GGRNA Home | Help | Advanced search

2019-03-25 15:21:42, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_144982               7158 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens zinc finger, C3H1-type containing (ZFC3H1), mRNA.
ACCESSION   NM_144982 XM_352900
VERSION     NM_144982.4  GI:87116682
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 7158)
  AUTHORS   Barbe,L., Lundberg,E., Oksvold,P., Stenius,A., Lewin,E.,
            Bjorling,E., Asplund,A., Ponten,F., Brismar,H., Uhlen,M. and
            Andersson-Svahn,H.
  TITLE     Toward a confocal subcellular atlas of the human proteome
  JOURNAL   Mol. Cell Proteomics 7 (3), 499-508 (2008)
   PUBMED   18029348
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AI015547.1, BX647709.1, BC064336.1 and AK125035.1.
            On Feb 10, 2006 this sequence version replaced gi:34787414.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BX647709.1 [ECO:0000332]
            RNAseq introns              :: mixed/partial sample support
                                           ERS025081, ERS025082 [ECO:0000350]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-121               AI015547.1         1-121
            122-1441            BX647709.1         2-1321
            1442-1544           BC064336.1         1323-1425
            1545-2989           BX647709.1         1425-2869
            2990-6635           AK125035.1         444-4089
            6636-7158           BX647709.1         6516-7038
FEATURES             Location/Qualifiers
     source          1..7158
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="12"
                     /map="12q21.1"
     gene            1..7158
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="zinc finger, C3H1-type containing"
                     /db_xref="GeneID:196441"
                     /db_xref="HGNC:28328"
     exon            1..957
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     STS             327..595
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /standard_name="AF021117"
                     /db_xref="UniSTS:53189"
     misc_feature    330..332
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="upstream in-frame stop codon"
     CDS             360..6329
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="proline/serine-rich coiled-coil 2; coiled-coil
                     domain containing 131; coiled-coil domain-containing
                     protein 131; proline/serine-rich coiled-coil protein 2"
                     /codon_start=1
                     /product="zinc finger C3H1 domain-containing protein"
                     /protein_id="NP_659419.3"
                     /db_xref="GI:87116683"
                     /db_xref="CCDS:CCDS41813.1"
                     /db_xref="GeneID:196441"
                     /db_xref="HGNC:28328"
                     /translation="
MATADTPAPASSGLSPKEEGELEDGEISDDDNNSQIRSRSSSSSSGGGLLPYPRRRPPHSARGGGSGGGGGSSSSSSSSQQQLRNFSRSRHASERGHLRGPSSYRPKEPFRSHPPSVRMPSSSLSESSPRPSFWERSHLALDRFRFRGRPYRGGSRWSRGRGVGERGGKPGCRPPLGGGAGSGFSSSQSWREPSPPRKSSKSFGRSPSRKQNYSSKNENCVEETFEDLLLKYKQIQLELECINKDEKLALSSKEENVQEDPKTLNFEDQTSTDNVSITKDSSKEVAPEEKTQVKTFQAFELKPLRQKLTLPGDKNRLKKVKDGAKPLSLKSDTTDSSQGLQDKEQNLTRRISTSDILSEKKLGEDEEELSELQLRLLALQSASKKWQQKEQQVMKESKEKLTKTKTVQQKVKTSTKTHSAKKVSTTAKQALRKQQTKAWKKLQQQKEQERQKEEDQRKQAEEEERRKREEEIRKIRDLSNQEEQYNRFMKLVGGKRRSRSKSSDPDLRRSLDKQPTDSGGGIYQYDNYEEVAMDTDSETSSPAPSPVQPPFFSECSLGYFSPAPSLSLPPPPQVSSLPPLSQPYVEGLCVSLEPLPPLPPLPPLPPEDPEQPPKPPFADEEEEEEMLLREELLKSLANKRAFKPEETSSNSDPPSPPVLNNSHPVPRSNLSIVSINTVSQPRIQNPKFHRGPRLPRTVISLPKHKSVVVTLNDSDDSESDGEASKSTNSVFGGLESMIKEARRTAEQASKPKVPPKSEKENDPLRTPEALPEEKKIEYRLLKEEIANREKQRLIKSDQLKTSSSSPANSDVEIDGIGRIAMVTKQVTDAESKLKKHRILLMKDESVLKNLVQQEAKKKESVRNAEAKITKLTEQLQATEKILNVNRMFLKKLQEQIHRVQQRVTIKKALTLKYGEELARAKAVASKEIGKRKLEQDRFGPNKMMRLDSSPVSSPRKHSAELIAMEKRRLQKLEYEYALKIQKLKEARALKAKEQQNISPVVEEEPEFSLPQPSLHDLTQDKLTLDTEENDVDDEILSGSSRERRRSFLESNYFTKPNLKHTDTANKECINKLNKNTVEKPELFLGLKIGELQKLYSKADSLKQLILKTTTGITEKVLHGQEISVDVDFVTAQSKTMEVKPCPFRPYHSPLLVFKSYRFSPYYRTKEKLPLSSVSYSNMIEPDQCFCRFDLTGTCNDDDCQWQHIQDYTLSRKQLFQDILSYNLSLIGCAETSTNEEITASAEKYVEKLFGVNKDRMSMDQMAVLLVSNINESKGHTPPFTTYKDKRKWKPKFWRKPISDNSFSSDEEQSTGPIKYAFQPENQINVPALDTVVTPDDVRYFTNETDDIANLEASVLENPSHVQLWLKLAYKYLNQNEGECSESLDSALNVLARALENNKDNPEIWCHYLRLFSKRGTKDEVQEMCETAVEYAPDYQSFWTFLHLESTFEEKDYVCERMLEFLMGAAKQETSNILSFQLLEALLFRVQLHIFTGRCQSALAILQNALKSANDGIVAEYLKTSDRCLAWLAYIHLIEFNILPSKFYDPSNDNPSRIVNTESFVMPWQAVQDVKTNPDMLLAVFEDAVKACTDESLAVEERIEACLPLYTNMIALHQLLERYEAAMELCKSLLESCPINCQLLEALVALYLQTNQHDKARAVWLTAFEKNPQNAEVFYHMCKFFILQNRGDNLLPFLRKFIASFFKPGFEKYNNLDLFRYLLNIPGPIDIPSRLCKGNFDDDMFNHQVPYLWLIYCLCHPLQSSIKETVEAYEAALGVAMRCDIVQKIWMDYLVFANNRAAGSRNKVQEFKFFTDLVNRCLVTVPARYPIPFSSADYWSNYEFHNRVIFFYLSCVPKTQHSKTLERFCSVMPANSGLALRLLQHEWEESNVQILKLQAKMFTYNIPTCLATWKIAIAAEIVLKGQREVHRLYQRALQKLPLCASLWKDQLLFEASEGGKTDNLRKLVSKCQEIGVSLNELLNLNSNKTESKNH
"
     misc_feature    363..365
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="N-acetylalanine; propagated from
                     UniProtKB/Swiss-Prot (O60293.3); acetylation site"
     misc_feature    402..404
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    441..443
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    441..443
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    459..461
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    459..461
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1413..1415
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    2499..2501
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    2508..2510
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    2514..2516
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    2784..2786
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    3204..3206
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    3204..3206
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3216..3218
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    3216..3218
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3351..3353
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    3351..3353
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    3495..3497
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    3909..3974
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="Putative zinc-finger domain; Region: zf-C3H1;
                     pfam10650"
                     /db_xref="CDD:192649"
     misc_feature    4266..4268
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    4269..4271
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (O60293.3); phosphorylation site"
     misc_feature    4440..4559
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: TPR 1"
     misc_feature    4443..>4682
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="Tetratricopeptide repeat domain; typically contains
                     34 amino acids
                     [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]-
                     X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in
                     a variety of organisms including bacteria, cyanobacteria,
                     yeast, fungi; Region: TPR; cd00189"
                     /db_xref="CDD:29151"
     misc_feature    order(4443..4448,4452..4457,4464..4469,4572..4577,
                     4581..4586,4593..4598,4674..4679)
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="binding surface"
                     /db_xref="CDD:29151"
     misc_feature    4443..4655
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="TPR repeat; Region: TPR_11; pfam13414"
                     /db_xref="CDD:205592"
     misc_feature    order(4461..4463,4515..4517,4527..4529,4536..4538,
                     4581..4583,4617..4619,4629..4631,4638..4640)
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="TPR motif; other site"
                     /db_xref="CDD:29151"
     misc_feature    4500..4598
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: HAT 1"
     misc_feature    4560..4661
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: TPR 2"
     misc_feature    4602..4697
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: HAT 2"
     misc_feature    4866..4964
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: HAT 3"
     misc_feature    5163..5264
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: TPR 3"
     misc_feature    5169..5453
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="Tetratricopeptide repeat domain; typically contains
                     34 amino acids
                     [WLF]-X(2)-[LIM]-[GAS]-X(2)-[YLF]-X(8)-[ASE]-X(3)-[FYL]-
                     X(2)-[ASL]-X(4)-[PKE] is the consensus sequence; found in
                     a variety of organisms including bacteria, cyanobacteria,
                     yeast, fungi; Region: TPR; cd00189"
                     /db_xref="CDD:29151"
     misc_feature    order(5169..5171,5175..5180,5187..5192,5277..5282,
                     5286..5291,5298..5303,5379..5384,5391..5396,5403..5408)
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="binding surface"
                     /db_xref="CDD:29151"
     misc_feature    order(5184..5186,5220..5222,5232..5234,5241..5243,
                     5286..5288,5322..5324,5334..5336,5343..5345,5388..5390,
                     5424..5426,5436..5438,5445..5447)
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /note="TPR motif; other site"
                     /db_xref="CDD:29151"
     misc_feature    5265..5366
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: TPR 4"
     misc_feature    5592..5693
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: TPR 5"
     misc_feature    5634..5741
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: HAT 4"
     misc_feature    5769..5888
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: HAT 5"
     misc_feature    6114..6212
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O60293.3);
                     Region: HAT 6"
     exon            958..1374
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            1375..1439
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            1440..1638
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            1639..1862
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            1863..1986
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            1987..2084
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            2085..2294
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            2295..2459
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            2460..2597
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            2598..2719
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            2720..2869
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            2870..3044
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            3045..3176
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            3177..3719
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     variation       3375
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1011332"
     exon            3720..3829
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            3830..3961
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            3962..4083
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            4084..4185
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            4186..4305
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            4306..4489
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            4490..4676
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            4677..4865
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            4866..5103
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            5104..5209
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            5210..5408
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     variation       5387
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369134705"
     exon            5409..5503
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            5504..5614
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            5615..5719
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            5720..5885
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     variation       5727
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199852445"
     variation       5779
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:11541286"
     exon            5886..5986
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            5987..6088
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            6089..6128
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            6129..6191
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     exon            6192..7158
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /inference="alignment:Splign:1.39.8"
     variation       6771
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17109964"
     variation       6853
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17109960"
     variation       6900
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17109956"
     polyA_site      7153
                     /gene="ZFC3H1"
                     /gene_synonym="CCDC131; PSRC2"
ORIGIN      
tcctagtgagtatcgagttggtcttattatcgcgtgaactgggagcctttgtttcctgcgtgtcgcaggaagtgacgtttcgggtacagccgctaccagagtccctttctcgcgaggcggaagaaccccgatcgctgaggagcaagggggcgctaggaaagggaactgggttgcgacggtccggcgagagagagctggggtgctggggtgcggggaagttggggagcagaggccgcttggtgtccgagtagggtaagaccgcaccgacccagtccgttaggaaagaagggaaacgaggcaattgtcgggcggatccccggacggagggctaaggttgtgtggaaggcgctgctccccggatggcgaccgcagatactccggccccggcctccagtggcctctcgccgaaggaagaaggggagcttgaagatggggaaatcagtgacgacgataataacagccagatacggagtcggagcagcagcagcagcagcggcggcgggctgttaccctatccgcggcgaaggcctcctcactcggcccggggcggtggatctggcggaggcggtggctcttcctcgtcatcgtcctcttctcagcagcagctgaggaatttctcacgctcgcggcacgcgtctgagcggggccacctcaggggacccagcagctaccgacccaaagaaccgttccggtctcatccgccttctgtacggatgccttcgagctcactgtccgaaagcagtccccggccgtctttctgggagcggagccacctcgccttggaccgtttccgctttcgaggcaggccttaccggggtgggagtcgctggagtcgggggcgaggagtgggtgagcgaggaggcaagccggggtgcagacctcctctgggaggaggagcaggatccgggttcagcagcagtcagagctggcgagagccctctccacctcggaagagctccaaaagttttggaaggtctccatcaagaaaacaaaattattcatcaaaaaatgaaaactgtgtggaagaaacttttgaagatttgcttttaaagtataaacaaatacagttggaactagaatgcatcaataaggatgaaaaactagcattgagtagcaaagaagagaatgtgcaggaagatcctaaaacattgaacttcgaggaccaaactagcactgataatgtcagtattacaaaggattcaagtaaagaagtagctcctgaggagaaaacacaagtcaaaacttttcaggcatttgaattaaaaccactcaggcaaaaattgactttaccaggagataagaaccgtttgaaaaaagttaaagatggagcaaaaccactttccctgaaatccgacactactgattctagtcaaggattacaagataaagaacaaaatttaacaagaagaattagtacctcagatattctgtctgaaaagaaacttggtgaagatgaagaggaactatctgaattacagcttcgccttttggctcttcagtcagccagtaaaaaatggcaacaaaaagaacagcaggtgatgaaagaaagcaaagaaaagttgactaagacgaaaactgtacagcaaaaagttaaaacaagtacaaaaacacattcggccaaaaaagttagcactacagctaaacaagcattgaggaagcagcaaacaaaggcatggaagaaactacaacaacaaaaagagcaggaaagacagaaagaagaggatcagcggaaacaagctgaagaagaagagagaaggaaaagagaggaagaaatcagaaaaattcgagatctctcaaatcaggaagaacagtacaatcgattcatgaaattggttggtggcaagaggagatcaagaagtaaatcttcagatcctgacctgaggcgatccttagataagcaacctactgatagtggaggaggcatttatcagtatgataactatgaagaagttgctatggatacagatagtgaaaccagttctccagctccttcaccagtgcaaccgccatttttctctgaatgttcattggggtatttttctccagcaccatctctttctttgcctccaccacctcaggtttcttctctgccacctttgagccagccttatgtggaaggcttgtgtgtttctcttgaacctctacctcctctaccaccattaccacctctcccacctgaagatccagaacagcctccaaaaccaccttttgcagatgaggaagaggaggaagaaatgctgcttcgagaagaactacttaaatctctagcaaataaaagagcttttaagccagaggaaacatccagtaatagtgacccaccttcacctccagttctgaacaattcacatcctgtgccaagaagcaatctatcaatagtcagtattaacacagtgtctcagcctaggatacagaatccaaagtttcacagaggaccccgtcttccacgaactgtgatctcgcttccaaagcataaatcagtggttgtaacactaaatgattcagatgatagtgaatctgatggagaggcttccaagtcaacaaatagtgtttttggtggattagagtccatgattaaagaagcaagacgaactgctgagcaagcttcaaaaccgaaagtacctccaaaatctgaaaaagaaaatgatcctctgcgaacaccggaggctttgcctgaagaaaagaagattgaatatagattgttaaaggaagagattgccaaccgtgagaaacagcgtttgattaaatcagatcagctgaagacaagttcatcatccccagcaaactctgatgtggaaattgatggtattggcaggatagcaatggttactaagcaggttacagatgcagaatcaaaactgaaaaaacataggattctcttgatgaaagatgaatctgttttaaagaatttagtgcaacaagaagctaagaagaaagaatctgttagaaatgctgaagcaaagattacaaaacttacagaacagcttcaagcaactgaaaaaattcttaatgttaacagaatgtttttgaagaagcttcaggaacaaattcacagagttcaacagcgtgttacaattaagaaagctttgactctaaaatatggagaagagcttgctcgggcaaaggcagtggccagtaaagaaataggaaaacgtaaactggaacaagatcgctttgggccaaacaaaatgatgagactggacagttctccagtatcaagtccaagaaagcattcagcagaactaattgctatggagaaaagacggttacaaaagctagaatatgaatatgccctgaaaattcaaaaattaaaagaagcccgtgcccttaaagcaaaggaacaacaaaatatctctccagttgtggaagaggaacccgaattttctttacctcaaccctcacttcatgatctgacacaagataaattaaccctggacactgaagaaaatgatgttgatgatgaaattttgtctggttcaagcagagagcgaagaagatcttttttagaatccaattattttactaaacctaaccttaagcacactgatactgctaacaaagaatgcataaacaaacttaataaaaatactgtagaaaaaccagaactttttctagggttaaaaattggtgaattgcaaaaattgtattcaaaagctgacagcctaaaacagctgattttaaaaaccaccacaggcattacagagaaggttttgcatggtcaggagatttctgtagatgtggattttgtcacagcacaaagtaaaacaatggaagtgaagccatgtccttttagaccctaccatagtcctcttctagtttttaagtcctacagatttagtccatattatcgaaccaaggaaaaacttcccctgagctcagtatcatacagtaatatgattgaaccggatcagtgtttctgccgttttgatttaacaggaacatgtaatgatgatgattgtcaatggcagcatatacaagactatacacttagccgaaaacagttattccaggacattctgtcatataatctgtctttgattggttgtgcagagacaagtactaatgaagaaattactgcttcagcagaaaaatatgttgagaaactttttggagtaaacaaagatcgaatgtcaatggaccagatggctgttctccttgttagcaatatcaatgaaagtaaaggtcatactcctccatttacaacctacaaagataaaagaaagtggaagccaaagttttggagaaaacctatttcagataatagcttcagtagtgatgaggaacagtctacaggaccaattaagtatgctttccagccagagaaccaaataaatgttccagctctggatacagttgtcactccagatgatgtcagatactttacaaatgagactgatgacatcgctaatttagaagcaagtgtgcttgaaaatccttctcatgtacaactttggctcaagcttgcgtacaagtacttgaatcaaaatgagggggagtgctcagaatccttggattctgctttaaatgttctggcgcgagcattggaaaataacaaagacaatccagaaatttggtgccattacctcagattgttctcaaaaagaggaaccaaggacgaggtgcaggaaatgtgtgaaacagctgttgaatatgctccagattatcaaagcttttggacttttctacacctagaaagtacctttgaagaaaaggattacgtatgtgagagaatgttggagtttctgatgggagcagccaagcaggaaacatccaatattttgtcctttcagcttttagaggctcttttgtttagagttcagctgcacatatttactggaagatgccaaagtgcactggcaattttacagaatgcattgaaatctgctaatgatggaatagtagctgaataccttaaaaccagtgatcgatgtttggcatggttggcctacatacatcttattgaattcaacattctcccttcaaaattttatgatccatctaatgataatccttcaagaattgttaacactgaatcatttgtaatgccatggcaagctgttcaagatgtaaagactaatcctgacatgttgttagcagtttttgaagatgcagtgaaagcttgcacagatgagagccttgctgttgaggaaagaatagaggcctgccttccactttacacaaacatgattgctctgcaccaactcctggagaggtatgaggctgcaatggagctttgtaaatctttattggaatcatgtcctattaactgccagttgctggaagctcttgttgcattatatttgcaaacaaatcagcatgacaaagccagagcagtgtggcttactgcatttgaaaaaaatcctcagaatgcagaggttttttatcatatgtgcaaattcttcatcttacagaatcgaggcgataatcttcttccatttttgcggaaatttattgcatccttctttaaaccggggtttgagaagtataataacttggatctgtttcggtatctcttaaatattccaggaccaattgacattccatctcgtttatgtaaagggaattttgatgatgatatgtttaaccaccaagttccttatttgtggctgatttactgcctttgtcatcctcttcaatcaagtattaaagaaacagtggaggcatatgaggcagcattaggggtggctatgagatgtgatatagtacagaagatatggatggattatcttgtctttgcaaataatagagctgctggatccagaaacaaagttcaagaattcaaattttttactgatttagtgaatagatgtttggttacagtccctgcccgataccccattccttttagcagtgctgattactggtccaactatgaatttcataatagggttattttcttttatttgagctgtgttccaaagacccagcattccaaaaccttggaacggttttgttcagttatgccagctaattctggacttgcattgaggttacttcaacatgaatgggaagaaagcaatgttcagattctgaaacttcaagccaagatgtttacatataatatcccaacatgcctggccacctggaaaatagccattgctgctgagattgttctaaagggacaaagagaggtccaccgtttatatcagagagccttacagaagttacctctttgtgcatcactgtggaaagatcaactcttgtttgaagcatcagaaggaggtaaaactgataacctgagaaaactagtttccaagtgccaagagattggagtcagcctaaatgagctcttaaatttaaacagtaacaaaacagaaagcaagaatcactgaacactgggtgcagtcagttctaagtccttataataattgccaaaattatttgaatgattcttcaagattaggctgatccctggctaaggtctgtgtaaggcagacaagcgttattgatcatatcaagttccctacaatatcctgtcctcaaaaccggaagcaatgaacatgatcctcttcggttggataaatgaacttcctgtttggcctgcttctaggccctgccagattctcataacatcatatacgtaagtatagttcctcaaagtgactgacatttattttaattttgctttgtttttttttattttctcccccattcctttattttgtgttattcctgactcacttgacactctctgatgcctgagagattcctgtttgggatttaatatccagggctgtgtttacagtaaaaaaagcaggcagtcccttttagtttttcctttttaaatttttttgagattcttcatttcaggatttaaaactatagcagtccatcttaaggaaagtgtaactgccatggccacaagtctgctagttgcacttgaatgctctatcagggttgtttattaccctttctacgttctggactccttgccgagactgtttaacttgaagattaaagaaactattgcaaatgccagtgcatcagaacctaagagtggtcaaatattatgtgcaatttttttgtaaagaaattttaatttataataaagtttaacagtttaaagaacagttaatatttgaactgctttgtattgaaatactactttgtagtattgaaattgtttatatacttttttaatataagttaactttctaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:196441 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:196441 -> Molecular function: GO:0046872 [metal ion binding] evidence: IEA
            GeneID:196441 -> Biological process: GO:0006396 [RNA processing] evidence: IEA
            GeneID:196441 -> Cellular component: GO:0005622 [intracellular] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.