Home |
Help |
Advanced search
2024-04-19 15:15:58, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_144710 3256 bp mRNA linear PRI 17-APR-2013
DEFINITION Homo sapiens septin 10 (SEPT10), transcript variant 1, mRNA.
ACCESSION NM_144710
VERSION NM_144710.3 GI:384871589
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3256)
AUTHORS Xu,M., Takanashi,M., Oikawa,K., Nishi,H., Isaka,K., Yoshimoto,T.,
Ohyashiki,J. and Kuroda,M.
TITLE Identification of a novel role of Septin 10 in
paclitaxel-resistance in cancers through a functional genomics
screen
JOURNAL Cancer Sci. 103 (4), 821-827 (2012)
PUBMED 22320903
REMARK GeneRIF: we found that paclitaxel-resistant tumors had decreased
expression of SEPT10.
REFERENCE 2 (bases 1 to 3256)
AUTHORS Benedetti,D., Bomben,R., Dal-Bo,M., Marconi,D., Zucchetto,A.,
Degan,M., Forconi,F., Del-Poeta,G., Gaidano,G. and Gattei,V.
TITLE Are surrogates of IGHV gene mutational status useful in B-cell
chronic lymphocytic leukemia? The example of Septin-10
JOURNAL Leukemia 22 (1), 224-226 (2008)
PUBMED 17657217
REMARK GeneRIF: Lack of SEPT10 transcript is associated with B-cell
chronic lymphocytic leukemia
REFERENCE 3 (bases 1 to 3256)
AUTHORS Lamesch,P., Li,N., Milstein,S., Fan,C., Hao,T., Szabo,G., Hu,Z.,
Venkatesan,K., Bethel,G., Martin,P., Rogers,J., Lawlor,S.,
McLaren,S., Dricot,A., Borick,H., Cusick,M.E., Vandenhaute,J.,
Dunham,I., Hill,D.E. and Vidal,M.
TITLE hORFeome v3.1: a resource of human open reading frames representing
over 10,000 human genes
JOURNAL Genomics 89 (3), 307-315 (2007)
PUBMED 17207965
REFERENCE 4 (bases 1 to 3256)
AUTHORS Hillier,L.W., Graves,T.A., Fulton,R.S., Fulton,L.A., Pepin,K.H.,
Minx,P., Wagner-McPherson,C., Layman,D., Wylie,K., Sekhon,M.,
Becker,M.C., Fewell,G.A., Delehaunty,K.D., Miner,T.L., Nash,W.E.,
Kremitzki,C., Oddy,L., Du,H., Sun,H., Bradshaw-Cordum,H., Ali,J.,
Carter,J., Cordes,M., Harris,A., Isak,A., van Brunt,A., Nguyen,C.,
Du,F., Courtney,L., Kalicki,J., Ozersky,P., Abbott,S.,
Armstrong,J., Belter,E.A., Caruso,L., Cedroni,M., Cotton,M.,
Davidson,T., Desai,A., Elliott,G., Erb,T., Fronick,C., Gaige,T.,
Haakenson,W., Haglund,K., Holmes,A., Harkins,R., Kim,K.,
Kruchowski,S.S., Strong,C.M., Grewal,N., Goyea,E., Hou,S., Levy,A.,
Martinka,S., Mead,K., McLellan,M.D., Meyer,R., Randall-Maher,J.,
Tomlinson,C., Dauphin-Kohlberg,S., Kozlowicz-Reilly,A., Shah,N.,
Swearengen-Shahid,S., Snider,J., Strong,J.T., Thompson,J.,
Yoakum,M., Leonard,S., Pearman,C., Trani,L., Radionenko,M.,
Waligorski,J.E., Wang,C., Rock,S.M., Tin-Wollam,A.M., Maupin,R.,
Latreille,P., Wendl,M.C., Yang,S.P., Pohl,C., Wallis,J.W.,
Spieth,J., Bieri,T.A., Berkowicz,N., Nelson,J.O., Osborne,J.,
Ding,L., Meyer,R., Sabo,A., Shotland,Y., Sinha,P., Wohldmann,P.E.,
Cook,L.L., Hickenbotham,M.T., Eldred,J., Williams,D., Jones,T.A.,
She,X., Ciccarelli,F.D., Izaurralde,E., Taylor,J., Schmutz,J.,
Myers,R.M., Cox,D.R., Huang,X., McPherson,J.D., Mardis,E.R.,
Clifton,S.W., Warren,W.C., Chinwalla,A.T., Eddy,S.R., Marra,M.A.,
Ovcharenko,I., Furey,T.S., Miller,W., Eichler,E.E., Bork,P.,
Suyama,M., Torrents,D., Waterston,R.H. and Wilson,R.K.
TITLE Generation and annotation of the DNA sequences of human chromosomes
2 and 4
JOURNAL Nature 434 (7034), 724-731 (2005)
PUBMED 15815621
REFERENCE 5 (bases 1 to 3256)
AUTHORS Sui,L., Zhang,W., Liu,Q., Chen,T., Li,N., Wan,T., Yu,M. and Cao,X.
TITLE Cloning and functional characterization of human septin 10, a novel
member of septin family cloned from dendritic cells
JOURNAL Biochem. Biophys. Res. Commun. 304 (2), 393-398 (2003)
PUBMED 12711328
REMARK GeneRIF: Cloning and functional characterization of septin 10.
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AC011753.6, BC020502.1 and
AC140485.3.
On Apr 20, 2012 this sequence version replaced gi:30795194.
Summary: This gene encodes a member of the septin family of
cytoskeletal proteins with GTPase activity. This protein localizes
to the cytoplasm and nucleus and displays GTP-binding and GTPase
activity. A pseudogene for this gene is located on chromosome 8.
Alternative splicing results in multiple transcript variants.
[provided by RefSeq, Apr 2012].
Transcript Variant: This variant (1) encodes the longer isoform
(1).
Sequence Note: This RefSeq record was created from transcript and
genomic sequence data to make the sequence consistent with the
reference genome assembly. The genomic coordinates used for the
transcript record were based on transcript alignments.
##Evidence-Data-START##
Transcript exon combination :: AK021681.1, AF146760.1 [ECO:0000332]
RNAseq introns :: mixed/partial sample support
ERS025081, ERS025082 [ECO:0000350]
##Evidence-Data-END##
COMPLETENESS: complete on the 3' end.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-306 AC011753.6 68994-69299 c
307-3071 BC020502.1 1-2765
3072-3256 AC140485.3 45359-45543 c
FEATURES Location/Qualifiers
source 1..3256
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="2"
/map="2q13"
gene 1..3256
/gene="SEPT10"
/note="septin 10"
/db_xref="GeneID:151011"
/db_xref="HGNC:14349"
/db_xref="HPRD:15325"
/db_xref="MIM:611737"
exon 1..409
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
variation 291
/gene="SEPT10"
/replace="a"
/replace="t"
/db_xref="dbSNP:3829700"
misc_feature 344..346
/gene="SEPT10"
/note="upstream in-frame stop codon"
CDS 380..1744
/gene="SEPT10"
/note="isoform 1 is encoded by transcript variant 1;
septin-10"
/codon_start=1
/product="septin-10 isoform 1"
/protein_id="NP_653311.1"
/db_xref="GI:21945064"
/db_xref="CCDS:CCDS46383.1"
/db_xref="GeneID:151011"
/db_xref="HGNC:14349"
/db_xref="HPRD:15325"
/db_xref="MIM:611737"
/translation="
MASSEVARHLLFQSHMATKTTCMSSQGSDDEQIKRENIRSLTMSGHVGFESLPDQLVNRSIQQGFCFNILCVGETGIGKSTLIDTLFNTNFEDYESSHFCPNVKLKAQTYELQESNVQLKLTIVNTVGFGDQINKEESYQPIVDYIDAQFEAYLQEELKIKRSLFTYHDSRIHVCLYFISPTGHSLKTLDLLTMKNLDSKVNIIPVIAKADTVSKTELQKFKIKLMSELVSNGVQIYQFPTDDDTIAKVNAAMNGQLPFAVVGSMDEVKVGNKMVKARQYPWGVVQVENENHCDFVKLREMLICTNMEDLREQTHTRHYELYRRCKLEEMGFTDVGPENKPVSVQETYEAKRHEFHGERQRKEEEMKQMFVQRVKEKEAILKEAERELQAKFEHLKRLHQEERMKLEEKRRLLEEEIIAFSKKKATSEIFHSQSFLATGSNLRKDKDRKNSNFL
"
misc_feature 566..1372
/gene="SEPT10"
/note="CDC/Septin GTPase family; Region: CDC_Septin;
cd01850"
/db_xref="CDD:206649"
misc_feature 569..1372
/gene="SEPT10"
/note="Septin; Region: Septin; pfam00735"
/db_xref="CDD:201420"
misc_feature 596..619
/gene="SEPT10"
/note="G1 box; other site"
/db_xref="CDD:206649"
misc_feature order(602..622,752..754,761..763,1001..1006,1010..1012,
1166..1171)
/gene="SEPT10"
/note="GTP/Mg2+ binding site [chemical binding]; other
site"
/db_xref="CDD:206649"
misc_feature 686..703
/gene="SEPT10"
/note="Switch I region; other site"
/db_xref="CDD:206649"
misc_feature 752..763
/gene="SEPT10"
/note="G3 box; other site"
/db_xref="CDD:206649"
misc_feature order(758..874,878..901)
/gene="SEPT10"
/note="Switch II region; other site"
/db_xref="CDD:206649"
misc_feature 1001..1012
/gene="SEPT10"
/note="G4 box; other site"
/db_xref="CDD:206649"
misc_feature 1166..1174
/gene="SEPT10"
/note="G5 box; other site"
/db_xref="CDD:206649"
exon 410..478
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
exon 479..596
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
exon 597..792
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
exon 793..979
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
variation 945
/gene="SEPT10"
/replace="c"
/replace="t"
/db_xref="dbSNP:3829701"
exon 980..1141
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
exon 1142..1238
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
exon 1239..1407
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
exon 1408..1540
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
exon 1541..1728
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
exon 1729..3256
/gene="SEPT10"
/inference="alignment:Splign:1.39.8"
variation 2223
/gene="SEPT10"
/replace="c"
/replace="t"
/db_xref="dbSNP:3886070"
ORIGIN
cacttccggcctcgcgagggccgcaatcactgctccgcagttcccgcctgcattcctcgcgccgtcttcctggagtcccagctctccttcagcccgccccaacgctgacgctcagtcctcaggcgtcgagggtagctcctgtgaggggctcgcttggcgcaggcaaaacgctcagcgcgcaccacagggcgtccgccccaaccccgcccccggaggcctccagctcggccccgcccctgtcccttccccgtcgcggaggcagcctagcctcgcgccccgcccgttgcttctgccctccggccttcccgccgccgtcgccgggaccagccgctcggggccgggctgatacagccgcttcaccgtgcccctgcccgcgaccatggcctcctccgaggtggcgcggcacctgctctttcagtctcacatggcaacgaaaacaacttgtatgtcttcacaaggatcagatgatgaacagataaaaagagaaaacattcgttcgttgactatgtctggccatgttggttttgagagtttgcctgatcagctggtgaacagatccattcagcaaggtttctgctttaatattctctgtgtgggggaaactggaattggaaaatcaacactgattgacacattgtttaatactaattttgaagactatgaatcctcacatttttgcccaaatgttaaacttaaagctcagacatatgaactccaggaaagtaatgttcaattgaaattgaccattgtgaatacagtgggatttggtgaccaaataaataaagaagagagctaccaaccaatagttgactacatagatgctcagtttgaggcctatctccaagaagaactgaagattaagcgttctctctttacctaccatgattctcgcatccatgtgtgtctctacttcatttcaccgacaggccactctctgaagacacttgatctcttaaccatgaagaaccttgacagcaaggtaaacattataccagtgattgccaaagcagatacggtttctaaaactgaattacagaagtttaagatcaagctcatgagtgaattggtcagcaatggcgtccagatataccagttcccaacggatgatgacactattgctaaggtcaacgctgcaatgaatggacagttgccgtttgctgttgtgggaagtatggatgaggtaaaagtcggaaacaagatggtcaaagctcgccagtacccttggggtgttgtacaagtggaaaatgaaaaccactgtgactttgtaaagctgcgggaaatgctcatttgtacaaatatggaggacctgcgagagcagacccataccaggcactatgagctttacaggcgctgcaaactggaggaaatgggctttacagatgtgggcccagaaaacaagccagtcagtgttcaagagacctatgaagccaaaagacatgagttccatggtgaacgtcagaggaaggaagaagaaatgaaacagatgtttgtgcagcgagtaaaggagaaagaagccatattgaaagaagctgagagagagctacaggccaaatttgagcaccttaagagacttcaccaagaagagagaatgaagcttgaagaaaagagaagacttttggaagaagaaataattgctttctctaaaaagaaagctacctccgagatatttcacagccagtcctttctggcaacaggcagcaacctgaggaaggacaaggaccgtaagaactccaattttttgtaaaacagaagttccagagcacagaaggtcatcatcacaagcaaactttattaaaaaaaaactagaagtgtgctttgattttgctgttatttgttttatcacttctatatttggtgaacagccacagttactgatatttatggaaaagtactttcaagtacaaggtcaatacataagccagagtgaatgatactacaagttgagcatctctaattcaaaaatctgaaatccagaagcttcaaaatctgaatctttttgagcactgacttgaccccacaagtggaaaattccccacccgacacctttgctttctgatggttcagtttaaacagattttgtttcttgcacaaaatttttgtataaattactttcaggctatatgtataaggtggatgtgaaacatgaattatgtaattagagtcgggtcccgttgtgtatatgcagatattccaaacctgaaatccaaaacacttctggtccctagcattttggataagggatactcagcttgtacctatatattcatatatattcactgttgttagaaatgtttaagttgctgttctgtgatgaatctaaatcttttctcttgctaccaagctattgtcactgcagtgcattataccaaagagcgaagtcagtgccactgaaaatacagaacccattaatatcgtggctatctgattacatttatattccaagatgaaccttttttatatatgctaaaaattttggggaatatgttttgggatgtattatggagctaaaactctaacctcttaatagttttatagaacttaaaaattttttatacaattacccaattggtgatatgatcttaagcttttgtgtcagattatttaatatgatgacttcatgctttattatgccttattatggctgacgtattactgtggtgaaacaaaatatctttaaaagttaaaacatccagatatataagctattttttcctaaggataaagtacctttgagcatgagtgtatcacagctttcattaggaaaacttttcattacatacttgtttaaactctgtcttccagggtaaaaataataaggttgaatcattttattaaaaatactttttaagaaaataactatgaacatctgaatattaaagatataaaaatgcacataattcatatttcaggtggtatttgcattcagtgccttactggtattctcagaacattttaatgatttctaacatttcttaacagtcatagatatatacattttcattttttgtacttgaatattctaaataaaactgacatttactcttgacaaataaaacatatatttactaaaatgtgtttaattttcctttctgaaaactctcattttaaaaacgttcatttaattatgtatttgaattattttggagatgaggtattttatgagtattttcagacaatgaaacttattagtctgtgtcagattctgagcaatcatagagtcatctaagttgtaaataaaaccttgcatagcacaatt
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:151011 -> Molecular function: GO:0005525 [GTP binding] evidence: IEA
GeneID:151011 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
GeneID:151011 -> Biological process: GO:0051301 [cell division] evidence: IEA
GeneID:151011 -> Cellular component: GO:0031105 [septin complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.