Home |
Help |
Advanced search
2024-04-20 17:25:01, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_145913 3286 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens solute carrier family 5 (iodide transporter), member 8
(SLC5A8), mRNA.
ACCESSION NM_145913
VERSION NM_145913.3 GI:167466277
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3286)
AUTHORS Coothankandaswamy,V., Elangovan,S., Singh,N., Prasad,P.D.,
Thangaraju,M. and Ganapathy,V.
TITLE The plasma membrane transporter SLC5A8 suppresses tumour
progression through depletion of survivin without involving its
transport function
JOURNAL Biochem. J. 450 (1), 169-178 (2013)
PUBMED 23167260
REMARK GeneRIF: SLC5A8 suppresses tumour progression through depletion of
survivin without involving its transport function
REFERENCE 2 (bases 1 to 3286)
AUTHORS Helm,J., Coppola,D., Ganapathy,V., Lloyd,M., Centeno,B.A.,
Chen,D.T., Malafa,M.P. and Park,J.Y.
TITLE SLC5A8 nuclear translocation and loss of expression are associated
with poor outcome in pancreatic ductal adenocarcinoma
JOURNAL Pancreas 41 (6), 904-909 (2012)
PUBMED 22450368
REMARK GeneRIF: SLC5A8 nuclear translocation and loss of expression are
associated with poor outcome in pancreatic ductal adenocarcinoma.
REFERENCE 3 (bases 1 to 3286)
AUTHORS Lin,H.Y., Park,H.Y., Radlein,S., Mahajan,N.P., Sellers,T.A.,
Zachariah,B., Pow-Sang,J., Coppola,D., Ganapathy,V. and Park,J.Y.
TITLE Protein expressions and genetic variations of SLC5A8 in prostate
cancer risk and aggressiveness
JOURNAL Urology 78 (4), 971 (2011)
PUBMED 21802122
REMARK GeneRIF: SLC5A8 has a role in prostate cancer risk and
aggressiveness
REFERENCE 4 (bases 1 to 3286)
AUTHORS Campa,D., Husing,A., Chang-Claude,J., Dostal,L., Boeing,H.,
Kroger,J., Tjonneland,A., Roswall,N., Overvad,K., Dahm,C.C.,
Rodriguez,L., Sala,N., Perez,M.J., Larranaga,N., Chirlaque,M.D.,
Ardanaz,E., Khaw,K.T., Wareham,N., Allen,N.E., Travis,R.C.,
Trichopoulou,A., Naska,A., Bamia,C., Palli,D., Sieri,S., Tumino,R.,
Sacerdote,C., van Kranen,H.J., Bas Bueno-de-Mesquita,H.,
Stattin,P., Johansson,M., Chajes,V., Rinaldi,S., Romieu,I.,
Siddiq,A., Norat,T., Riboli,E., Kaaks,R. and Canzian,F.
TITLE Genetic variability of the fatty acid synthase pathway is not
associated with prostate cancer risk in the European Prospective
Investigation on Cancer (EPIC)
JOURNAL Eur. J. Cancer 47 (3), 420-427 (2011)
PUBMED 20965718
REMARK GeneRIF: Observational study of gene-disease association. (HuGE
Navigator)
REFERENCE 5 (bases 1 to 3286)
AUTHORS Brim,H., Kumar,K., Nazarian,J., Hathout,Y., Jafarian,A., Lee,E.,
Green,W., Smoot,D., Park,J., Nouraie,M. and Ashktorab,H.
TITLE SLC5A8 gene, a transporter of butyrate: a gut flora metabolite, is
frequently methylated in African American colon adenomas
JOURNAL PLoS ONE 6 (6), E20216 (2011)
PUBMED 21687703
REMARK GeneRIF: SLC5A8 is highly methylated in African American colon
adenomas
REFERENCE 6 (bases 1 to 3286)
AUTHORS Hong,C., Maunakea,A., Jun,P., Bollen,A.W., Hodgson,J.G.,
Goldenberg,D.D., Weiss,W.A. and Costello,J.F.
TITLE Shared epigenetic mechanisms in human and mouse gliomas inactivate
expression of the growth suppressor SLC5A8
JOURNAL Cancer Res. 65 (9), 3617-3623 (2005)
PUBMED 15867356
REMARK GeneRIF: Data suggest that SLC5A8 functions as a growth suppressor
gene in vitro and that it is silenced frequently by epigenetic
mechanisms in primary gliomas.
REFERENCE 7 (bases 1 to 3286)
AUTHORS Gopal,E., Fei,Y.J., Sugawara,M., Miyauchi,S., Zhuang,L., Martin,P.,
Smith,S.B., Prasad,P.D. and Ganapathy,V.
TITLE Expression of slc5a8 in kidney and its role in Na(+)-coupled
transport of lactate
JOURNAL J. Biol. Chem. 279 (43), 44522-44532 (2004)
PUBMED 15322102
REFERENCE 8 (bases 1 to 3286)
AUTHORS Miyauchi,S., Gopal,E., Fei,Y.J. and Ganapathy,V.
TITLE Functional identification of SLC5A8, a tumor suppressor
down-regulated in colon cancer, as a Na(+)-coupled transporter for
short-chain fatty acids
JOURNAL J. Biol. Chem. 279 (14), 13293-13296 (2004)
PUBMED 14966140
REMARK GeneRIF: functional identity of SLC5A8 as a Na(+)-coupled
transporter for short-chain fatty acids.
REFERENCE 9 (bases 1 to 3286)
AUTHORS Lacroix,L., Pourcher,T., Magnon,C., Bellon,N., Talbot,M.,
Intaraphairot,T., Caillou,B., Schlumberger,M. and Bidart,J.M.
TITLE Expression of the apical iodide transporter in human thyroid
tissues: a comparison study with other iodide transporters
JOURNAL J. Clin. Endocrinol. Metab. 89 (3), 1423-1428 (2004)
PUBMED 15001644
REMARK GeneRIF: In thyroid carcinomas, the mean and median hAIT mRNA
levels were significantly decreased
REFERENCE 10 (bases 1 to 3286)
AUTHORS Li,H., Myeroff,L., Smiraglia,D., Romero,M.F., Pretlow,T.P.,
Kasturi,L., Lutterbaugh,J., Rerko,R.M., Casey,G., Issa,J.P.,
Willis,J., Willson,J.K., Plass,C. and Markowitz,S.D.
TITLE SLC5A8, a sodium transporter, is a tumor suppressor gene silenced
by methylation in human colon aberrant crypt foci and cancers
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 100 (14), 8412-8417 (2003)
PUBMED 12829793
REMARK GeneRIF: SLC5A8 exon 1 methylation is an early event, detectable in
colon adenomas & microscopic aberrant crypt foci. SLC5A8 is a
member of the family of sodium solute symporters, now added to the
candidate colon cancer suppressor genes.
COMMENT VALIDATED REFSEQ: This record has undergone validation or
preliminary review. The reference sequence was derived from
AC079953.28 and BC110492.2.
On Feb 8, 2008 this sequence version replaced gi:33942075.
Summary: SLC5A8 has been shown to transport iodide by a passive
mechanism (Rodriguez et al., 2002 [PubMed 12107270]) and
monocarboxylates and short-chain fatty acids by a sodium-coupled
mechanism (Gopal et al., 2004 [PubMed 15322102]). In kidney, SLC5A8
functions as a high-affinity sodium-coupled lactate transporter
involved in reabsorption of lactate and maintenance of blood
lactate levels (Thangaraju et al., 2006 [PubMed
16873376]).[supplied by OMIM, Dec 2008].
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data because transcript sequence consistent with
the reference genome assembly was not available for all regions of
the RefSeq transcript. The extent of this transcript is supported
by transcript alignments.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: AF536216.1, AY081220.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025082, ERS025084 [ECO:0000350]
##Evidence-Data-END##
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-365 AC079953.28 48062-48426
366-2051 BC110492.2 1-1686
2052-2052 AC079953.28 100003-100003
2053-2670 BC110492.2 1688-2305
2671-3286 AC079953.28 101469-102084
FEATURES Location/Qualifiers
source 1..3286
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="12"
/map="12q23.1"
gene 1..3286
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/note="solute carrier family 5 (iodide transporter),
member 8"
/db_xref="GeneID:160728"
/db_xref="HGNC:19119"
/db_xref="MIM:608044"
exon 1..741
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
misc_feature 313..315
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/note="upstream in-frame stop codon"
CDS 391..2223
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/note="apical iodide transporter; solute carrier family 5
member 8; sodium iodide-related cotransporter;
electrogenic sodium monocarboxylate cotransporter"
/codon_start=1
/product="sodium-coupled monocarboxylate transporter 1"
/protein_id="NP_666018.3"
/db_xref="GI:167466278"
/db_xref="CCDS:CCDS9080.1"
/db_xref="GeneID:160728"
/db_xref="HGNC:19119"
/db_xref="MIM:608044"
/translation="
MDTPRGIGTFVVWDYVVFAGMLVISAAIGIYYAFAGGGQQTSKDFLMGGRRMTAVPVALSLTASFMSAVTVLGTPSEVYRFGAIFSIFAFTYFFVVVISAEVFLPVFYKLGITSTYEYLELRFNKCVRLCGTVLFIVQTILYTGIVIYAPALALNQVTGFDLWGAVVATGVVCTFYCTLGGLKAVIWTDVFQVGIMVAGFASVIIQAVVMQGGISTILNDAYDGGRLNFWNFNPNPLQRHTFWTIIIGGTFTWTSIYGVNQSQVQRYISCKSRFQAKLSLYINLVGLWAILTCSVFCGLALYSRYHDCDPWTAKKVSAPDQLMPYLVLDILQDYPGLPGLFVACAYSGTLSTVSSSINALAAVTVEDLIKPYFRSLSERSLSWISQGMSVVYGALCIGMAALASLMGALLQAALSVFGMVGGPLMGLFALGILVPFANSIGALVGLMAGFAISLWVGIGAQIYPPLPERTLPLHLDIQGCNSTYNETNLMTTTEMPFTTSVFQIYNVQRTPLMDNWYSLSYLYFSTVGTLVTLLVGILVSLSTGGRKQNLDPRYILTKEDFLSNFDIFKKKKHVLSYKSHPVEDGGTDNPAFNHIELNSDQSGKSNGTRL
"
misc_feature 409..1962
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/note="Na(+)/monocarboxylate cotransporter SMCT1 and
related proteins; solute-binding domain; Region:
SLC5sbd_SMCT1; cd11519"
/db_xref="CDD:212088"
misc_feature 418..480
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 544..606
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature order(577..579,586..588,1432..1434,1441..1446)
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/note="Na binding site [ion binding]; other site"
/db_xref="CDD:212088"
misc_feature 640..702
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 787..849
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 874..936
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 958..1020
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 1108..1170
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 1228..1290
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 1399..1467
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 1558..1620
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 1636..1698
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 1708..1770
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
misc_feature 1831..1833
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/note="putative glycosylation site [posttranslational
modification]; other site"
/db_xref="CDD:212088"
misc_feature 1843..1845
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/note="putative glycosylation site [posttranslational
modification]; other site"
/db_xref="CDD:212088"
misc_feature 1945..2007
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="non-experimental evidence, no additional
details recorded"
/note="propagated from UniProtKB/Swiss-Prot (Q8N695.2);
transmembrane region"
exon 742..807
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 808..859
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 860..927
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 928..1082
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 1083..1223
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 1224..1353
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 1354..1442
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 1443..1555
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 1556..1623
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 1624..1710
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 1711..1916
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 1917..2020
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
exon 2021..2100
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
misc_feature 2052
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/note="C/T"
/function="polymorphic site"
variation 2052
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/replace="c"
/replace="t"
/db_xref="dbSNP:2671444"
exon 2101..3286
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/inference="alignment:Splign:1.39.8"
variation 3104
/gene="SLC5A8"
/gene_synonym="AIT; SMCT; SMCT1"
/replace="a"
/replace="g"
/db_xref="dbSNP:2279834"
ORIGIN
gaacaaaacctgcccagagcgctccctgtgtagattcgctggaagcagctggaggctccagttctcatctgctcaggtgtccccggcgccttggcgaactcggccactccagttcctcacgtggtgagcactcagggcagcgggtcgattttccgaggtcccatacctgggtttgaggggcgcggctcgcagcggcgggtgcaggggcgactgccagccctcaccccgcctcggggtgcgttcggaggccgacacctggaggacgcctccagtccccgcgggacgccacgcctgcgcgccagggatccgggataagaagtgcgcgccgggctccggctgcgcgccgcggggccaccagtttgcgcgcagggctcaggcgaccgtgcggccatggacacgccacggggcatcggcaccttcgtggtgtgggactacgtggtgttcgcgggcatgctggtcatctcggccgccatcggcatctactacgccttcgctgggggcggccagcagacctccaaggacttcctgatgggcggccgcagaatgaccgcagtgcccgtggcgctgtccctcaccgctagcttcatgtcagccgtcactgtcctgggcaccccctccgaggtctaccgttttggggccatttttagcatctttgccttcacctacttctttgtggtggtcatcagcgcggaggtcttcctcccggtgttctacaaactgggaattaccagcacctacgagtatttagaacttcgatttaacaaatgtgttcgtctctgtggaacagtcctcttcattgttcaaacaattctgtatactggaattgttatttatgcccctgccctggctttgaatcaagtcacaggatttgatctgtggggcgcggtagtggcaacgggggtggtctgcacattctactgcacactgggtggtcttaaagcagttatctggacagatgtttttcaagttgggatcatggtggctggatttgcatccgtgattatacaggctgtggtgatgcaaggtggaatcagcactattttaaatgatgcctatgatggtggaagattaaatttctggaattttaatcctaaccctttgcaaagacacaccttctggacaattattataggagggaccttcacatggaccagcatctacggtgtcaaccaatcccaggtgcagagatatatttcttgtaaaagcagattccaggcaaaactgtctctctacatcaatcttgtgggactctgggcaatcctcacatgctcagtgttttgtgggctcgccctatattccaggtaccatgactgtgatccttggacagccaagaaagtgtctgcaccagaccagctcatgccttatttggtactggacattctgcaagattatccaggacttcctggactttttgtggcctgtgcttacagtgggacattaagcacagtgtcctccagtattaatgccttagcagcagtaactgtggaagatctaatcaaaccttacttcagatcgctctcagaaaggtctctgtcttggatttcccaaggaatgagtgtggtgtatggagccctgtgtattggaatggctgcgctggcgtcacttatgggagctttgttgcaggcagcactcagcgtatttggtatggttggtggaccacttatgggcctgttcgctttgggcattttggttccctttgccaactcaattggagcacttgttggtctgatggctggatttgccatttctctatgggttggaattggagctcaaatatatcctccacttcctgagagaacattgccattgcaccttgatatccaaggctgtaacagcacctacaatgagacaaatttgatgacaaccacagaaatgccatttactactagtgtttttcaaatatacaatgttcaaaggactccactgatggataactggtattctttatcatatctgtacttcagcactgttggaactttggtaacattattagtggggatacttgtcagtttatcaacaggaggaagaaaacagaacttagaccccagatacatactaaccaaagaggactttttatccaattttgatatttttaagaaaaagaagcatgttttgagctataaatcacatccagtggaagatggtggaactgataatcctgctttcaaccacattgaattgaactcagatcagagtggcaagagcaatgggactcgtttgtgaagctgctctgatactagatatccttaaatgatgtttcaattttatatgttttctaagataattggatcaggttttctttgtgtgtgtgtgtgtgttgtatcatgagtgtttgggggataagtttttgttaaaacaaagtctggactatcttcatttactacatcattaattgatgttactctggagtttagaattctggcattgacatttccctctctttcctttatttcgatgaagctataattgtgaaaattgtaactacatagatgctgaaaggctaatacacacatatgcacatgtatttgattgtcaaaggtatattcttaaatttgggtattattgaaaatattttccatgccttggtgctagcatataagtttggaagtttgccaacatcacaattcatcttgaaaagagcttttttccctcctaccacatacaccattcttagggagcaatgaggtaacaggtctgtgttgtctagatctttgctttttatccccctatcagtccagggcatatactaacctgcaaactgattctgaatcaggaaggtggtaatcaataagtattctggctgggaaagaccgtgggcccaatgatcaaagtcttcttggtgctgttcattaattcttgtgccttttggcttgttttctagagtttctgggctttggctgctgatactgcctttcttagactgtaatttttatctgcatgcccagtttctgacctatcaacttgggttttattgtgcactctaactgagcttgtcttcataattttctgtttattgccctgggcttggatatgtctcaagacactcatgtgaatcatgccaccccaaatcctggcttatcaagtcccagactataaattatgaactcccattagcttggtactaacatatacttgatgtaggtatttatggacttgatgatccaagaatattatattcttcaaaatggttaagctccatggagttagatgactacacttaatgctattaagttgaacttttgaatgtcaactaatttgcaatcaattaaagatacatatgcctaga
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:160728 -> Molecular function: GO:0015293 [symporter activity] evidence: IEA
GeneID:160728 -> Biological process: GO:0006811 [ion transport] evidence: TAS
GeneID:160728 -> Biological process: GO:0006814 [sodium ion transport] evidence: IEA
GeneID:160728 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA
GeneID:160728 -> Biological process: GO:0055085 [transmembrane transport] evidence: TAS
GeneID:160728 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
GeneID:160728 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA
GeneID:160728 -> Cellular component: GO:0016324 [apical plasma membrane] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.