translation="
MESLRGYTHSDIGYRSLAVGEDIEEVNDEKLTVTSLMARGGEDEENTRSKPEYGTEAENNVGTEGSVPSDDQDREGGGGHEPEQQQEEPPLTKPEQQQEEPPLLELKQEQEEPPQTTVEGPQPAEGPQTAEGPQPPERKRRRRTAFTQFQLQELENFFDESQYPDVVARERLAARLNLTEDRVQVWFQNRRAKWKRNQRVLMLRNTATADLAHPLDMFLGGAYYAAPALDPALCVHLVPQLPRPPVLPVPPMPPRPPMVPMPPRPPIAPMPPMAPVPPGSRMAPVPPGPRMAPVPPWPPMAPVPPWPPMAPVPTGPPMAPVPPGPPMARVPPGPPMARVPPGPPMAPLPPGPPMAPLPPGPPMAPLPPGPPMAPLPPRSHVPHTGLAPVHITWAPVINSYYACPFF
"
     misc_feature    481..498
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8N693.3);
                     Region: Nuclear localization signal (Potential)"
     misc_feature    487..663
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /note="Homeodomain;  DNA binding domains involved in the
                     transcriptional regulation of key eukaryotic developmental
                     processes; may bind to DNA as monomers or as homo- and/or
                     heterodimers, in a sequence-specific manner; Region:
                     homeodomain; cd00086"
                     /db_xref="CDD:28970"
     misc_feature    order(487..501,505..507,556..558,574..576,613..615,
                     619..624,631..636,640..648,652..657)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /note="DNA binding site [nucleotide binding]"
                     /db_xref="CDD:28970"
     misc_feature    order(493..495,502..504,622..624,631..636,643..645)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /note="specific DNA base contacts [nucleotide binding];
                     other site"
                     /db_xref="CDD:28970"
     misc_feature    799..1203
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8N693.3);
                     Region: 15 X 9 AA tandem repeats of P-P-x-x-P-x-P-P-x"
     variation       complement(78)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201322852"
     variation       complement(87)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:147351224"
     variation       complement(97)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186958219"
     variation       complement(124)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:202022977"
     variation       complement(139)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200141038"
     exon            152..575
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(160)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140169186"
     variation       complement(170)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147516186"
     variation       complement(201)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149394798"
     variation       complement(230)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:76590545"
     variation       complement(239)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200824381"
     variation       complement(271)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138817762"
     variation       complement(279)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376654393"
     variation       complement(294)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150207642"
     variation       complement(297)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372065561"
     variation       complement(333)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200053829"
     variation       complement(379)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56255243"
     variation       complement(381)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141891783"
     variation       complement(386..387)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace=""
                     /replace="tg"
                     /db_xref="dbSNP:72224483"
     variation       complement(417)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138260698"
     variation       complement(437)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368352917"
     variation       complement(460)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375606449"
     variation       complement(475)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370791049"
     variation       complement(477)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:145629484"
     variation       complement(495)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140432334"
     variation       complement(544)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201574313"
     variation       complement(567)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:146746547"
     exon            576..621
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(577)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:370262145"
     variation       complement(605)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:143139589"
     variation       complement(611)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201519494"
     exon            622..1480
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /inference="alignment:Splign:1.39.8"
     variation       complement(647)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41305431"
     variation       complement(656)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144948361"
     variation       complement(662)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200652460"
     variation       complement(709)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149916765"
     variation       complement(722)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371028979"
     variation       complement(772)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199653056"
     variation       complement(790)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376291238"
     variation       complement(794)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139543229"
     variation       complement(823)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373095481"
     variation       complement(870)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369362892"
     variation       complement(877)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375826244"
     variation       complement(903)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369054321"
     variation       complement(907)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144173947"
     variation       complement(910)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:111666814"
     variation       complement(934)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141524947"
     variation       complement(937)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148783552"
     variation       complement(940)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374876713"
     variation       complement(943)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200455087"
     variation       complement(971)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200908797"
     variation       complement(972)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373133940"
     variation       complement(976)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200592570"
     variation       complement(985)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201963432"
     variation       complement(990)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184828935"
     variation       complement(1009)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:9697856"
     variation       complement(1028)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:191202058"
     variation       complement(1098)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368249985"
     variation       complement(1109)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200088361"
     variation       complement(1111)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76090537"
     variation       complement(1136)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201142803"
     variation       complement(1138)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199856640"
     variation       complement(1190)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:369886617"
     variation       complement(1192)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:78191648"
     variation       complement(1200)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace=""
                     /replace="gggccgcccatggcgcctctgccaccc"
                     /db_xref="dbSNP:11267975"
     variation       complement(1201)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377155869"
     variation       complement(1246)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:12383583"
     variation       complement(1252)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372235695"
     variation       complement(1278)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375756428"
     variation       complement(1281)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138294460"
     variation       complement(1285)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184749315"
     variation       complement(1286)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145648737"
     variation       complement(1288)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:9803338"
     variation       complement(1302)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368022150"
     variation       complement(1305)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192729779"
     variation       complement(1317)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371465085"
     variation       complement(1336)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201413646"
     variation       complement(1369)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:113852635"
     variation       complement(1420)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:188475442"
     variation       complement(1479)
                     /gene="ESX1"
                     /gene_synonym="ESX1L; ESXR1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:183421159"
ORIGIN      
cccgggatcgccgcggaaccacgcacagagtctgcagaagtgcacagctttatcgacagcgcttgaagcatggagtctcttcgcgggtacacccacagtgatattggctaccgcagcctggcagtcggcgaggacatcgaggaagtgaatgatgagaaacttaccgtgacctcgctgatggcaaggggaggagaggacgaggagaatacacggtccaaacctgagtacggaacagaagcggaaaacaacgttggcacggaagggtccgtcccctcggacgaccaagaccgtgagggtggcggcggccacgagccggagcaacagcaggaggagccgcccctgaccaagccggagcaacagcaggaggagccgcccctgctcgagctgaagcaagagcaggaggagccgccccagacgaccgtggaggggccacagccggcggaggggccacaaaccgctgagggaccacagcccccagagaggaaacgccgccgccgcaccgcgttcacgcagtttcagctgcaggagctagagaactttttcgatgaatctcaatatcccgacgttgtggcgcgagagagacttgcagcacgcctgaatttgactgaagacagagtgcaggtttggtttcagaacagaagagccaagtggaaacgaaatcagagggtgctaatgttgagaaacactgctactgctgacctggcccaccctttggacatgttcttgggtggggcctattatgctgctcctgctctggatcctgctttgtgtgttcatctggtgccacaactacctagaccacctgtgctgcctgtgccacctatgccacccaggccacccatggtccctatgccacccaggccacccatagcacctatgccacccatggcgcctgtgccacccggctcacgcatggcgcctgtgccacccgggccacgcatggcgcctgtgccaccctggccgcccatggcgcctgtgccaccctggccgcccatggcgcctgtgccaaccgggccgcccatggcgcctgtgccacccgggccgcccatggcgcgtgtgccacccgggccgcccatggcgcgtgtgccacccgggccgcccatggcgcctctgccacccgggccgcccatggcgcctctgccacccgggccgcccatggcgcctctgccacccgggccgcccatggcgcctctgccacccaggtcacatgtgcctcacactggcctggctcctgtacacatcacatgggcccctgtcatcaacagttattatgcatgtccctttttctaaagtaaggtattcataacagtttttccaaagttctttcctgccagatagaaattgtgcacagcacagcatcaagtaattcgttagatgcttgttaaatgaagtgggtaggtgaacaaagttaacgaatgccctgttatttttgtaggccacataattgtagtattttcaataaagatgtgacttaatagtaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:80712 -> Molecular function: GO:0003700 [sequence-specific DNA binding transcription factor activity] evidence: IEA
            GeneID:80712 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IDA
            GeneID:80712 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA
            GeneID:80712 -> Biological process: GO:0006357 [regulation of transcription from RNA polymerase II promoter] evidence: IEA
            GeneID:80712 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA
            GeneID:80712 -> Biological process: GO:0051726 [regulation of cell cycle] evidence: IDA
            GeneID:80712 -> Biological process: GO:0060713 [labyrinthine layer morphogenesis] evidence: IEA
            GeneID:80712 -> Biological process: GO:0060716 [labyrinthine layer blood vessel development] evidence: IEA
            GeneID:80712 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:80712 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.