GGRNA Home | Help | Advanced search

2020-10-26 18:55:39, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_152446               4461 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens centrosomal protein 128kDa (CEP128), mRNA.
ACCESSION   NM_152446 XM_496002
VERSION     NM_152446.3  GI:194018736
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 4461)
  AUTHORS   Wu,J.H., Lemaitre,R.N., Manichaikul,A., Guan,W., Tanaka,T., Foy,M.,
            Kabagambe,E.K., Djousse,L., Siscovick,D., Fretts,A.M., Johnson,C.,
            King,I.B., Psaty,B.M., McKnight,B., Rich,S.S., Chen,Y.D.,
            Nettleton,J.A., Tang,W., Bandinelli,S., Jacobs,D.R. Jr.,
            Browning,B.L., Laurie,C.C., Gu,X., Tsai,M.Y., Steffen,L.M.,
            Ferrucci,L., Fornage,M. and Mozaffarian,D.
  TITLE     Genome-wide association study identifies novel loci associated with
            concentrations of four plasma phospholipid fatty acids in the de
            novo lipogenesis pathway: results from the Cohorts for Heart and
            Aging Research in Genomic Epidemiology (CHARGE) consortium
  JOURNAL   Circ Cardiovasc Genet 6 (2), 171-183 (2013)
   PUBMED   23362303
REFERENCE   2  (bases 1 to 4461)
  AUTHORS   Croteau-Chonka,D.C., Marvelle,A.F., Lange,E.M., Lee,N.R.,
            Adair,L.S., Lange,L.A. and Mohlke,K.L.
  TITLE     Genome-wide association study of anthropometric traits and evidence
            of interactions with age and study year in Filipino women
  JOURNAL   Obesity (Silver Spring) 19 (5), 1019-1027 (2011)
   PUBMED   20966902
  REMARK    GeneRIF: Observational study and genome-wide association study of
            gene-disease association. (HuGE Navigator)
REFERENCE   3  (bases 1 to 4461)
  AUTHORS   Jakobsen,L., Vanselow,K., Skogs,M., Toyoda,Y., Lundberg,E.,
            Poser,I., Falkenby,L.G., Bennetzen,M., Westendorf,J., Nigg,E.A.,
            Uhlen,M., Hyman,A.A. and Andersen,J.S.
  TITLE     Novel asymmetrically localizing components of human centrosomes
            identified by complementary proteomics methods
  JOURNAL   EMBO J. 30 (8), 1520-1535 (2011)
   PUBMED   21399614
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BX248746.1, BC045834.1, DB320407.1, AC022404.7, AK056756.1,
            CD366820.1 and AI937080.1.
            On Jul 10, 2008 this sequence version replaced gi:64085251.
            
            ##Evidence-Data-START##
            CDS exon combination :: BC150610.1 [ECO:0000331]
            RNAseq introns       :: mixed/partial sample support ERS025081,
                                    ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-708               BX248746.1         162-869
            709-1354            BC045834.1         816-1461
            1355-1627           DB320407.1         111-383             c
            1628-1731           DB320407.1         6-109               c
            1732-2311           AC022404.7         156915-157494       c
            2312-3087           AK056756.1         1-776
            3088-3466           CD366820.1         263-641             c
            3467-3894           AK056756.1         1156-1583
            3895-4007           AK056756.1         1586-1698
            4008-4227           AI937080.1         236-455             c
            4228-4461           AI937080.1         1-234               c
FEATURES             Location/Qualifiers
     source          1..4461
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="14"
                     /map="14q31.1"
     gene            1..4461
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /note="centrosomal protein 128kDa"
                     /db_xref="GeneID:145508"
                     /db_xref="HGNC:20359"
     exon            1..156
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     variation       39
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3742722"
     misc_feature    70..72
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /note="upstream in-frame stop codon"
     exon            157..318
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     CDS             172..3456
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /note="lens epithelium-derived protein"
                     /codon_start=1
                     /product="centrosomal protein of 128 kDa"
                     /protein_id="NP_689659.2"
                     /db_xref="GI:64085252"
                     /db_xref="CCDS:CCDS32130.1"
                     /db_xref="GeneID:145508"
                     /db_xref="HGNC:20359"
                     /translation="
MAESSSESDHFRCRDRLSPWAARSTHRGTRSLPTVEVTEKVNTITSTLQDTSRNLRQVDQMLGRYREYSNGQAGAIEHLKESLEQSIDQLRSQRLLRNSGGRSISVTSLSASDLDGGTGSELHHFPPTSPLKDYGDPQGIKRMRSRTGVRFVQETDDMTQLHGFHQSLRDLSSEQIRLGDDFNRELSRRSRSDAETKRALEELTEKLNEAQKQEVVSDRVERRLQELEREMRTERELVERRQDQLGLMSLQLQEALKKQEAKADEHEGAIKNKLRQTETEKNQLEQELELSRRLLNQSEGSRETLLHQVEELRTQLTKAEGDRKGLQHQVSQISKQQSNYQDEQGEDWRFRRGVEREKQDLEKQMSDLRVQLNFSAMASELEEVKRCMERKDKEKAHLASQVENLTRELENGEKQQLQMLDRLKEIQNHFDTCEAERKHADLQISELTRHAEDATKQAERYLSELQQSEALKEEAEKRREDLKLKAQESIRQWKLKHKKLERALEKQSETVDELTGKNNQILKEKDELKTQLYAALQQIENLRKELNDVLTKRALQEEELHSKEEKLRDIKSHQADLELEVKNSLDTIHRLESELKKQSKIQSQMKVEKAHLEEEIAELKKSQAQDKAKLLEMQESIKDLSAIRADLANKLAEEERAKKAVLKDLSDLTAQAKSRDEETATIITQLKLERDVHQRELKDLTSSLQSVKTKHEQNIQELMKHFKKEKSEAENHIRTLKAESLEEKNMAKIHRGQLEKLKSQCDRLTEELTQNENENKKLKLKYQCLKDQLEEREKHISIEEEHLRRMEEARLQLKDQLLCLETEQESILGVIGKEIDAACKTFSKDSVEKLKVFSSGPDIHYDPHRWLAESKTKLQWLCEELKERENREKNLRHQLMLCRQQLRNLTENKESELQCLFQQIERQEQLLDEIHREKRDLLEETQRKDEEMGSLQDRVIALETSTQVALDHLESVPEKLSLLEDFKDFRDSCSSSERTDGRYSKYRVRRNSLQHHQDDTKYRTKSFKGDRTFLEGSHTRGLDHSSSWQDHSRFLSSPRFSYVNSFTKRTVAPDSASNKEDATMNGTSSQPKKEEYGS
"
     misc_feature    1663..>2085
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /note="Fms-interacting protein; Region: FimP; pfam09766"
                     /db_xref="CDD:204309"
     misc_feature    2992..2994
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3019..3021
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     exon            319..405
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            406..532
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            533..651
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            652..743
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            744..816
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            817..933
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            934..1020
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            1021..1095
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            1096..1228
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            1229..1380
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            1381..1731
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            1732..2382
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    <2151..>2730
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /note="span covered by CTD-2308C24"
     misc_feature    <2151..>2730
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /note="span covered by RP11-757H14"
     exon            2383..2547
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            2548..2724
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            2725..2784
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            2785..2977
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            2978..3027
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            3028..3051
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            3052..3129
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            3130..3243
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            3244..3352
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
     exon            3353..4457
                     /gene="CEP128"
                     /gene_synonym="C14orf145; C14orf61; LEDP/132"
                     /inference="alignment:Splign:1.39.8"
ORIGIN      
gtggtttggggaaagtgtaggggcaaccaaagatcatcggcttgactaggccctttgccctgaacctcatgaagaaatgataggaggcagacatatgtgcctaaaaagagcgttgagctcagagaagagcaactcggagttttgggggtgtgctttgatttgtgtacatcaatggcagaatcatccagcgaatcagatcacttccgctgtcgtgaccgattgagtccatgggctgccagatcaacgcacaggggaactcgaagtcttcctacagtagaagttaccgagaaggtcaacactataacaagtactttacaggataccagtcggaacctgcgacaagtggaccagatgcttggacgataccgagaatacagtaatggacaggcgggtgcgatagaacatttaaaagaaagcttggaacaatcaatcgaccaactccggagtcaacgtttattgagaaactcaggagggagaagtatttctgttacaagtttgagtgcaagtgaccttgatggtggcactgggtcagagctccatcattttccacctacctcacctctcaaggactatggggatccacagggtattaaacgaatgagatcaagaactggtgtccggtttgttcaagagactgatgatatgactcagcttcatggttttcatcagtctcttcgagacctcagcagtgaacaaattcgccttggagatgatttcaacagggagctttccagaaggagccggtcagatgccgaaacaaaaagggctttggaagaattgactgaaaaacttaatgaagcccagaaacaagaagtggtttcagatcgggtggagcggcggcttcaggaactggagagagagatgcgcacagaaagggagctggtggaaagacgccaggatcaactgggactcatgtccctgcagctacaggaggcactaaagaaacaagaagctaaagcagatgagcatgagggggcaataaaaaataagctaagacaaactgaaactgagaagaatcaacttgaacaggaattggagctatctcgaaggttattgaatcaatcagaaggcagccgagaaacacttttgcatcaggtagaagaactgcgtacacaacttacgaaagcagaaggtgatcgaaagggtttacagcatcaagtatctcagatttccaagcaacagtcaaactatcaggatgaacaaggggaggactggagatttaggagaggggttgagcgggaaaaacaggacctggagaagcaaatgtcagatttgagagtgcagctgaacttcagcgcaatggcatctgagttagaggaagtgaaacggtgcatggagagaaaagacaaggagaaagcacatttggcatcacaagtagagaatttaacacgtgaactggagaatggggaaaaacagcaactgcagatgttggatcgacttaaggagatccagaatcactttgacacatgtgaggccgagcgtaagcatgctgaccttcagatctcagagctgactcgccatgcggaggatgcaaccaagcaggctgagcggtacctcagtgagctccagcagtcagaggctctgaaagaggaggcggagaagaggagggaagacctgaaactgaaagctcaagaatccattaggcagtggaagcttaagcataagaagttagaacgagcgttggagaaacaatctgaaactgttgatgaactgacaggcaagaataatcagattttaaaagaaaaggatgaattgaaaacccagctgtatgcagcattacaacaaatagagaatcttcgaaaggaattgaatgatgtcctaacaaagcgtgcccttcaggaggaggagcttcactccaaggaggagaaattacgtgatattaagtctcatcaagctgaccttgaattggaagttaagaattccctggataccatccatagactggagagcgaattgaaaaagcagagtaagatccaaagccagatgaaagttgagaaagctcacttggaggaagaaattgcagagctcaagaagagccaggcccaggacaaagctaaacttcttgagatgcaagagtccatcaaggacctgagtgccatccgagcagatcttgctaataaattggctgaggaagagagagccaagaaagcagtgcttaaggacctttctgacctcactgcacaggcaaaatccagggatgaagaaacagctacaatcatcacacagttaaagctggaacgagatgtgcaccagagggagctgaaagatctcacatcatcattgcagagtgtgaaaacaaaacacgaacagaatatccaggagcttatgaagcactttaagaaagaaaagagtgaggctgagaatcatatcaggactctgaaggctgaaagtttagaagagaagaatatggctaaaattcatcgtggtcagctggagaagttgaaatcacagtgtgacagactgacagaggaattaacccagaatgaaaatgagaacaaaaaactgaagctaaaatatcaatgtttgaaggatcaactagaagaaagggaaaaacatataagcattgaagaggagcacttaaggaggatggaagaggccagattgcagctcaaggatcaacttctttgcttggagactgaacaggaatccattcttggtgtgataggaaaggaaattgatgcagcttgtaaaacattctccaaggactcagtggagaaattaaaagttttttcatctggtcctgatatacattatgacccacatcgctggttagcagaaagcaagactaaacttcagtggctctgtgaggaactgaaagagagagaaaacagagagaaaaatctgcgacaccagctgatgctctgcagacaacaactcaggaatttgactgaaaacaaggaatctgagttgcagtgtctctttcaacagatagaaaggcaggagcagcttctggatgaaatacatcgtgagaagagagatctactggaagagacccaaagaaaagatgaagaaatgggatctctgcaggaccgtgtaattgcattagaaacgagtacccaagtggccttggaccatctggagtctgtgcctgagaaactgagcctactagaagatttcaaagacttcagagattcctgcagttcatctgagagaactgatggaagatattccaaatacagggttcgcagaaattctcttcagcatcaccaagatgacaccaagtacagaaccaaaagtttcaaaggtgacagaacctttctggaaggttcccacactcgtgggttagatcactcatcctcttggcaggatcacagtcgcttcctgtctagtccaagattttcatacgtgaactcatttaccaaaagaactgttgctccagattcagcttcaaacaaggaagatgccacaatgaatggaacaagttcacaacccaaaaaagaggaatatgggagctaaaaaagcaaatgtaatttgttattttacatgagtatgttacaaataataacatctctattcttacagcaatttggcccagattatctaacagacatacctgcagctttggctctttggtattgccaaacattgacaaaagtgacaatactgttggtccttgtgaatggtaaaccaatccaaataatatcagatcatgaatgatgtgcagctaatttatttgcaacttatactagcacagaaagaatgatattttttcactttgtattttcctttttcaagtgtggtcagtcacattttcccaaccaaaatttggatttctaattgaggccttttaaaaattactggctaaaaagaaggaaaatgagtttcccttgaggcaaaagttgccagcactttagattcagggagcatttatatacaactgattttttgaaaaattttctccctaataaattatcatgtgttataacatgtggagatgtgcatatataacattagacagtccactttataaatgctcaggacttttatatctatcatcttaacagtccacaactgcataccgtagctgaaaattatttccaatcatccatttttaatagcaataaagaattcataaatgatatctgaactgtagagcactgtaaagaattcatagcacaatttatttatttgtctttttgtggccaaatatcctactgtgatcacttcagtcatatcctggaccgtctttggtttactgtgactaaaatcatagcaccaaactcctttgtccatgagatttatatataatcttgtataatttggtcctatctgcttctaccatcccaacttttttcatcaaagtgtctaagaacgtattccctttacacgctgatctcctagtggagaaggatttatattaaatgctaagtaatagtaaactttcaggaactgaatcctattgggtcatggattctgcatagacaagggcaataaagcaatacctttgtaatatgcataaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:145508 -> Cellular component: GO:0000922 [spindle pole] evidence: IDA
            GeneID:145508 -> Cellular component: GO:0005814 [centriole] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.