GGRNA Home | Help | Advanced search

2020-10-26 19:45:32, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_144715               2857 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens EF-hand domain family, member B (EFHB), mRNA.
ACCESSION   NM_144715
VERSION     NM_144715.3  GI:148613875
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2857)
  AUTHORS   Rose,J.E., Behm,F.M., Drgon,T., Johnson,C. and Uhl,G.R.
  TITLE     Personalized smoking cessation: interactions between nicotine dose,
            dependence and quit-success genotype score
  JOURNAL   Mol. Med. 16 (7-8), 247-253 (2010)
   PUBMED   20379614
  REMARK    GeneRIF: Clinical trial of gene-disease association and
            gene-environment interaction. (HuGE Navigator)
            Erratum:[Mol Med. 2012;18(1):729]
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AC104182.2, AK097644.1 and BC028198.1.
            On Jun 6, 2007 this sequence version replaced gi:32526891.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC028198.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-197               AC104182.2         150267-150463       c
            198-1186            AK097644.1         200-1188
            1187-1192           AC104182.2         136082-136087       c
            1193-1340           BC028198.1         1159-1306
            1341-1373           AC104182.2         134481-134513       c
            1374-2857           BC028198.1         1340-2823
FEATURES             Location/Qualifiers
     source          1..2857
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="3"
                     /map="3p24.3"
     gene            1..2857
                     /gene="EFHB"
                     /note="EF-hand domain family, member B"
                     /db_xref="GeneID:151651"
                     /db_xref="HGNC:26330"
     exon            1..985
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    35..37
                     /gene="EFHB"
                     /note="upstream in-frame stop codon"
     variation       125
                     /gene="EFHB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2929349"
     CDS             197..2698
                     /gene="EFHB"
                     /codon_start=1
                     /product="EF-hand domain-containing family member B"
                     /protein_id="NP_653316.3"
                     /db_xref="GI:148613876"
                     /db_xref="CCDS:CCDS33715.2"
                     /db_xref="GeneID:151651"
                     /db_xref="HGNC:26330"
                     /translation="
MNMEIGHPHEGKDDLGDKRVIMGTKFPMELGIRVGLGKEDSRCGESPVVSNKCEGRMAPPETKFPLSKGLEMGLERQNISRTVMQRGSLGVDSVSASQGTKPSLLPGRMGLENESLLAGYTHERIIQPPLGRVCGSSQAAGSRRAPLASGPEGVEELVGKPAFVMEPRQEMEKESTCVLMKPNTEIKLPVEVDIGLTQAEGPDETKNTEPQMGLVIEPPQCQFAQQHEQRKEAGNIESGVEPPDRIRPIYSGKFFDRTPCWPSAGKVIPVGYRVATCLTEKLPRLITPPEAKKYFNFRYPPAGVERVFYGRANDPQIAPYLTHGIRSKISVLANTLINPQPITTFQQKIKDKKESIYLSNRRAPLGKSHDQAPGLPKGMDTTNTTFGTAVIKEYSAKDVVNPPKSYEEVFKEGNEGHDLYVVSHNDYYAGEAKNRKYNPSSFHRCSVYGVPTPHFNDGRAMAKSLYWLHELQMKRGAKFVSKRADDFKEKFQHKLGRVLDPIAETMNVPPDCTFGACLRPEEYGVGDLIHNRLPDEYLRGKDRQRALIAAVRHHLKKVNYQKFDTLLAAFRHYDKKGDGMIDKDELQEACDQANLSLDDKLLDQLFDYCDVDNDGFINYLEFANFLNWKDKMLLKEYEERVIIKGRKPDCVNPTEANVEEPEQTLLIKPEDIVLKEAGSTEKTLRTLLRPSDKVSNYYKTTSSEINAIVGAIPSTCYPICGVPTIRSDIPAPRIRRISDRTNYGEEGSAYSLLYPTIFARKGVFERDFFKTRSKEEIAEILCNIGVKLSDEEFENVWNLASKKHHRGEVCVENIRNVLDELRHADRIKCKTLM
"
     misc_feature    1892..2074
                     /gene="EFHB"
                     /note="EF-hand, calcium binding motif; A diverse
                     superfamily of calcium sensors and calcium signal
                     modulators; most examples in this alignment model have 2
                     active canonical EF hands. Ca2+ binding induces a
                     conformational change in the EF-hand motif, leading to...;
                     Region: EFh; cd00051"
                     /db_xref="CDD:28933"
     misc_feature    1907..2074
                     /gene="EFHB"
                     /note="EF-hand domain pair; Region: EF_hand_5; pfam13499"
                     /db_xref="CDD:205677"
     misc_feature    order(1916..1918,1922..1924,1928..1930,1949..1951,
                     2024..2026,2030..2032,2036..2038,2057..2059)
                     /gene="EFHB"
                     /note="Ca2+ binding site [ion binding]; other site"
                     /db_xref="CDD:28933"
     exon            986..1048
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     exon            1049..1192
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     variation       1186
                     /gene="EFHB"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2929362"
     exon            1193..1373
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     variation       1341
                     /gene="EFHB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2929366"
     exon            1374..1484
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     exon            1485..1614
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     exon            1615..1698
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     exon            1699..1766
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     exon            1767..1921
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     exon            1922..2129
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     variation       2062
                     /gene="EFHB"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:4858714"
     exon            2130..2342
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     exon            2343..2524
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     exon            2525..2857
                     /gene="EFHB"
                     /inference="alignment:Splign:1.39.8"
     polyA_signal    2832..2837
                     /gene="EFHB"
     polyA_site      2857
                     /gene="EFHB"
ORIGIN      
ctccatcttttcctctgtgaactcggctaggtgttaagaggcaggcaggaagcaatggacagggagtccgagtgaggttgtgctctttcctgagagaggggttccgcaagggattggaggcgtctttgtagccaggtacagctttccccttagagatgagcgctcttggagaaatgagaatggggagaaatcgtccatgaacatggagattggacatccccacgaaggaaaggatgatttaggagacaagagggtcatcatgggaacaaaatttcccatggagttggggatcagagtaggattaggaaaagaagattcccgatgcggggagagccctgtggttagtaataagtgtgagggaaggatggcaccaccagaaacaaaatttccattgagcaaggggcttgaaatgggattagaaagacagaatatttctaggactgtcatgcagaggggtagtttaggagtcgacagtgtctcagcttcacagggaacaaaaccttctctgttgccaggaagaatggggttagaaaatgagagtcttcttgcaggatatacccatgaacggataatacagcctcctttgggcagggtgtgtggaagttcacaggctgcagggagcaggagagctcctttggctagtggccctgaaggggtagaggaattagtgggaaagcctgctttcgttatggaaccaagacaggaaatggaaaaagagtctacctgtgttttaatgaaacccaacacagagattaagcttcctgtggaggtggacattggactaacccaagccgaggggccagatgagactaagaatacagagccccaaatgggcttggtgatagaacctccccaatgccagtttgcccaacaacatgaacagagaaaggaggctggaaacattgaatcaggagtggaacctccagatcgcatcagacccatatactctgggaagttttttgatcggaccccttgctggccaagtgcaggaaaagttattccagttggttacagagttgcaacctgcttgactgaaaaacttcccaggctaattactccacctgaagcaaaaaagtatttcaacttcagatatccacctgctggagtagaaagagtattttacggaagagcaaatgatccccagattgcaccttatttgacacatggaattagatctaaaatttcagtactggcaaacacattgataaacccacagcctattaccacatttcaacagaaaattaaagataaaaaagaatctatatatcttagcaatcgacgagcaccattaggaaaatctcacgatcaagcaccaggattaccaaaaggcatggacacaaccaatacgacatttgggacagcagtcatcaaagaatactctgctaaagatgtggtgaatccaccaaaatcctatgaagaagtatttaaagaaggaaatgaaggacatgatttgtatgttgtttctcacaatgattattatgcaggagaggcaaagaaccgaaagtataacccatcaagtttccataggtgtagtgtgtatggagtaccaacaccacattttaatgatggacgagccatggcaaaatctctatattggctccatgaactacaaatgaaaagaggagctaagtttgtatccaaaagagcagatgatttcaaagaaaagtttcaacataaacttggaagagttttagatcccattgcagaaacaatgaatgttcccccagactgcacatttggagcttgtctccgtcctgaggaatatggagttggtgatctcatccataatagacttccggatgaatatcttcgaggcaaggatagacagcgagccctgattgcagcagttcggcatcacctgaagaaagttaattaccaaaagtttgacactttgctggcagccttcaggcactatgacaagaagggagatgggatgatagataaagacgagctgcaggaagcttgtgaccaggccaacttgagtttagatgacaagctcctggaccagctatttgactactgtgatgtggataatgatggcttcattaactatctggaattcgcaaattttcttaactggaaagacaaaatgcttcttaaagagtatgaagagagggtcattattaaaggtagaaaaccagattgtgtaaaccctactgaggctaatgttgaagaacctgaacaaactctcctcataaagccagaagatattgtcttaaaagaagcaggaagcacagaaaagactctccggacacttctgagaccaagtgataaagtttccaactactataagacaacttcttctgagatcaatgcaattgtaggagccattccttctacttgttaccccatttgtggtgttccaaccattcgatctgacattcctgctccccgaattcgtcgcatcagtgacagaactaattatggtgaagaaggtagtgcatattcactactatatcctaccatttttgcccggaaaggagtgtttgaaagagacttcttcaagaccagatcaaaagaagagattgcagagatattgtgtaacattggtgtcaaactgtctgatgaagaatttgaaaatgtatggaatcttgcatcaaaaaagcatcacagaggagaagtttgtgttgagaacatcagaaatgttctagatgagctacggcatgcagaccggatcaagtgtaaaacactcatgtgatatttttggacttcattcattcaagcaaaagaattattaactctgtgtttatctaaaatgttgaatccattctggttttagatattatgttagagttcacagtggtaagactcatatgcctgtatgtgttgctaataaattagattttggattttaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:151651 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.