GGRNA Home | Help | Advanced search

2024-03-29 18:23:31, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_144662               1829 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 8
            (PSMA8), transcript variant 1, mRNA.
ACCESSION   NM_144662
VERSION     NM_144662.2  GI:68303560
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 1829)
  AUTHORS   Nusbaum,C., Zody,M.C., Borowsky,M.L., Kamal,M., Kodira,C.D.,
            Taylor,T.D., Whittaker,C.A., Chang,J.L., Cuomo,C.A., Dewar,K.,
            FitzGerald,M.G., Yang,X., Abouelleil,A., Allen,N.R., Anderson,S.,
            Bloom,T., Bugalter,B., Butler,J., Cook,A., DeCaprio,D., Engels,R.,
            Garber,M., Gnirke,A., Hafez,N., Hall,J.L., Norman,C.H., Itoh,T.,
            Jaffe,D.B., Kuroki,Y., Lehoczky,J., Lui,A., Macdonald,P.,
            Mauceli,E., Mikkelsen,T.S., Naylor,J.W., Nicol,R., Nguyen,C.,
            Noguchi,H., O'Leary,S.B., O'Neill,K., Piqani,B., Smith,C.L.,
            Talamas,J.A., Topham,K., Totoki,Y., Toyoda,A., Wain,H.M.,
            Young,S.K., Zeng,Q., Zimmer,A.R., Fujiyama,A., Hattori,M.,
            Birren,B.W., Sakaki,Y. and Lander,E.S.
  TITLE     DNA sequence and analysis of human chromosome 18
  JOURNAL   Nature 437 (7058), 551-555 (2005)
   PUBMED   16177791
  REMARK    Erratum:[Nature. 2005 Dec 1;438(7068):696. O'Neill, Keith [added]]
REFERENCE   2  (bases 1 to 1829)
  AUTHORS   Margottin-Goguet,F., Hsu,J.Y., Loktev,A., Hsieh,H.M., Reimann,J.D.
            and Jackson,P.K.
  TITLE     Prophase destruction of Emi1 by the SCF(betaTrCP/Slimb) ubiquitin
            ligase activates the anaphase promoting complex to allow
            progression beyond prometaphase
  JOURNAL   Dev. Cell 4 (6), 813-826 (2003)
   PUBMED   12791267
REFERENCE   3  (bases 1 to 1829)
  AUTHORS   Claverol,S., Burlet-Schiltz,O., Girbal-Neuhauser,E., Gairin,J.E.
            and Monsarrat,B.
  TITLE     Mapping and structural dissection of human 20 S proteasome using
            proteomic approaches
  JOURNAL   Mol. Cell Proteomics 1 (8), 567-578 (2002)
   PUBMED   12376572
  REMARK    GeneRIF: This article provides an overview of some of the
            components in the human 20 S proteasome.
REFERENCE   4  (bases 1 to 1829)
  AUTHORS   Geley,S., Kramer,E., Gieffers,C., Gannon,J., Peters,J.M. and
            Hunt,T.
  TITLE     Anaphase-promoting complex/cyclosome-dependent proteolysis of human
            cyclin A starts at the beginning of mitosis and is not subject to
            the spindle assembly checkpoint
  JOURNAL   J. Cell Biol. 153 (1), 137-148 (2001)
   PUBMED   11285280
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            BC042820.1 and BC047355.1.
            On Jun 29, 2005 this sequence version replaced gi:21389548.
            
            Transcript Variant: This variant (1) represents the longest
            transcript and it encodes the longest protein (isoform 1).
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC025389.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-26                BC042820.1         1-26
            27-1829             BC047355.1         1-1803
FEATURES             Location/Qualifiers
     source          1..1829
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="18"
                     /map="18q11.2"
     gene            1..1829
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /note="proteasome (prosome, macropain) subunit, alpha
                     type, 8"
                     /db_xref="GeneID:143471"
                     /db_xref="HGNC:22985"
     exon            1..216
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /inference="alignment:Splign:1.39.8"
     variation       20
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:79042990"
     variation       60
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:76463276"
     variation       70
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:375979811"
     variation       76
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:367810883"
     variation       87
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199655437"
     misc_feature    103..105
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /note="upstream in-frame stop codon"
     variation       103
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369422702"
     variation       113
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367607416"
     CDS             115..885
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /EC_number="3.4.25.1"
                     /note="isoform 1 is encoded by transcript variant 1"
                     /codon_start=1
                     /product="proteasome subunit alpha type-7-like isoform 1"
                     /protein_id="NP_653263.2"
                     /db_xref="GI:68303561"
                     /db_xref="CCDS:CCDS32808.1"
                     /db_xref="GeneID:143471"
                     /db_xref="HGNC:22985"
                     /translation="
MASRYDRAITVFSPDGHLFQVEYAQEAVKKGSTAVGIRGTNIVVLGVEKKSVAKLQDERTVRKICALDDHVCMAFAVLTIFIGLTADARVVINRARVECQSHKLTVEDPVTVEYITRFIATLKQKYTQSNGRRPFGISALIVGFDDDGISRLYQTDPSGTYHAWKANAIGRSAKTVREFLEKNYTEDAIASDSEAIKLAIKALLEVVQSGGKNIELAIIRRNQPLKMFSAKEVELYVTEIEKEKEEAEKKKSKKSV
"
     misc_feature    127..825
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /note="proteasome subunit alpha; Provisional; Region:
                     PRK03996"
                     /db_xref="CDD:179701"
     misc_feature    127..771
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /note="proteasome_alpha_type_7. The 20S proteasome,
                     multisubunit proteolytic complex, is the central enzyme of
                     nonlysosomal protein degradation in both the cytosol and
                     nucleus. It is composed of 28 subunits arranged as four
                     homoheptameric rings that stack on...; Region:
                     proteasome_alpha_type_7; cd03755"
                     /db_xref="CDD:48453"
     misc_feature    order(133..144,148..153,157..162,172..174,181..183,
                     190..195,202..204,226..228,271..273,277..282,367..375,
                     379..384,475..477,484..486,493..498,505..519,571..573,
                     586..591,595..597,601..606,610..612)
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /note="alpha subunit interaction site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:48453"
     misc_feature    order(208..210,256..258,262..264,301..303,625..627)
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /note="active site"
                     /db_xref="CDD:48453"
     variation       133
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371585912"
     exon            217..343
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /inference="alignment:Splign:1.39.8"
     variation       226
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376403017"
     variation       227
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369017941"
     variation       240
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373058718"
     variation       254
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147712923"
     variation       282
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376606262"
     variation       314
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370769323"
     variation       342
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142644405"
     exon            344..486
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /inference="alignment:Splign:1.39.8"
     variation       358
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372177106"
     variation       401
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146900756"
     variation       429
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138692405"
     variation       436
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141138094"
     variation       437
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150332181"
     variation       449
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:137990346"
     variation       464
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371854509"
     variation       472
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375557530"
     variation       480
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369804246"
     exon            487..609
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /inference="alignment:Splign:1.39.8"
     variation       503
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377524722"
     variation       528
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149476347"
     variation       554
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371109228"
     variation       575
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201810632"
     variation       581
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200739878"
     variation       598
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200476943"
     exon            610..729
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /inference="alignment:Splign:1.39.8"
     variation       623
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146000809"
     variation       628
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:370534304"
     variation       643
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139896833"
     variation       644
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141896498"
     variation       703
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146272213"
     variation       724
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148724967"
     exon            730..792
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /inference="alignment:Splign:1.39.8"
     variation       743
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142265503"
     variation       749
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17852261"
     exon            793..1829
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /inference="alignment:Splign:1.39.8"
     variation       802
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:145392373"
     STS             840..1124
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /standard_name="SHGC-82018"
                     /db_xref="UniSTS:102988"
     variation       841
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:17852262"
     variation       904
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201321706"
     variation       964
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:368685303"
     variation       1000
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:138505570"
     variation       1083
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2069310"
     variation       1196
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:192674845"
     polyA_signal    1271..1276
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
     polyA_site      1298
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /experiment="experimental evidence, no additional details
                     recorded"
     variation       1451
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3794196"
     variation       1625
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368290560"
     variation       1633
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184708358"
     variation       1693
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:189047996"
     variation       1763
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181678938"
     polyA_signal    1809..1814
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
     polyA_site      1829
                     /gene="PSMA8"
                     /gene_synonym="PSMA7L"
                     /experiment="experimental evidence, no additional details
                     recorded"
ORIGIN      
gaggcgcgtgtggaagcgcttccgggcggtagcacgctgtgttggcggcggctccccgcttgcctcagctgcagcagcgggaagctcggtggcaagcccttgtagtcctgtgcgatggcgtctcgatatgacagggcgatcactgtcttctccccagacggacacctttttcaagttgaatatgcccaggaagcggtgaagaaaggatccaccgcggtcggaattcgaggtaccaatatagttgttcttggggtagaaaaaaaatctgttgccaagcttcaagatgaaagaactgtgaggaaaatttgtgcccttgatgaccatgtctgcatggcttttgcagttttgacaatttttataggacttactgctgatgctagagtagtaataaacagagcccgtgtggagtgccagagccataagcttacggttgaggacccagtcactgtagaatacataactcgcttcatagcaactttaaagcagaaatatacccaaagcaatggacgaagaccttttggtatttctgccttaattgtaggttttgatgatgatggtatctcaagattgtatcagacagatccttctggtacttatcatgcttggaaggcaaatgcaataggccgaagtgctaaaactgttcgagaatttctagaaaagaattacacagaagatgccatagcaagtgacagtgaagctatcaagttagcaataaaagctttgctagaagttgtccagtctggtggaaaaaacattgaacttgctataataagaagaaatcaacctttgaagatgtttagtgcaaaagaagttgaattatatgtaactgaaatagaaaaggaaaaggaagaagcagagaagaaaaaatcaaagaaatctgtctaattcttaggatgaccactgggaggtcttaatgttttgttttattgtactgcctgaggttgtttagtgaaattttagaggaaaacagttattttgcagcattacatgcagtacttgtgtgatgttttgagaatgccagatctgtggctgtcttcattctattacatagtcaaacataggtttatgtgaagattttctttgaaaggggatttcagtaattgttgagagcagtcataattccacataagcctgagactctataatttgtccagtgtcttacttaccttcatatatgcaaatataattttaaaaaattttttaattaaaaaaatttaataatttggtgatgtttgaatattgactgtcagttaaggacatagctattccaaataaactaaatataatattgagctgcatttctcaaagaatgacaaaagcatccttatactgatgagttcttaaaattttgtcagagccttcttcattttacaatattttgttatttttattttacctttttcattttacaatatttcgttatttttattttacctttttcattttacaagttgcaatatattgtttcgttcatggaacaaatataggctgaattcaaacatgcaattaaagcatgggaagagcttctaagggcatcttaacaggatgctacatgaaaataaggaaagaaattaatacatatcacttttagtttagatttttattttatctcaagtatgtccagtgtgttcggtttgttacatattccatgaaatatctgagtgtgtattttatgattggtattatggaaggcttattgggggaacaagaaaaatataaaaagtgatctctgcccacggaaaggatttaatccaaatggtccacaagaggaatgtgcttaattcctacagtgagtttatatttttgaaaataaaagctagtaaatattc
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:143471 -> Molecular function: GO:0004298 [threonine-type endopeptidase activity] evidence: IEA
            GeneID:143471 -> Biological process: GO:0000209 [protein polyubiquitination] evidence: TAS
            GeneID:143471 -> Biological process: GO:0000278 [mitotic cell cycle] evidence: TAS
            GeneID:143471 -> Biological process: GO:0002474 [antigen processing and presentation of peptide antigen via MHC class I] evidence: TAS
            GeneID:143471 -> Biological process: GO:0002479 [antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent] evidence: TAS
            GeneID:143471 -> Biological process: GO:0006521 [regulation of cellular amino acid metabolic process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0006977 [DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest] evidence: TAS
            GeneID:143471 -> Biological process: GO:0010467 [gene expression] evidence: TAS
            GeneID:143471 -> Biological process: GO:0016032 [viral process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0016070 [RNA metabolic process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0016071 [mRNA metabolic process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0031145 [anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0034641 [cellular nitrogen compound metabolic process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0042590 [antigen processing and presentation of exogenous peptide antigen via MHC class I] evidence: TAS
            GeneID:143471 -> Biological process: GO:0042981 [regulation of apoptotic process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0043066 [negative regulation of apoptotic process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS
            GeneID:143471 -> Biological process: GO:0051437 [positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
            GeneID:143471 -> Biological process: GO:0051439 [regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle] evidence: TAS
            GeneID:143471 -> Cellular component: GO:0005634 [nucleus] evidence: IEA
            GeneID:143471 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:143471 -> Cellular component: GO:0019773 [proteasome core complex, alpha-subunit complex] evidence: IEA
            GeneID:143471 -> Cellular component: GO:1990111 [spermatoproteasome complex] evidence: ISS
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_653263 -> EC 3.4.25.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.