GGRNA Home | Help | Advanced search

2020-10-24 06:54:24, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_145027               3972 bp    mRNA    linear   PRI 15-JUN-2013
DEFINITION  Homo sapiens kinesin family member 6 (KIF6), mRNA.
ACCESSION   NM_145027
VERSION     NM_145027.4  GI:157502183
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3972)
  AUTHORS   Liu,X., Gomez-Pinillos,A., Loder,C., Carrillo-de Santa Pau,E.,
            Qiao,R., Unger,P.D., Kurek,R., Oddoux,C., Melamed,J.,
            Gallagher,R.E., Mandeli,J. and Ferrari,A.C.
  TITLE     KLF6 loss of function in human prostate cancer progression is
            implicated in resistance to androgen deprivation
  JOURNAL   Am. J. Pathol. 181 (3), 1007-1016 (2012)
   PUBMED   22819534
  REMARK    GeneRIF: These data suggest that decreased availability of
            functional KLF6 contributes to clinical prostate cancer
            progression.
REFERENCE   2  (bases 1 to 3972)
  AUTHORS   Ovsyannikova,I.G., Kennedy,R.B., O'Byrne,M., Jacobson,R.M.,
            Pankratz,V.S. and Poland,G.A.
  TITLE     Genome-wide association study of antibody response to smallpox
            vaccine
  JOURNAL   Vaccine 30 (28), 4182-4189 (2012)
   PUBMED   22542470
REFERENCE   3  (bases 1 to 3972)
  AUTHORS   Comuzzie,A.G., Cole,S.A., Laston,S.L., Voruganti,V.S., Haack,K.,
            Gibbs,R.A. and Butte,N.F.
  TITLE     Novel genetic loci identified for the pathophysiology of childhood
            obesity in the Hispanic population
  JOURNAL   PLoS ONE 7 (12), E51954 (2012)
   PUBMED   23251661
REFERENCE   4  (bases 1 to 3972)
  AUTHORS   Peng,P., Lian,J., Huang,R.S., Xu,L., Huang,Y., Ba,Y., Yang,X.,
            Huang,X., Dong,C., Zhang,L., Ye,M., Zhou,J. and Duan,S.
  TITLE     Meta-analyses of KIF6 Trp719Arg in coronary heart disease and
            statin therapeutic effect
  JOURNAL   PLoS ONE 7 (12), E50126 (2012)
   PUBMED   23236363
  REMARK    GeneRIF: Our case-control study suggests that Trp719Arg of KIF6
            gene is associated with coronary heart disease in female Han
            Chinese through a post hoc analysis.
REFERENCE   5  (bases 1 to 3972)
  AUTHORS   Wu,G., Li,G.B. and Dai,B.
  TITLE     Association of KIF6 variant with lipid level and angiographic
            coronary artery disease events risk in the Han Chinese population
  JOURNAL   Molecules 17 (9), 11269-11280 (2012)
   PUBMED   23001387
  REMARK    GeneRIF: KIF6 719Arg allele was not an independent risk factor for
            angiographic coronary artery disease(CAD)susceptibility in northern
            China Han populations; it was associated with a significantly
            higher TG level, which may indicate increased myocardial infarction
            risk in angiographic CAD patients
            Publication Status: Online-Only
REFERENCE   6  (bases 1 to 3972)
  AUTHORS   Shiffman,D., Chasman,D.I., Zee,R.Y., Iakoubova,O.A., Louie,J.Z.,
            Devlin,J.J. and Ridker,P.M.
  TITLE     A kinesin family member 6 variant is associated with coronary heart
            disease in the Women's Health Study
  JOURNAL   J. Am. Coll. Cardiol. 51 (4), 444-448 (2008)
   PUBMED   18222354
  REMARK    GeneRIF: Confirming and extending previous reports, carriers of the
            719Arg allele of KIF6 have 34% higher risk of myocardial infarction
            and 24% higher risk of CHD compared with noncarriers among 25,283
            women from the WHS.
            GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
            Erratum:[J Am Coll Cardiol. 2008 Mar 4;51(9):977]
REFERENCE   7  (bases 1 to 3972)
  AUTHORS   Iakoubova,O.A., Tong,C.H., Rowland,C.M., Kirchgessner,T.G.,
            Young,B.A., Arellano,A.R., Shiffman,D., Sabatine,M.S., Campos,H.,
            Packard,C.J., Pfeffer,M.A., White,T.J., Braunwald,E., Shepherd,J.,
            Devlin,J.J. and Sacks,F.M.
  TITLE     Association of the Trp719Arg polymorphism in kinesin-like protein 6
            with myocardial infarction and coronary heart disease in 2
            prospective trials: the CARE and WOSCOPS trials
  JOURNAL   J. Am. Coll. Cardiol. 51 (4), 435-443 (2008)
   PUBMED   18222353
  REMARK    GeneRIF: In both the CARE and the WOSCOPS trials, carriers of the
            KIF6 719Arg allele had an increased risk of coronary events, and
            pravastatin treatment substantially reduced that risk.
            GeneRIF: Observational study of gene-disease association and
            gene-environment interaction. (HuGE Navigator)
REFERENCE   8  (bases 1 to 3972)
  AUTHORS   Shiffman,D., O'Meara,E.S., Bare,L.A., Rowland,C.M., Louie,J.Z.,
            Arellano,A.R., Lumley,T., Rice,K., Iakoubova,O., Luke,M.M.,
            Young,B.A., Malloy,M.J., Kane,J.P., Ellis,S.G., Tracy,R.P.,
            Devlin,J.J. and Psaty,B.M.
  TITLE     Association of gene variants with incident myocardial infarction in
            the Cardiovascular Health Study
  JOURNAL   Arterioscler. Thromb. Vasc. Biol. 28 (1), 173-179 (2008)
   PUBMED   17975119
  REMARK    GeneRIF: Observational study of gene-disease association. (HuGE
            Navigator)
REFERENCE   9  (bases 1 to 3972)
  AUTHORS   Bare,L.A., Morrison,A.C., Rowland,C.M., Shiffman,D., Luke,M.M.,
            Iakoubova,O.A., Kane,J.P., Malloy,M.J., Ellis,S.G., Pankow,J.S.,
            Willerson,J.T., Devlin,J.J. and Boerwinkle,E.
  TITLE     Five common gene variants identify elevated genetic risk for
            coronary heart disease
  JOURNAL   Genet. Med. 9 (10), 682-689 (2007)
   PUBMED   18073581
  REMARK    GeneRIF: Observational study of gene-disease association and
            gene-gene interaction. (HuGE Navigator)
REFERENCE   10 (bases 1 to 3972)
  AUTHORS   Mungall,A.J., Palmer,S.A., Sims,S.K., Edwards,C.A., Ashurst,J.L.,
            Wilming,L., Jones,M.C., Horton,R., Hunt,S.E., Scott,C.E.,
            Gilbert,J.G., Clamp,M.E., Bethel,G., Milne,S., Ainscough,R.,
            Almeida,J.P., Ambrose,K.D., Andrews,T.D., Ashwell,R.I.,
            Babbage,A.K., Bagguley,C.L., Bailey,J., Banerjee,R., Barker,D.J.,
            Barlow,K.F., Bates,K., Beare,D.M., Beasley,H., Beasley,O.,
            Bird,C.P., Blakey,S., Bray-Allen,S., Brook,J., Brown,A.J.,
            Brown,J.Y., Burford,D.C., Burrill,W., Burton,J., Carder,C.,
            Carter,N.P., Chapman,J.C., Clark,S.Y., Clark,G., Clee,C.M.,
            Clegg,S., Cobley,V., Collier,R.E., Collins,J.E., Colman,L.K.,
            Corby,N.R., Coville,G.J., Culley,K.M., Dhami,P., Davies,J.,
            Dunn,M., Earthrowl,M.E., Ellington,A.E., Evans,K.A., Faulkner,L.,
            Francis,M.D., Frankish,A., Frankland,J., French,L., Garner,P.,
            Garnett,J., Ghori,M.J., Gilby,L.M., Gillson,C.J., Glithero,R.J.,
            Grafham,D.V., Grant,M., Gribble,S., Griffiths,C., Griffiths,M.,
            Hall,R., Halls,K.S., Hammond,S., Harley,J.L., Hart,E.A.,
            Heath,P.D., Heathcott,R., Holmes,S.J., Howden,P.J., Howe,K.L.,
            Howell,G.R., Huckle,E., Humphray,S.J., Humphries,M.D., Hunt,A.R.,
            Johnson,C.M., Joy,A.A., Kay,M., Keenan,S.J., Kimberley,A.M.,
            King,A., Laird,G.K., Langford,C., Lawlor,S., Leongamornlert,D.A.,
            Leversha,M., Lloyd,C.R., Lloyd,D.M., Loveland,J.E., Lovell,J.,
            Martin,S., Mashreghi-Mohammadi,M., Maslen,G.L., Matthews,L.,
            McCann,O.T., McLaren,S.J., McLay,K., McMurray,A., Moore,M.J.,
            Mullikin,J.C., Niblett,D., Nickerson,T., Novik,K.L., Oliver,K.,
            Overton-Larty,E.K., Parker,A., Patel,R., Pearce,A.V., Peck,A.I.,
            Phillimore,B., Phillips,S., Plumb,R.W., Porter,K.M., Ramsey,Y.,
            Ranby,S.A., Rice,C.M., Ross,M.T., Searle,S.M., Sehra,H.K.,
            Sheridan,E., Skuce,C.D., Smith,S., Smith,M., Spraggon,L.,
            Squares,S.L., Steward,C.A., Sycamore,N., Tamlyn-Hall,G., Tester,J.,
            Theaker,A.J., Thomas,D.W., Thorpe,A., Tracey,A., Tromans,A.,
            Tubby,B., Wall,M., Wallis,J.M., West,A.P., White,S.S.,
            Whitehead,S.L., Whittaker,H., Wild,A., Willey,D.J., Wilmer,T.E.,
            Wood,J.M., Wray,P.W., Wyatt,J.C., Young,L., Younger,R.M.,
            Bentley,D.R., Coulson,A., Durbin,R., Hubbard,T., Sulston,J.E.,
            Dunham,I., Rogers,J. and Beck,S.
  TITLE     The DNA sequence and analysis of human chromosome 6
  JOURNAL   Nature 425 (6960), 805-811 (2003)
   PUBMED   14574404
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AK131471.1, BX649045.1, AL832634.2, AL136087.12 and AK123217.1.
            On Sep 25, 2007 this sequence version replaced gi:47271465.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK131471.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025085 [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-1621              AK131471.1         1-1621
            1622-2250           BX649045.1         1202-1830
            2251-3108           AL832634.2         487-1344
            3109-3450           AL136087.12        88482-88823         c
            3451-3972           AK123217.1         1848-2369
FEATURES             Location/Qualifiers
     source          1..3972
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="6"
                     /map="6p21.2"
     gene            1..3972
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /note="kinesin family member 6"
                     /db_xref="GeneID:221458"
                     /db_xref="HGNC:21202"
                     /db_xref="MIM:613919"
     exon            1..161
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    6..8
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /note="upstream in-frame stop codon"
     CDS             96..2540
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /codon_start=1
                     /product="kinesin-like protein KIF6"
                     /protein_id="NP_659464.3"
                     /db_xref="GI:157502184"
                     /db_xref="CCDS:CCDS4844.1"
                     /db_xref="GeneID:221458"
                     /db_xref="HGNC:21202"
                     /db_xref="MIM:613919"
                     /translation="
MVKQTIQIFARVKPPVRKHQQGIYSIDEDEKLIPSLEIILPRDLADGFVNNKRESYKFKFQRIFDQDANQETVFENIAKPVAGSVLAGYNGTIFAYGQTGSGKTFTITGGAERYSDRGIIPRTLSYIFEQLQKDSSKIYTTHISYLEIYNECGYDLLDPRHEASSLEDLPKVTILEDPDQNIHLKNLTLHQATTEEEALNLLFLGDTNRMIAETPMNQASTRSHCIFTIHLSSKEPGSATVRHAKLHLVDLAGSERVAKTGVGGHLLTEAKYINLSLHYLEQVIIALSEKHRSHIPYRNSMMTSVLRDSLGGNCMTTMIATLSLEKRNLDESISTCRFAQRVALIKNEAVLNEEINPRLVIKRLQKEIQELKDELAMVTGEQRTEALTEAELLQLEKLITSFLEDQDSDSRLEVGADMRKVHHCFHHLKKLLNDKKILENNTVSSESKDQDCQEPLKEEEYRKLRDILKQRDNEINILVNMLKKEKKKAQEALHLAGMDRREFRQSQSPPFRLGNPEEGQRMRLSSAPSQAQDFSILGKRSSLLHKKIGMREEMSLGCQEAFEIFKRDHADSVTIDDNKQILKQRFSEAKALGESINEARSKIGHLKEEITQRHIQQVALGISENMAVPLMPDQQEEKLRSQLEEEKRRYKTMFTRLKALKVEIEHLQLLMDKAKVKLQKEFEVWWAEEATNLQVNSPAVNSLDHTKPFLQTSDSQHEWSQLLSNKSSGGWEVQDQGTGRFDVCDVNARKILPSPCPSPHSQKQSSTSTPLEDSIPKRPVSSIPLTGDSQTDSDIIAFIKARQSILQKQCLGSN
"
     misc_feature    108..1124
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /note="Kinesin motor domain, KIF9-like subgroup; might
                     play a role in cell shape remodeling. This catalytic
                     (head) domain has ATPase activity and belongs to the
                     larger group of P-loop NTPases. Kinesins are
                     microtubule-dependent molecular motors that play...;
                     Region: KISc_KIF9_like; cd01375"
                     /db_xref="CDD:30097"
     misc_feature    111..1151
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /note="Kinesin motor, catalytic domain. ATPase; Region:
                     KISc; smart00129"
                     /db_xref="CDD:197527"
     misc_feature    order(132..134,384..386,393..395,399..410,843..845)
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:30097"
     misc_feature    order(987..989,996..998,1005..1007)
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /note="microtubule interaction site [polypeptide binding];
                     other site"
                     /db_xref="CDD:30097"
     exon            162..271
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            272..346
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            347..494
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            495..604
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            605..734
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            735..941
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            942..1085
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1086..1172
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1173..1276
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1277..1382
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1383..1521
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1522..1740
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     variation       1630
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2273063"
     exon            1741..1849
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1850..1905
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1906..1956
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            1957..2041
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            2042..2177
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            2178..2275
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     variation       2250
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:20455"
     exon            2276..2326
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            2327..2416
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            2417..2523
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
     exon            2524..3972
                     /gene="KIF6"
                     /gene_synonym="C6orf102; dJ1043E3.1; dJ137F1.4; dJ188D3.1"
                     /inference="alignment:Splign:1.39.8"
ORIGIN      
gttgctaagactgtgggtcgccggaggtggtgggagttagttttggcagcccgggcctgagagaggtcaagggtcattgcagagccagggaggagatggtgaagcagactatccagatattcgcgagggtgaagccccctgtccggaagcaccaacaagggatttattccatagatgaagatgaaaaattaatacctagcttggaaatcatcttaccacgtgatttggcagatgggtttgtgaataataagcgagaaagctacaaatttaaatttcaaagaatttttgatcaggatgcaaaccaagagaccgtttttgaaaacattgccaaaccagttgctgggagtgtcctggcaggttacaatggtaccatctttgcatatgggcaaacaggcagcgggaagacattcactatcacagggggtgcagagcgttacagtgacagaggcattatcccaaggacactgtcatacatttttgaacagttacaaaaggacagcagcaaaatatatacaacacacatttcctatttggaaatctacaatgaatgtggttatgatcttttggatccaagacatgaagcctccagtttggaagatttgccgaaagtgacaatactggaggatcctgatcagaacattcacctgaaaaacttgactctccatcaggcaaccacagaggaagaagctctgaatttgctttttttaggagacaccaaccgaatgattgcagagactcctatgaaccaagcttcaacccgttcccactgcattttcaccattcatttgtcaagcaaggaaccaggatctgcaactgtacgacatgccaaactccatctggttgacctggctggttcagagcgagttgcaaagactggagtagggggccatcttctaacagaggccaagtatatcaacttgtcactacattacttagaacaggttatcattgccctttcagaaaagcaccgttcgcacattccttatagaaactccatgatgaccagtgtcctaagagacagtttgggagggaactgcatgacaactatgattgcaacactctccttggagaaaaggaatcttgatgagtctatatcaacctgcagatttgcacagcgagtggcactcataaagaatgaagctgttcttaatgaagaaattaaccccagattagtgattaaacgcctacaaaaggaaatccaggaactgaaggatgaactggccatggtcactggggagcagaggacagaggcactcacagaagcagagctccttcagctggaaaaactaataacatcctttttggaagaccaggattcagacagtagattagaggttggcgcggatatgcgtaaagttcatcactgttttcatcatttaaagaaactattgaatgacaagaagatccttgaaaacaatacagtctcctctgaaagcaaagaccaagattgtcaagaaccattaaaagaagaagaatatagaaagctacgagatattctgaaacagagagataacgaaatcaatatcctggtcaacatgttaaaaaaagaaaagaagaaagctcaggaggctctccacttggctggcatggatagacgtgaattcagacagtcccagagcccacccttccgcctaggaaacccagaagaaggtcaaagaatgcgactatcctcagctccctcacaggcccaggacttcagcattttggggaaaagatccagtttgctccacaagaaaataggaatgagagaggaaatgtcattaggatgccaggaggcttttgaaatcttcaagagggaccacgctgacagcgttaccatcgatgacaacaaacagattctgaaacagagattttctgaagccaaggccctgggagaaagtataaatgaagcaagaagtaaaattggtcacctgaaggaagaaatcacccagcggcatatacagcaagtagccctaggaatctcggaaaacatggccgtgcctctgatgccagaccagcaggaggagaagctgcgatcacaactggaggaagaaaagagaaggtataaaacaatgttcactcgcctgaaagccctgaaggtggagatcgagcacttgcagctgctcatggacaaagccaaggtgaagctacagaaagagtttgaagtctggtgggcagaggaggccaccaacctgcaggtaaattctccagcagtgaattcactcgatcacacgaagccatttctccagacatctgactcccagcatgaatggtcccaactcctctctaacaaaagttctggaggctgggaagtccaagatcaaggcactggcagattcgatgtctgtgatgtgaatgccaggaaaatcctgccctcgccttgccccagtccacacagccagaaacagagcagcaccagcaccccactggaagacagcatccccaagaggccagtgtcgtccatccctctcaccggagacagccagacggactcggacatcatcgccttcatcaaggccagacagagcattctgcagaagcaatgtttgggaagcaattgaatttccaggaaatatccatccatgaattatgccagcaagaatgaagcacagatgaaggcagcgcccctcacttgctctggcttcagaagtgaactatgggctgctgggagcaactagtgactttgattcccatggaggggactgtgtttctttaaggatgctgacctggaggccaccgagaggctggggctggggctgaccacaacatccttcctgtggttgctggagctgctggcagggccaggcaaggccagagtgctaggggcagggtgaaggcttcagctcactgttgtagtgacgttttgtgtagatctttataagcttttgagaatgtgaaatagcaccatcaaaatataatgtcagaggatgctcacaccagtggaatgtggggggaatatttttatttttaacgatttgccagctctctcccttggcccgtgctctggtttggaagcccagaaatggccatgacaggtccaggcaggatgtcccagccacaggcaaggcagtggaatgcagggcatcctgaaggccaatcctgatctcccagaccacatctttcaccatcagcctcttggccaggatgacctggaggcagtgcctgaacagctgtgtctccagggagccatctgccctgcagggtctaaggacatcatagcacccagagaacagtgggcagctcccaggggctctgctgagagcttgagagagggcagtgtgggtaccttgggcctcacaaccttcacccagccacttgggaggatttgggctgacactccccacttccacagggaaaaacatagctgcctgggggtcttgtctccatgggccctctccatgacagatccaagggaaggtgggcagccctcaaggaggttcttgaagaactgccccctgggccagggggttccaacccagctgcagccagggaggggcagcggagggtgagcaggagtggcacctggaaatgaagctaactggataaaagtgctggtccactgctcctggtgtctctgtcctataaatacaggacctgatgaccctggaggggagcagagtggtaatatagtataattggcttgattttctttttcgttttttaggactgggtaacaggatcatgcaggagaagattaaaccattacatttctaagctaggcaggcccatcgagctcctctaatccacacccctattttatataattagaaggccagagtgaaggggagattcagcttgctgttctatgccactgacaaatgtcccctcttcagggggcttcccctgaccactccatctcgagtcaccccctagttatcccctatcccattaccattttttctgcatcactatctgacatgttatccttccgaacttgcctatttttgaaatacctgcaaccccccataatactaagagctccaatgcaacagg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:221458 -> Molecular function: GO:0003777 [microtubule motor activity] evidence: IEA
            GeneID:221458 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:221458 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:221458 -> Molecular function: GO:0008017 [microtubule binding] evidence: IEA
            GeneID:221458 -> Biological process: GO:0007018 [microtubule-based movement] evidence: IEA
            GeneID:221458 -> Cellular component: GO:0005737 [cytoplasm] evidence: IEA
            GeneID:221458 -> Cellular component: GO:0005871 [kinesin complex] evidence: IEA
            GeneID:221458 -> Cellular component: GO:0005874 [microtubule] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.