GGRNA Home | Help | Advanced search

2019-03-25 14:28:31, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_138959               8691 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens VANGL planar cell polarity protein 1 (VANGL1),
            transcript variant 1, mRNA.
ACCESSION   NM_138959 NM_024062
VERSION     NM_138959.2  GI:83415182
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 8691)
  AUTHORS   Anastas,J.N., Biechele,T.L., Robitaille,M., Muster,J.,
            Allison,K.H., Angers,S. and Moon,R.T.
  TITLE     A protein complex of SCRIB, NOS1AP and VANGL1 regulates cell
            polarity and migration, and is associated with breast cancer
            progression
  JOURNAL   Oncogene 31 (32), 3696-3708 (2012)
   PUBMED   22179838
  REMARK    GeneRIF: NOS1AP colocalizes with both SCRIB and VANGL1 along
            cellular protrusions in metastatic breast cancer cells, but does
            not colocalize with either SCRIB or VANGL1 at cell junctions in
            normal breast cells
REFERENCE   2  (bases 1 to 8691)
  AUTHORS   Lee,S., Song,Y.A., Park,Y.L., Cho,S.B., Lee,W.S., Lee,J.H.,
            Chung,I.J., Kim,K.K., Rew,J.S. and Joo,Y.E.
  TITLE     Expression of KITENIN in human colorectal cancer and its relation
            to tumor behavior and progression
  JOURNAL   Pathol. Int. 61 (4), 210-220 (2011)
   PUBMED   21418393
  REMARK    GeneRIF: KITENIN is associated with human colorectal cancer
            progression including invasion and metastasis.
REFERENCE   3  (bases 1 to 8691)
  AUTHORS   Iliescu,A., Gravel,M., Horth,C., Apuzzo,S. and Gros,P.
  TITLE     Transmembrane topology of mammalian planar cell polarity protein
            Vangl1
  JOURNAL   Biochemistry 50 (12), 2274-2282 (2011)
   PUBMED   21291170
  REMARK    GeneRIF: a compact membrane-associated portion with very short
            predicted extra- and intracellular loops, while the protein harbors
            a large intracellular domain
REFERENCE   4  (bases 1 to 8691)
  AUTHORS   Iliescu,A., Gravel,M., Horth,C., Kibar,Z. and Gros,P.
  TITLE     Loss of membrane targeting of Vangl proteins causes neural tube
            defects
  JOURNAL   Biochemistry 50 (5), 795-804 (2011)
   PUBMED   21142127
  REMARK    GeneRIF: Loss of membrane targeting of Vangl1 and Vangl2 proteins
            causes neural tube defects.
REFERENCE   5  (bases 1 to 8691)
  AUTHORS   Ryu,H.S., Park,Y.L., Park,S.J., Lee,J.H., Cho,S.B., Lee,W.S.,
            Chung,I.J., Kim,K.K., Lee,K.H., Kweon,S.S. and Joo,Y.E.
  TITLE     KITENIN is associated with tumor progression in human gastric
            cancer
  JOURNAL   Anticancer Res. 30 (9), 3479-3486 (2010)
   PUBMED   20944126
  REMARK    GeneRIF: KITENIN plays an important role in human gastric cancer
            progression by AP-1 activation.
REFERENCE   6  (bases 1 to 8691)
  AUTHORS   Kalabis,J., Rosenberg,I. and Podolsky,D.K.
  TITLE     Vangl1 protein acts as a downstream effector of intestinal trefoil
            factor (ITF)/TFF3 signaling and regulates wound healing of
            intestinal epithelium
  JOURNAL   J. Biol. Chem. 281 (10), 6434-6441 (2006)
   PUBMED   16410243
  REMARK    GeneRIF: VANGL protein may serve as an effector mediating the
            intestinal trefoil factor (ITF) healing response of the intestinal
            mucosa.
REFERENCE   7  (bases 1 to 8691)
  AUTHORS   Doudney,K., Ybot-Gonzalez,P., Paternotte,C., Stevenson,R.E.,
            Greene,N.D., Moore,G.E., Copp,A.J. and Stanier,P.
  TITLE     Analysis of the planar cell polarity gene Vangl2 and its
            co-expressed paralogue Vangl1 in neural tube defect patients
  JOURNAL   Am. J. Med. Genet. A 136 (1), 90-92 (2005)
   PUBMED   15952208
  REMARK    Erratum:[Am J Med Genet A. 2005 Nov 1;138(4):415]
REFERENCE   8  (bases 1 to 8691)
  AUTHORS   Lee,J.H., Park,S.R., Chay,K.O., Seo,Y.W., Kook,H., Ahn,K.Y.,
            Kim,Y.J. and Kim,K.K.
  TITLE     KAI1 COOH-terminal interacting tetraspanin (KITENIN), a member of
            the tetraspanin family, interacts with KAI1, a tumor metastasis
            suppressor, and enhances metastasis of cancer
  JOURNAL   Cancer Res. 64 (12), 4235-4243 (2004)
   PUBMED   15205336
REFERENCE   9  (bases 1 to 8691)
  AUTHORS   Yagyu,R., Hamamoto,R., Furukawa,Y., Okabe,H., Yamamura,T. and
            Nakamura,Y.
  TITLE     Isolation and characterization of a novel human gene, VANGL1, as a
            therapeutic target for hepatocellular carcinoma
  JOURNAL   Int. J. Oncol. 20 (6), 1173-1178 (2002)
   PUBMED   12011995
REFERENCE   10 (bases 1 to 8691)
  AUTHORS   Katoh,M.
  TITLE     Molecular cloning and characterization of Strabismus 2 (STB2)
  JOURNAL   Int. J. Oncol. 20 (5), 993-998 (2002)
   PUBMED   11956595
  REMARK    GeneRIF: Molecular cloning and characterization of Strabismus 2
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from BM552933.1, AB075805.1 and
            AL450389.12.
            This sequence is a reference standard in the RefSeqGene project.
            On Dec 9, 2005 this sequence version replaced gi:20373170.
            
            Summary: This gene encodes a member of the tretraspanin family. The
            encoded protein may be involved in mediating intestinal trefoil
            factor induced wound healing in the intestinal mucosa. Mutations in
            this gene are associated with neural tube defects. Alternate
            splicing results in multiple transcript variants. [provided by
            RefSeq, Feb 2010].
            
            Transcript Variant: This variant (1) represents the longest
            transcript and encodes the longer isoform (1). Both variants 1 and
            2 encode the same isoform (1).
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: BC065272.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025085, ERS025087 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-503               BM552933.1         20-522
            504-2321            AB075805.1         245-2062
            2322-8691           AL450389.12        55279-61648
FEATURES             Location/Qualifiers
     source          1..8691
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p13.1"
     gene            1..8691
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="VANGL planar cell polarity protein 1"
                     /db_xref="GeneID:81839"
                     /db_xref="HGNC:15512"
                     /db_xref="HPRD:18279"
                     /db_xref="MIM:610132"
     exon            1..134
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       46
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:116216703"
     variation       48
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:191609592"
     exon            135..342
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       157
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181583261"
     misc_feature    206..208
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="upstream in-frame stop codon"
     variation       217
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371591397"
     variation       234
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:78368849"
     variation       240
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371100144"
     variation       243
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375618149"
     variation       254
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185393860"
     CDS             272..1846
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="isoform 1 is encoded by transcript variant 1;
                     strabismus 2; KAI1 C-terminal interacting tetraspanin;
                     vang-like protein 1; van Gogh-like protein 1; loop-tail
                     protein 2 homolog; vang-like 1 (van gogh, Drosophila)"
                     /codon_start=1
                     /product="vang-like protein 1 isoform 1"
                     /protein_id="NP_620409.1"
                     /db_xref="GI:20373171"
                     /db_xref="CCDS:CCDS883.1"
                     /db_xref="GeneID:81839"
                     /db_xref="HGNC:15512"
                     /db_xref="HPRD:18279"
                     /db_xref="MIM:610132"
                     /translation="
MDTESTYSGYSYYSSHSKKSHRQGERTRERHKSPRNKDGRGSEKSVTIQPPTGEPLLGNDSTRTEEVQDDNWGETTTAITGTSEHSISQEDIARISKDMEDSVGLDCKRYLGLTVASFLGLLVFLTPIAFILLPPILWRDELEPCGTICEGLFISMAFKLLILLIGTWALFFRKRRADMPRVFVFRALLLVLIFLFVVSYWLFYGVRILDSRDRNYQGIVQYAVSLVDALLFIHYLAIVLLELRQLQPMFTLQVVRSTDGESRFYSLGHLSIQRAALVVLENYYKDFTIYNPNLLTASKFRAAKHMAGLKVYNVDGPSNNATGQSRAMIAAAARRRDSSHNELYYEEAEHERRVKKRKARLVVAVEEAFIHIQRLQAEEQQKAPGEVMDPREAAQAIFPSMARALQKYLRITRQQNYHSMESILQHLAFCITNGMTPKAFLERYLSAGPTLQYDKDRWLSTQWRLVSDEAVTNGLRDGIVFVLKCLDFSLVVNVKKIPFIILSEEFIDPKSHKFVLRLQSETSV
"
     misc_feature    338..1843
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /note="Strabismus protein; Region: Strabismus; pfam06638"
                     /db_xref="CDD:148316"
     misc_feature    623..685
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     misc_feature    725..787
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     misc_feature    818..880
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     misc_feature    938..1000
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q8TAA9.1);
                     transmembrane region"
     variation       307
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:371629555"
     variation       338
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374630481"
     exon            343..475
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       344
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61734296"
     variation       348
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143990097"
     variation       369
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78535164"
     variation       371
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372052239"
     variation       374
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375505955"
     variation       375
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369543626"
     variation       385
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201840785"
     variation       422
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200391853"
     exon            476..1083
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       502
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:186509771"
     variation       509
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:139472200"
     variation       516
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371028647"
     variation       519
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146695372"
     variation       520
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146495414"
     STS             536..1535
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="Vangl1"
                     /db_xref="UniSTS:532467"
     variation       540
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374024136"
     variation       545
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143196463"
     variation       556
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140451005"
     variation       578
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147048524"
     variation       583
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146723580"
     variation       594
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141673853"
     variation       601
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41275546"
     variation       613
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141525464"
     variation       614
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370292117"
     variation       616
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:79828493"
     variation       617
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:4839469"
     variation       668
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141482063"
     variation       676
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200325939"
     variation       706
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34768472"
     variation       753
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:201871883"
     variation       763
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372165510"
     variation       781
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368383358"
     variation       788
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200535188"
     variation       789
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148341022"
     variation       794
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142594314"
     variation       795
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201441696"
     variation       808
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201493360"
     variation       817
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143094973"
     variation       847
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146175997"
     variation       897
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201593132"
     variation       911
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143395094"
     variation       920
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:373384296"
     variation       952
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201698322"
     variation       956
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143956994"
     variation       985
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376477305"
     variation       986
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121918218"
     variation       991
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200762200"
     variation       1015
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148388816"
     variation       1023
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201630629"
     variation       1036
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368722418"
     variation       1037
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199932833"
     variation       1051
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373473714"
     variation       1058
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377435467"
     variation       1078
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200039235"
     exon            1084..1217
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1092
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:121918219"
     variation       1109
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370403671"
     variation       1118
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139744440"
     variation       1139
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145309218"
     variation       1155
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:77983133"
     variation       1156
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201705477"
     variation       1167
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:142348368"
     variation       1173
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373814054"
     variation       1192
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:148965020"
     variation       1210
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367774972"
     exon            1218..1350
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1231
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143754434"
     variation       1248
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141396495"
     variation       1254
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:121918220"
     variation       1272
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368071458"
     variation       1275
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199526468"
     variation       1284
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:74117015"
     variation       1295
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137860752"
     variation       1311
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34059106"
     variation       1312
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149279018"
     variation       1321
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147220426"
     exon            1351..1585
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1398
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200389969"
     variation       1437
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:151256445"
     variation       1438
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376015336"
     variation       1443
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:140485834"
     variation       1450
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370067272"
     variation       1460
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373242373"
     variation       1468
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376174821"
     variation       1503
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369450463"
     variation       1517
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146596086"
     variation       1529
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189584852"
     variation       1570
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145137292"
     variation       1571
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143016040"
     exon            1586..8691
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /inference="alignment:Splign:1.39.8"
     variation       1598
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371428273"
     variation       1611
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148199776"
     variation       1612
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150326572"
     STS             1649..1799
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="SHGC-75371"
                     /db_xref="UniSTS:73877"
     variation       1715
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143622439"
     variation       1741
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:199542978"
     variation       1762..1763
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34903463"
     variation       1762
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200739468"
     variation       1800
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375459125"
     variation       1805
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140596381"
     variation       1820
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184905686"
     variation       1821
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148512517"
     variation       1854
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377233845"
     variation       1869
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202050152"
     variation       1870..1871
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:151052987"
     variation       1891
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376792729"
     variation       1893
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:190792695"
     variation       1929
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3811013"
     variation       1962
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147518221"
     variation       2063
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41299565"
     variation       2064
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183938394"
     variation       2079
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188834002"
     variation       2132
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140372918"
     variation       2146
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41310108"
     variation       2147
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:193075321"
     variation       2159
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811012"
     variation       2229
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:75277108"
     variation       2262
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811011"
     variation       2267
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:183137974"
     variation       2322
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:187145225"
     variation       2351
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6700610"
     variation       2540
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:41312690"
     variation       2568
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191916791"
     variation       2768
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142123586"
     variation       2870
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1140940"
     variation       2889
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150705915"
     variation       2899
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184219889"
     variation       2954
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189281695"
     variation       3029
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200424846"
     variation       3029
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:3841008"
     variation       3089
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192418098"
     variation       3123
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3204955"
     variation       3242
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185557879"
     variation       3361
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139030532"
     variation       3391
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:117337677"
     STS             3441..3632
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH26190"
                     /db_xref="UniSTS:84486"
     variation       3471
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376483138"
     variation       3473
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149888685"
     STS             3495..3619
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="SHGC-75372"
                     /db_xref="UniSTS:59289"
     variation       3498
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146512242"
     variation       3534
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374184679"
     variation       3587
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199831777"
     variation       3594
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143344734"
     variation       3595
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3811010"
     variation       3597
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3811009"
     variation       3618
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114033235"
     variation       3620..3621
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="ta"
                     /db_xref="dbSNP:374697813"
     variation       3728
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:190492027"
     STS             3761..3948
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH102185"
                     /db_xref="UniSTS:96519"
     variation       3774
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374222902"
     variation       3855
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181543393"
     variation       3889
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74117021"
     variation       3967
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184469057"
     variation       4005
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376302608"
     variation       4032
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375230119"
     variation       4033
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146730302"
     polyA_signal    4135..4140
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     polyA_site      4158
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     variation       4175
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188964296"
     variation       4182
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148944333"
     variation       4197
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12121158"
     variation       4335
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41299571"
     variation       4382
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377292403"
     variation       4427
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3811008"
     variation       4490
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372511903"
     variation       4520
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181039153"
     variation       4711
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114921471"
     variation       4869
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:10923204"
     variation       4923
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:185557143"
     variation       4969
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143712039"
     variation       4996
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148126079"
     variation       5003
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:114196858"
     variation       5102
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374942113"
     variation       5146
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190894422"
     variation       5181
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61732172"
     variation       5182
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:61732170"
     variation       5223
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:367988126"
     variation       5225
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61797707"
     variation       5227
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:61797708"
     variation       5230
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:181008715"
     variation       5255
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140931431"
     variation       5263
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76160883"
     variation       5342
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4839472"
     variation       5368
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:78917287"
     variation       5390
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74117023"
     variation       5444
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:187286147"
     variation       5499
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146435279"
     variation       5513
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1128100"
     variation       5588
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:115376031"
     variation       5605..5608
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="aaac"
                     /db_xref="dbSNP:144395099"
     STS             5646..5840
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="D1S3610"
                     /db_xref="UniSTS:66759"
     variation       5665
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139328749"
     STS             5735..5909
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH70098"
                     /db_xref="UniSTS:69412"
     variation       5791
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192127758"
     variation       5902
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183004818"
     variation       5911
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:187382548"
     polyA_signal    5915..5920
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     variation       5934
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:138659832"
     polyA_site      5936
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     variation       5948
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:369489322"
     variation       6060
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112297385"
     variation       6065
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:190660373"
     variation       6092
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147501140"
     variation       6182
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:113030671"
     variation       6193
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138485279"
     variation       6258
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149626166"
     variation       6324
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17034226"
     variation       6350
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17034228"
     variation       6476
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:58002309"
     variation       6575
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182580560"
     variation       6577
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144489409"
     variation       6598
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370211174"
     variation       6634
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:148437823"
     variation       6776
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377056964"
     variation       6799
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369257328"
     variation       6854
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:117347999"
     variation       6881
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188051509"
     variation       7112
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17034230"
     variation       7113
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:75064936"
     variation       7126
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:148451859"
     variation       7132
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192672583"
     variation       7174
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184529007"
     variation       7214
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10494179"
     variation       7268
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:189009112"
     variation       7290
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:142497673"
     variation       7312
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192325588"
     variation       7342..7345
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="actt"
                     /db_xref="dbSNP:111232035"
     variation       7474
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374395998"
     variation       7479
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:4348723"
     variation       7563
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145945936"
     variation       7588
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371583408"
     variation       7597
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10801933"
     variation       7650
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:76569370"
     variation       7654
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184708484"
     variation       7687
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4548441"
     variation       7702
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:188827143"
     variation       7841
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:4595366"
     variation       7872
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:6428677"
     variation       7974
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181588954"
     variation       8045
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:3811007"
     variation       8058
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3811006"
     variation       8083
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:184820374"
     variation       8162
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:139953261"
     variation       8167
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:77318780"
     variation       8259
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:189697580"
     variation       8289
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:7414259"
     STS             8443..8624
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /standard_name="RH99220"
                     /db_xref="UniSTS:85528"
     variation       8455
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375912178"
     variation       8567
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17034249"
     variation       8602..8603
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:5777244"
     variation       8608..8609
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:369126863"
     variation       8610..8611
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:67579944"
     polyA_signal    8670..8675
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
     polyA_site      8688
                     /gene="VANGL1"
                     /gene_synonym="KITENIN; LPP2; STB2; STBM2"
ORIGIN      
aggaagcggaaagcagcagtgcagcggcggcggcggcggggctctgcctctccaggagcccagcgcaggccgcagagccggggccgctgtgagccgagaccgcgggccgcggagctcgggcggccggcgcggagaatttgttcctgttgaagagtggctcctcttctaatttccagactccttgaggttttaggagtctggtaggtgaaattttctacctctaaggagaaacagtacctgctccttcctcaagcgcaagccctccattgctatggataccgaatccacttattctggatattcttactattcaagtcattcgaaaaaatctcacagacaaggggaaagaactagagagagacacaagtcaccccggaataaagacggcagagggtcagaaaagtctgtcaccattcaacctcccactggagagcccctgttgggaaatgattctactcggacagaggaagttcaggatgacaactggggagagaccaccacggccatcacaggcacctcggagcacagcatatcccaagaggacattgccaggatcagcaaggacatggaggacagcgtggggctggattgcaaacgctacctgggcctcaccgtcgcctcttttcttggacttctagttttcctcacccctattgccttcatccttttacctccgatcctgtggagggatgagctggagccttgtggcacaatttgtgaggggctctttatctccatggcattcaaactcctcattctgctcatagggacctgggcactttttttccgcaagcggagagctgacatgccacgggtgtttgtgtttcgtgcccttttgttggtcctcatctttctctttgtggtttcctattggcttttttacggggtccgcattttggactctcgggaccggaattaccagggcattgtgcaatatgcagtctcccttgtggatgccctcctcttcatccattacctggccatcgtcctgctggagctcaggcagctgcagcccatgttcacgctgcaggtggtccgctccaccgatggcgagtcccgcttctacagcctgggacacctgagtatccagcgagcagcattggtggtcctagaaaattactacaaagatttcaccatctataacccaaacctcctaacagcctccaaattccgagcagccaagcatatggccgggctgaaagtctacaatgtagatggccccagtaacaatgccactggccagtcccgggccatgattgctgcagctgctcggcgcagggactcaagccacaacgagttgtattatgaagaggccgaacatgaacggcgagtaaagaagcggaaagcaaggctggtggttgcagtggaagaggccttcatccacattcagcgtctccaggctgaggagcagcagaaagccccaggggaggtgatggaccctagggaggccgcccaggccattttcccctccatggccagggctctccagaagtacctgcgcatcacccggcagcagaactaccacagcatggagagcatcctgcagcacctggccttctgcatcaccaacggcatgacccccaaggccttcctagaacggtacctcagtgcgggccccaccctgcaatatgacaaggaccgctggctctctacacagtggaggcttgtcagtgatgaggctgtgactaatggattacgggatggaattgtgttcgtccttaagtgcttggacttcagcctcgtagtcaatgtgaagaaaattccattcatcatactctctgaagagttcatagaccccaaatctcacaaatttgtccttcgcttacagtctgagacatccgtttaaaagttctatatttgtggctttattaaaaaaaaaagaaaaatatatagagagatatatatctatgccagaggggtgtcttttttaaaaattcttcttcattgctgactgaaactggcagatgattgaccagtatcctttgaccatctgcactttatttggaaggaagcaggggctgtccaccctgaaaaagagtgactgatgacatctgacttttgtcgatgggacttctcaagaagccattccttggagcttctgttacagctgtaaaccaaagtggagctggtgcttcttgggagcctcgccttacaactaattcctgcctttcgtccagtaccaagtcccccgttgcttctggtcagcccacttgtagacttccaggggacacatctttattctgtttcaggaaaccagtcacgacacgtccacatatgtatttgtgtatgttaatgtccagtatcacatcacccatgaaagtcgtgggcagttcaggagatacctgccttcatctttgttctttgttgccttaggttcttcagagaaagatcacaacaaaaaatgtacactgtcgtttacagctattaagtgatttgattttgtttttttcccaaagagaaaacctacctgccctgtttctgatcccacccctctgctggcttgaagcaggtaaccctttcccagccctgcagctgcccacctggcctccatgccatcctgcccccacctggctggcagccctggctctccatgtgtgccctccggctctgtgtgaagcctcaagtcagtcccagcattgtttccatagggaagtgtggggtgcccagcaggtaaagcacagggagagagggcagtgggaatgccacctttaggctgcagcaggagccccacactgcccagttttcctccccactgttctacaccaaccaggggagactaacactgtgactctgggattggcaggtgcaacttggagccacttaatttcctggggacgtaagttcttcccaagcttagagcaagctgccctgccaaaggagaccaaaccatgccaaccacgctggcaactgctgctgtccagtccctgtgttttctgaccaccgtcactgtgcaactcatcgcctctgccacttaggaccaggaaagaggctggttttgctcccactcttagttgctgataaagtggggagaaggaaaatggacactctacagagtttggggaagggagagtagggagcccatcttgtccagaaagattcatctgtggtctgtctgttaaacacagctgatttcagtgggctttcccctggccctgggggagcagacactgactgggttgtgggcagaggagccatcctggcggagccctgctgcaggggagctccttcaggagccccatccggacctcttgcactgggctgcctttgcctccatttgccttcctgtatctgcaacaaaccttttaaaagtgttcactcttgctttttccagtatttcggtaatcagccatcttgctgtagtacaggatgacattgtcgaatgctctttgtatgtgtgcacacccccttactcccttactgcttcatacactccacaagtggtacagtattttgtgtcattgtaaaaatcaaaattggctttggatctttgtaatacacctgtacctgaaaaagtaaacaacattcttcaattactagccttcagcttgaaaagacatgctggagaagaaggaagggggaacccataggtgtggcgtggagccaagatgtactattcaactatgtgtttctgtttataaaaaacacataccatggaaccatggtgcttttgttcttagtttttgccgttagatcccttcaaactggaagttccttacaatatctttctcaggaaatattttgggaaatggggtaagagatggcaagtgtgagacgggctgtgtcagaggttgctacgtcatggatacagtgcagttccaagtgccataagtgtatgtacatatagttaataatgacactgttcatcaccattctaaaatactgttcttccaaccctatcttcaatgaccagtccagaaggggttaagctggattcatttgctctggcatgtgcattcccagcagggtgaagaaaggtttaaattaaagaatttattttctctctcccccttcctctttctcccagtctttgcataggagaatgttagacattcagaaattactgtttctgttttaaattgagtattgatttttttatattgactttgtattgagttctttttgaaagaataacaaaataaaatgcaggatctttgtaaagcctttgcactttcaacctctttatagcttgagttacttttgcagtgggaacaatgtaaatgacatttaaaagatttaaggtttcagaaagctgcatcccacaattgaacacaatgcatttttatttcaattcttggaactggtaggctattctttttaaaagggggtaaacttcgccctaaggctggtagaatgtatgttcacattatagtagacaggatttcatttgccttatatgtttatagattttttataattttcatcctacgttattaaaattagagcattgagtgttaaagaacttaatgaggagtctatatctgagattgctctcttccctggtgatgttttaactggtagataatttgttcttaaatatgtacttttgaagataggacagtttttatagtccatgaactgaatgttaaaaagttctgtatgcattctcagagaggattttaaagctatatagttcatccatcctttgcattatcaaaatgttaagtcaaatctgtaatactttggctaaaattcataaagtaagccctagagaaaatacttgaccaccaaatttttgcccaactatcatcacctcccttcccccgcctctgttcttgccttttgacatctacatggaagacaagttctttacagcaaatggtaagaggcaggtgacctggtgtgtttgctgtgttgtagttcattgcctggggcttgggactccttttttaatggagagactagctgtgcaggtgtgtgttggatagggataaagtgctcacccctgccctctctacagtagttggtggtagatttctctctcattttgcctcataatcactttcgagtgcatgtatttacctaagggctgtagctctgtgggatgctaccagcatattggactgacagaaattgattaccttgccactccaacctacgtactgagtgagtgctccagccactcagtgaaaccaacaaaagtgagtccttggtttaccttccaatctgggtcctgctgtgtaagtatccctaagtggggatgcatatttgtttgtgcgtttttatttccatatatgtgagcatttctctgagtgtattaccagacggatagcacatttatatgtcagacatcttaacatctgtgttatctgtagcaggtgtgtagctcagcagatacgtgtcattgtgtatatagctgagtgtgtgagggtgtctgtgtttctgcagtcccctgtgtttgagagatgacttaataaccctgtgttttgagaggtcgctctaaaccagtgacttttccctcccctgctttattcctttccctcactgacactggcttctcccgctagagtaaatggctttagcacagcactgtcttctggggagcctgctgtcctgcaggcaagtccattaaactctttcttgctttaggactctgaaaacagcaagaaacaaacaaacaaaggtcaagctctaagaaaattactgctcaaacttcactaccctggaagccttactagatatttcttaaggtaacttaaaaattgggctttatttttaaaaagtgataggttacttacagtagcacagaaatgttagcatatttatttaaatagtcctgcagcagagaccctgcgattgtaaagtgatttaagtatttctgggtagtgtttgtgatttacggatttgttactgaaaaacaaaaaaatcactactgtgaatttactactatgtaaccttgtggtcgtatttcattataaataaaataagaattgctcttctgcccaccgttcttgattggtattcagtgcagtagcgaaatgagatagtttagacactgttgaaataactgcattgagctttaaccaagtgtatgctcagaaaattcagttttggatcacattttgacaaaacatgttttggtcaaagaaaggaaaggctactaacacatttatcaggtaatgtatgtcacagtccgtgttccacccagccttgttatccccacattctttcaagataggagtcatcttggtttttcgggtgaaaaacggaaggtcagagaggaaggggcttgtccaaggtctcatgtctggttaacagaatttcaaactagatgtttgattctaacccctcagtccactgtaccttgaagtatggtctaaatgattcggcacttctggatgttgaggaaggacctagagacacatccttgaactagaacctggggtgagagttcattgggaggcaggatctcttctttcactttggatttacaccttgtcccttggaaagcttctccactatgctagcaaatatcttaggatatttgatggaaagaacttgagaatcccttctggaaaacccagcctttcagtgttaacacctgctgcaagacagggatgctgttgttctggcagcccccctttgcttttgcctggccccaccttctgctcccactctgctggcttgggcaagatgcgtgccttgggccttgggtgcagggaggcaggcaggggcttgacctggcctctctctggtgccatggcaacattatgccccaaacttcttccctggttggagtgagaggggctgtccacagccccatcctgtggggatctcaagccggagtccctggcctggcctccttgacgtaggtgttctcagcaagcagtttgcatcccaccgtctttctcacacttgcccccaagacttttgacagagcagacgtaaaacaggactcagaaaaccatttttctctgttcccatatgtagtaagttttgattcagttgtgcataaaccatagttttctgccctgctgtttgctttcaatggaagacagtaaagggaagatggtgctcacatctctccatgtgacatctcattaggaattaagatgcgatggattagaaatgtaaaacttcagaataaaattaaatttcagggctctataagtcccgttttcccaggtcctgttccgtttctacgtagataacccaatttgttttgtctatgaaataagcctctttagtgggttgttttagtctctccaacaaaagagcagattcctaaagccaggtgcagcactgtgaaaagtttctttcaatatggcaccaagactctaccatttatgtctctctcagcttacaaacatcagcgttttgtccttgtcatagtggaagaaagacacttactttaagctttggggacaaaggtgacaaaccccaggcttttatcttaaaagtgtctttggcacttcttttggcactgaaatggtatttgggaagcattatttgaatgtacagttgtttggttttgtatgtgcttatctttatctgagctttcacttgtagacatggccttttgttgtgaagttgctcatcatttaggagtgtttaattctaaaaagccttcagcctaagaaagcttcatctgtggggaccagagacttgttgctcagggagttagtgatgggacttgggcatctgatctgcaggtgacaagtttagttcaactgaagttgtagggaatttagacagttgcacatcattgccgttctaggggccttgtagaaagatgaaacagttgtttttcatttaccagcacctctcagttatagaggtaatggaacattcgcttacttttcatcatcattctttaaaaagggaacatacaaaaatctaaactatggcaataatttatttttataatagtttacggtaggctttaattaaatggcaaactcctctgggacccctaagttatggcgtgattagccaaatttgatttccaacagtcatttatggccataactattgcatagagtgcaggatgccagcaaagatgagggtgggggcagatactggctcagtgatttaactcacattatagatgaccccttcctcaacagaaatgctactgagagaaccagagaggcctgggccaggcaggtcttatttgagaggagattatttgataattgctttggttagaaggactttacatttcctgatttcaagtccagcaccaatttagaaagttcagagatgaaaccacctgtctttacctgacagagtcataacggtttgtgtaaaaatgtggtcagggaccttttttgttctttctgattagttaatactgtacattgtaaccaggaggggcagttttgccaaccagcctctgctcatggtcaccatatgtgtatgacaaggcctgagtgagttcctgcataaactgggtagtgggctcttttgacacatttgcaagcatgtaaatgaatgaatgacactaccagcaaccatctgtacaggtccatttacttacattcataaggtttatgctatgaaacttcttctcattgtgatgtcagtaacagagttagtgtctctgatggaatagtgtacctgtcacccaagttattttgttcctttttgggtcctccagtataatccccccctcatcccaattaactgtaaaatgttttacacatcacattttttatactgtaaacttggaaaataaactgaaatatcaaattg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:81839 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:81839 -> Biological process: GO:0007275 [multicellular organismal development] evidence: IEA
            GeneID:81839 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.