GGRNA Home | Help | Advanced search

2020-10-24 06:47:55, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_138709               3500 bp    mRNA    linear   PRI 15-JUL-2013
DEFINITION  Homo sapiens DAB2 interacting protein (DAB2IP), transcript variant
            2, mRNA.
ACCESSION   NM_138709
VERSION     NM_138709.1  GI:41281682
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3500)
  AUTHORS   Xu,S., Zhou,Y., Du,W.D., Chen,G., Zhou,F.S., Schneider,M., Ma,X.L.,
            Xu,H.Y. and Zhang,X.J.
  TITLE     Association of the variant rs2243421 of human DOC-2/DAB2
            interactive protein gene (hDAB2IP) with gastric cancer in the
            Chinese Han population
  JOURNAL   Gene 515 (1), 200-204 (2013)
   PUBMED   23246699
  REMARK    GeneRIF: Our results for the first time provided new insight into
            susceptibility factors of hDAB2IP gene variants in carcinogenesis
            of gastric cancer.
REFERENCE   2  (bases 1 to 3500)
  AUTHORS   Del-Aguila,J.L., Beitelshees,A.L., Cooper-Dehoff,R.M.,
            Chapman,A.B., Gums,J.G., Bailey,K., Gong,Y., Turner,S.T.,
            Johnson,J.A. and Boerwinkle,E.
  TITLE     Genome-wide association analyses suggest NELL1 influences adverse
            metabolic response to HCTZ in African Americans
  JOURNAL   Pharmacogenomics J. (2013) In press
   PUBMED   23400010
  REMARK    Publication Status: Available-Online prior to print
REFERENCE   3  (bases 1 to 3500)
  AUTHORS   Yu,L., Tumati,V., Tseng,S.F., Hsu,F.M., Kim,D.N., Hong,D.,
            Hsieh,J.T., Jacobs,C., Kapur,P. and Saha,D.
  TITLE     DAB2IP regulates autophagy in prostate cancer in response to
            combined treatment of radiation and a DNA-PKcs inhibitor
  JOURNAL   Neoplasia 14 (12), 1203-1212 (2012)
   PUBMED   23308052
  REMARK    GeneRIF: In this study, we show a novel function of DAB2IP in
            suppressing radiation-induced and DNA-PKcs-associated autophagy and
            promoting apoptosis in prostate cancer cells.
REFERENCE   4  (bases 1 to 3500)
  AUTHORS   Ji,W., Li,Y., Wan,T., Wang,J., Zhang,H., Chen,H. and Min,W.
  TITLE     Both internalization and AIP1 association are required for tumor
            necrosis factor receptor 2-mediated JNK signaling
  JOURNAL   Arterioscler. Thromb. Vasc. Biol. 32 (9), 2271-2279 (2012)
   PUBMED   22743059
  REMARK    GeneRIF: Both internalization and ASK1-interacting protein-1
            association are required for TNFR2-dependent JNK and apoptotic
            signaling in endothelial cells.
REFERENCE   5  (bases 1 to 3500)
  AUTHORS   Divaris,K., Monda,K.L., North,K.E., Olshan,A.F., Lange,E.M.,
            Moss,K., Barros,S.P., Beck,J.D. and Offenbacher,S.
  TITLE     Genome-wide association study of periodontal pathogen colonization
  JOURNAL   J. Dent. Res. 91 (7 SUPPL), 21S-28S (2012)
   PUBMED   22699663
REFERENCE   6  (bases 1 to 3500)
  AUTHORS   von Bergh,A.R., Wijers,P.M., Groot,A.J., van Zelderen-Bhola,S.,
            Falkenburg,J.H., Kluin,P.M. and Schuuring,E.
  TITLE     Identification of a novel RAS GTPase-activating protein (RASGAP)
            gene at 9q34 as an MLL fusion partner in a patient with de novo
            acute myeloid leukemia
  JOURNAL   Genes Chromosomes Cancer 39 (4), 324-334 (2004)
   PUBMED   14978793
REFERENCE   7  (bases 1 to 3500)
  AUTHORS   Zhang,R., He,X., Liu,W., Lu,M., Hsieh,J.T. and Min,W.
  TITLE     AIP1 mediates TNF-alpha-induced ASK1 activation by facilitating
            dissociation of ASK1 from its inhibitor 14-3-3
  JOURNAL   J. Clin. Invest. 111 (12), 1933-1943 (2003)
   PUBMED   12813029
REFERENCE   8  (bases 1 to 3500)
  AUTHORS   Chen,H., Toyooka,S., Gazdar,A.F. and Hsieh,J.T.
  TITLE     Epigenetic regulation of a novel tumor suppressor gene (hDAB2IP) in
            prostate cancer cell lines
  JOURNAL   J. Biol. Chem. 278 (5), 3121-3130 (2003)
   PUBMED   12446720
  REMARK    GeneRIF: Epigenetic regulation of this novel tumor suppressor gene
            in prostate cancer cell lines.
REFERENCE   9  (bases 1 to 3500)
  AUTHORS   Wang,Z., Tseng,C.P., Pong,R.C., Chen,H., McConnell,J.D., Navone,N.
            and Hsieh,J.T.
  TITLE     The mechanism of growth-inhibitory effect of DOC-2/DAB2 in prostate
            cancer. Characterization of a novel GTPase-activating protein
            associated with N-terminal domain of DOC-2/DAB2
  JOURNAL   J. Biol. Chem. 277 (15), 12622-12631 (2002)
   PUBMED   11812785
REFERENCE   10 (bases 1 to 3500)
  AUTHORS   Chen,H., Pong,R.C., Wang,Z. and Hsieh,J.T.
  TITLE     Differential regulation of the human gene DAB2IP in normal and
            malignant prostatic epithelia: cloning and characterization
  JOURNAL   Genomics 79 (4), 573-581 (2002)
   PUBMED   11944990
  REMARK    GeneRIF: Normal prostatic epithelial cells have elevated DAB2IP
            mRNA compared with cancer cells, which correlates with increased
            DAB2IP promoter activity.
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            AY032952.1.
            
            Summary: DAB2IP is a Ras (MIM 190020) GTPase-activating protein
            (GAP) that acts as a tumor suppressor. The DAB2IP gene is
            inactivated by methylation in prostate and breast cancers (Yano et
            al., 2005 [PubMed 15386433]).[supplied by OMIM, May 2010].
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AY032952.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..3500
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="9"
                     /map="9q33.1-q33.3"
     gene            1..3500
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /note="DAB2 interacting protein"
                     /db_xref="GeneID:153090"
                     /db_xref="HGNC:17294"
                     /db_xref="HPRD:09903"
                     /db_xref="MIM:609205"
     exon            1..137
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     misc_feature    73..75
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /note="upstream in-frame stop codon"
     variation       118
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:186756127"
     exon            138..291
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       140
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:202163855"
     CDS             148..3345
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /note="isoform 2 is encoded by transcript variant 2;
                     ASK1-interacting protein 1; nGAP-like protein; DOC-2/DAB2
                     interactive protein; disabled homolog 2-interacting
                     protein; DAB2 interaction protein; DAB2-interacting
                     protein; ASK-interacting protein 1; DOC-2/DAB-2
                     interactive protein"
                     /codon_start=1
                     /product="disabled homolog 2-interacting protein isoform
                     2"
                     /protein_id="NP_619723.1"
                     /db_xref="GI:41281683"
                     /db_xref="CCDS:CCDS6832.1"
                     /db_xref="GeneID:153090"
                     /db_xref="HGNC:17294"
                     /db_xref="HPRD:09903"
                     /db_xref="MIM:609205"
                     /translation="
MPRLKESRSHESLLSPSSAVEALDLSMEEEVVIKPVHSSILGQDYCFEVTTSSGSKCFSCRSAAERDKWMENLRRAVHPNKDNSRRVEHILKLWVIEAKDLPAKKKYLCELCLDDVLYARTTGKLKTDNVFWGEHFEFHNLPPLRTVTVHLYRETDKKKKKERNSYLGLVSLPAASVAGRQFVEKWYPVVTPNPKGGKGPGPMIRIKARYQTITILPMEMYKEFAEHITNHYLGLCAALEPILSAKTKEEMASALVHILQSTGKVKDFLTDLMMSEVDRCGDNEHLIFRENTLATKAIEEYLKLVGQKYLQDALGEFIKALYESDENCEVDPSKCSAADLPEHQGNLKMCCELAFCKIINSYCVFPRELKEVFASWRQECSSRGRPDISERLISASLFLRFLCPAIMSPSLFNLLQEYPDDRTARTLTLIAKVTQNLANFAKFGSKEEYMSFMNQFLEHEWTNMQRFLLEISNPETLSNTAGFEGYIDLGRELSSLHSLLWEAVSQLEQSIVSKLGPLPRILRDVHTALSTPGSGQLPGTNDLASTPGSGSSSISAGLQKMVIENDLSGLIDFTRLPSPTPENKDLFFVTRSSGVQPSPARSSSYSEANEPDLQMANGGKSLSMVDLQDARTLDGEAGSPAGPDVLPTDGQAAAAQLVAGWPARATPVNLAGLATVRRAGQTPTTPGTSEGAPGRPQLLAPLSFQNPVYQMAAGLPLSPRGLGDSGSEGHSSLSSHSNSEELAAAAKLGSFSTAAEELARRPGELARRQMSLTEKGGQPTVPRQNSAGPQRRIDQPPPPPPPPPPAPRGRTPPNLLSTLQYPRPSSGTLASASPDWVGPSTRLRQQSSSSKGDSPELKPRAVHKQGPSPVSPNALDRTAAWLLTMNAQLLEDEGLGPDPPHRDRLRSKDELSQAEKDLAVLQDKLRISTKKLEEYETLFKCQEETTQKLVLEYQARLEEGEERLRRQQEDKDIQMKGIISRLMSVEEELKKDHAEMQAAVDSKQKIIDAQEKRIASLDAANARLMSALTQLKERYSMQARNGISPTNPTKLQITENGEFRNSSNC
"
     misc_feature    <202..375
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /note="Pleckstrin homology-like domain; Region: PH-like;
                     cl00273"
                     /db_xref="CDD:206947"
     misc_feature    order(262..273,283..297,316..330,349..375)
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /note="PH-like core; other site"
                     /db_xref="CDD:176275"
     misc_feature    382..801
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /note="C2 domain present in Ras GTPase activating protein
                     (GAP) family; Region: C2_SynGAP_like; cd04013"
                     /db_xref="CDD:175980"
     misc_feature    802..1722
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /note="The DAB2IP family of Ras GTPase-activating proteins
                     includes DAB2IP, nGAP, and Syn GAP. Disabled 2 interactive
                     protein, (DAB2IP; also known as ASK-interacting protein 1
                     (AIP1)), is a member of the GTPase-activating proteins,
                     down-regulates Ras-mediated...; Region: RasGAP_DAB2IP;
                     cd05136"
                     /db_xref="CDD:88576"
     misc_feature    order(889..891,1000..1002,1012..1023,1042..1044,
                     1318..1320,1342..1347,1354..1359,1441..1443,1462..1464,
                     1468..1470,1483..1488)
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /note="putative GAP/RAS interaction site [polypeptide
                     binding]; other site"
                     /db_xref="CDD:88576"
     misc_feature    1711..3252
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /note="Domain of unknown function (DUF3498); Region:
                     DUF3498; pfam12004"
                     /db_xref="CDD:152439"
     variation       152
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373885033"
     variation       153
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200818458"
     variation       157
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199832930"
     variation       158
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150226818"
     variation       166
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:188350283"
     variation       169
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138827521"
     variation       170
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201767314"
     variation       186
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:377575300"
     variation       197
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:370182641"
     variation       205
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148946129"
     variation       212
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373166769"
     variation       213
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143770081"
     variation       219
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138442421"
     variation       252
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35510547"
     variation       271
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201351997"
     exon            292..390
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       297
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190940502"
     variation       324
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370347740"
     variation       328
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147323804"
     variation       347
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200002701"
     variation       348
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374038020"
     variation       368
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368193656"
     variation       370
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:114266755"
     variation       375
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3747851"
     exon            391..945
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       401
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150710857"
     variation       482
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:199878386"
     variation       533
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367747884"
     variation       540
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34727342"
     variation       555
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201994635"
     variation       572
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200997326"
     variation       578
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376851410"
     variation       594
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149894049"
     variation       606
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:144040487"
     variation       613
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200273040"
     variation       624
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:41273440"
     variation       627
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34839326"
     variation       648
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146750250"
     variation       674
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369573008"
     variation       675
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202119015"
     variation       681
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140379738"
     variation       685
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373749384"
     variation       702
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142280608"
     variation       711
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375810712"
     variation       715
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201266598"
     variation       770
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201959346"
     variation       771
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34334373"
     variation       777
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:41273442"
     variation       816
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201057911"
     variation       829
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201397224"
     variation       847
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:112361531"
     variation       849
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143033667"
     variation       876
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150428926"
     variation       882
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138506377"
     variation       884
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:192522695"
     variation       920
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200565908"
     exon            946..1090
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       960
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:375600016"
     variation       988
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142519289"
     variation       993
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:370152633"
     variation       999
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372829760"
     variation       1012
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370747909"
     variation       1014
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146911285"
     variation       1024
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:80008292"
     variation       1083
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149420814"
     exon            1091..1235
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       1106
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371930308"
     variation       1108
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376373696"
     variation       1152
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:77220406"
     variation       1154
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:76191175"
     variation       1155
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373776876"
     variation       1158
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375557765"
     variation       1159
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141706892"
     variation       1171
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145965964"
     variation       1197
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376330730"
     variation       1200
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139934832"
     variation       1208
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368910721"
     exon            1236..1472
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       1242
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375151401"
     variation       1252
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:182562255"
     variation       1260
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374953875"
     variation       1267
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145267973"
     variation       1271
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200497980"
     variation       1272
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371966536"
     variation       1294
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373995748"
     variation       1295
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368453566"
     variation       1305
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372045771"
     variation       1319
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141771432"
     variation       1329
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201506332"
     variation       1346
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146233036"
     variation       1386
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375368221"
     variation       1394
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372284148"
     variation       1419
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:139420347"
     variation       1432
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:374667920"
     variation       1440
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:78398519"
     exon            1473..1674
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       1485
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143825896"
     variation       1492
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:113032925"
     variation       1497
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:376629723"
     variation       1588
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:200519908"
     variation       1591
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369754590"
     variation       1606
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376186048"
     variation       1642
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376861447"
     variation       1657
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:149945931"
     exon            1675..1853
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       1706
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371856149"
     variation       1719
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374196620"
     variation       1731
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368371667"
     variation       1749
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145735158"
     variation       1760
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148506189"
     variation       1787
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199563033"
     variation       1788
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371535507"
     variation       1800
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:376071498"
     variation       1821
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369300184"
     variation       1842
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:142889743"
     variation       1843
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147687395"
     variation       1850
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:186101367"
     exon            1854..2742
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       1870
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374349526"
     variation       1871
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377052245"
     variation       1890
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146791892"
     variation       1926
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147918500"
     variation       1930
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370343273"
     variation       1948
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200771794"
     variation       1957
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:140605079"
     variation       1974
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201508886"
     variation       1983
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150482022"
     variation       1998
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372674684"
     variation       2039
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199732967"
     variation       2045
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:200073956"
     variation       2049
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:368301140"
     variation       2055
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371971340"
     variation       2061
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:74792331"
     variation       2069
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:201992293"
     variation       2076
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370109988"
     variation       2079
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34301794"
     variation       2086
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372120275"
     variation       2094
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:189270684"
     variation       2103
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34923170"
     variation       2105
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373611896"
     variation       2116..2117
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34632435"
     variation       2124
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377593194"
     variation       2171
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370862211"
     variation       2177
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:137949148"
     variation       2212
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:149452173"
     variation       2220
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144586865"
     variation       2221
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34458419"
     variation       2222
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141593526"
     variation       2250
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146245060"
     variation       2256
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35706546"
     variation       2282
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141810290"
     variation       2283
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373684988"
     variation       2324
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:376857569"
     variation       2346
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:371528560"
     variation       2364
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150585317"
     variation       2371
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374731021"
     variation       2395
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:367690998"
     variation       2396
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139267584"
     variation       2409
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370257448"
     variation       2410
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:145366203"
     variation       2411
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147657880"
     variation       2412
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368800049"
     variation       2433
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373922763"
     variation       2434
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199598085"
     variation       2442
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:113815211"
     variation       2446
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:191595599"
     variation       2456
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:376519748"
     variation       2475
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368492360"
     variation       2486
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:183735294"
     variation       2487
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:372787392"
     variation       2494
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:56200518"
     variation       2572
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201889776"
     variation       2621
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:368754133"
     variation       2623
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373299937"
     variation       2637
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200577247"
     variation       2671
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:371407818"
     variation       2672
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:114838746"
     variation       2682
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:376759925"
     variation       2688
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147942555"
     variation       2704
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148978268"
     exon            2743..2895
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       2765
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:143836788"
     variation       2778
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:151122611"
     variation       2784
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141080470"
     variation       2793
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:144609886"
     variation       2805
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138505036"
     variation       2808
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371735785"
     variation       2820
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190856269"
     variation       2823
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199878545"
     variation       2828
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:367742152"
     variation       2842
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:141691348"
     variation       2846
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:145340237"
     variation       2848
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138053639"
     exon            2896..3089
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       2908
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78083431"
     variation       2913
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183020944"
     variation       2933
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149504970"
     variation       2982
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:147553080"
     variation       2985
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201092583"
     variation       3028
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374129525"
     variation       3052
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368342737"
     exon            3090..3177
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     variation       3090..3091
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace=""
                     /replace="t"
                     /db_xref="dbSNP:34016532"
     variation       3100
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200849707"
     STS             3110..3325
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /standard_name="MARC_10012-10013:996678884:1"
                     /db_xref="UniSTS:267012"
     variation       3126
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376673781"
     variation       3149
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:112159524"
     variation       3153
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:373962032"
     exon            3178..3500
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /inference="alignment:Splign:1.39.8"
     STS             3235..3367
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /standard_name="RH16168"
                     /db_xref="UniSTS:50704"
     variation       3265
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:117152313"
     variation       3366
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:80315580"
     variation       3378
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:56186860"
     variation       3490
                     /gene="DAB2IP"
                     /gene_synonym="AF9Q34; AIP-1; AIP1; DIP1/2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:199642322"
ORIGIN      
tgttcctcttctttcgtgttgtgtcagaagccatgatttccagtcttctcatctggaagatgaaggaaaagatagacccgaccccacagggttctgaggctcaaactgaaagcctggtggtggggcacctgtgacaggtcccatctgatgccgaggctgaaggagtctcgctcccacgagtccctgctcagccccagcagtgcggtggaggcgctggacctcagcatggaggaagaggtggtcatcaagcccgtgcacagcagcatccttggccaggactactgcttcgaggtgacgacgtcatcaggaagcaagtgcttttcctgccggtctgcagctgagcgggataagtggatggagaacctccggcgagcggtgcatcccaacaaggacaacagccggcgtgtggagcacatcctgaagctgtgggtgatcgaggccaaggacctgccagccaagaagaagtacctgtgcgagctgtgcctggacgatgtgctctatgcccgcaccacgggcaagctcaagacggacaatgttttctggggcgagcacttcgagttccacaacttgccgcctctgcgcacggtcactgtccacctgtaccgggagaccgacaagaagaagaagaaggagcgcaacagttacctgggcctggtgagcctacctgctgcctcggtggccgggcggcagttcgtggagaagtggtacccggtggtgacgcccaaccccaagggcggcaagggccctggacccatgatccgcatcaaggcgcgctaccaaaccatcaccatcctgcccatggagatgtacaaagagttcgctgagcacatcaccaaccactacctggggctgtgtgcagccctcgagcccatcctcagtgccaagaccaaggaggagatggcatctgccctggtgcacatcctgcagagcacgggcaaggtgaaggacttcctgacagacctgatgatgtcagaggtggaccgctgcggggacaacgagcacctcatcttccgggagaacacactggccaccaaggccattgaggagtacctcaagctagtgggccagaagtacctgcaggacgccctaggtgagttcatcaaagcgctgtatgagtcagatgagaactgcgaagtggatcccagcaagtgctcggccgctgacctcccagagcaccagggcaacctcaagatgtgctgcgagctggccttctgcaagatcatcaactcctactgtgtcttcccacgggagttgaaagaggtgtttgcctcgtggaggcaggagtgcagcagtcgcggccgcccggacatcagtgagcggctcatcagcgcctccctcttcctgcgcttcctctgcccagccatcatgtcgccctcactcttcaacctgctgcaggagtaccctgatgaccgcactgcccgcaccctcaccctcatcgccaaggtcacccagaacctggccaactttgccaaatttggcagcaaggaggaatacatgtccttcatgaaccagttcctagagcatgagtggaccaacatgcagcgcttcctgctggagatctccaaccccgagaccctctccaatacagccggcttcgagggctacatcgacctgggccgcgagctctccagcctgcactcactgctctgggaggccgtcagccagctggagcagagcatagtatccaaactgggacccctgcctcggatcctgagggacgtccacacagcactgagcaccccaggtagcgggcagctcccagggaccaatgacctggcctccacaccgggctctggcagcagcagcatctcagctgggctgcagaagatggtgattgagaacgatctttccggtctgatagatttcacccggttaccgtctccaacccccgaaaacaaggacttgttttttgtcacaaggtcctccggggtccagccctcacctgcccgcagctcgagttactcggaagccaacgagcctgatcttcagatggccaacggtggcaagagcctctccatggtggacctccaggacgcccgcacgctggatggggaggcaggctccccggcgggccccgacgtcctccccacagatgggcaggccgctgcagctcagctggtggccgggtggccggcccgggcaaccccagtgaacctggcagggctggccacggtgcggcgggcaggccagacaccaaccacaccaggcacctccgagggcgcgccaggccggccccagctgttggcaccgctctccttccagaaccctgtgtaccagatggcggctggcctgccgctgtcaccccgtggccttggcgactcaggctctgagggccacagctccctgagctcacacagcaacagcgaggagttggcggctgctgccaagctgggaagtttcagcactgccgcggaggagctggctcggcggcccggtgagctggcacggcgacagatgtcactgactgaaaaaggcgggcagcccacggtgccacggcagaacagtgctggcccccagaggaggatcgaccagcctccgcccccacccccgccgccacctcctgccccccgcggccggacgccccccaacctgctgagcaccctgcagtacccaagaccctcaagcggaaccctggcgtcggcctcacctgattgggtgggccccagtacccgcctgaggcagcagtcctcttcctccaagggggacagcccagaactgaagccacgggcagtgcacaagcagggcccttcacctgtgagccccaatgccctggaccgcacagccgcttggctcttgaccatgaacgcgcagttgttagaagacgagggcctgggcccagaccccccccacagggataggctaaggagtaaggacgagctcagccaagcagaaaaggacctggcggtgctgcaggacaagctgcgaatctccaccaagaagctggaggagtatgagaccctgttcaagtgccaggaggagacgacgcagaagctggtgctggagtaccaggcacggctggaggagggcgaggagcggctgcggcggcagcaggaggacaaggacatccagatgaagggcatcatcagcaggttgatgtccgtggaggaagaactgaagaaggaccacgcagagatgcaagcggctgtggactccaaacagaagatcattgatgcccaggagaagcgcattgcctcgttggatgccgccaatgcccgcctcatgagtgccctgacccagctgaaagagaggtacagcatgcaagcccgtaacggcatctcccccaccaaccccaccaaattgcagattactgagaacggcgagttcagaaacagcagcaattgttaacctgcctgaggagggaggaagctacccaaggagagggggactatggtggccaagggcagggtctcggcctggggaggcacccacggttgcagccccagcgcgggtgtcaggaggccgagcctcccctccctgccgctgtccaggaggcggccgca
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:153090 -> Molecular function: GO:0005099 [Ras GTPase activator activity] evidence: IBA
            GeneID:153090 -> Molecular function: GO:0005099 [Ras GTPase activator activity] evidence: ISS
            GeneID:153090 -> Molecular function: GO:0005123 [death receptor binding] evidence: IPI
            GeneID:153090 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:153090 -> Molecular function: GO:0017124 [SH3 domain binding] evidence: IDA
            GeneID:153090 -> Molecular function: GO:0019900 [kinase binding] evidence: IPI
            GeneID:153090 -> Molecular function: GO:0019901 [protein kinase binding] evidence: IPI
            GeneID:153090 -> Molecular function: GO:0031434 [mitogen-activated protein kinase kinase binding] evidence: IPI
            GeneID:153090 -> Molecular function: GO:0031435 [mitogen-activated protein kinase kinase kinase binding] evidence: IPI
            GeneID:153090 -> Molecular function: GO:0032266 [phosphatidylinositol-3-phosphate binding] evidence: IDA
            GeneID:153090 -> Molecular function: GO:0032403 [protein complex binding] evidence: IDA
            GeneID:153090 -> Molecular function: GO:0035591 [signaling adaptor activity] evidence: IDA
            GeneID:153090 -> Molecular function: GO:0035662 [Toll-like receptor 4 binding] evidence: IDA
            GeneID:153090 -> Molecular function: GO:0036312 [phosphatidylinositol 3-kinase regulatory subunit binding] evidence: IDA
            GeneID:153090 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:153090 -> Molecular function: GO:0042803 [protein homodimerization activity] evidence: IPI
            GeneID:153090 -> Molecular function: GO:0043184 [vascular endothelial growth factor receptor 2 binding] evidence: IPI
            GeneID:153090 -> Molecular function: GO:0043548 [phosphatidylinositol 3-kinase binding] evidence: IDA
            GeneID:153090 -> Molecular function: GO:0051721 [protein phosphatase 2A binding] evidence: IDA
            GeneID:153090 -> Molecular function: GO:0070273 [phosphatidylinositol-4-phosphate binding] evidence: IDA
            GeneID:153090 -> Molecular function: GO:0071889 [14-3-3 protein binding] evidence: IDA
            GeneID:153090 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:153090 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IMP
            GeneID:153090 -> Biological process: GO:0000185 [activation of MAPKKK activity] evidence: IDA
            GeneID:153090 -> Biological process: GO:0001525 [angiogenesis] evidence: IEA
            GeneID:153090 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: IMP
            GeneID:153090 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: ISS
            GeneID:153090 -> Biological process: GO:0006927 [transformed cell apoptotic process] evidence: TAS
            GeneID:153090 -> Biological process: GO:0006954 [inflammatory response] evidence: IEA
            GeneID:153090 -> Biological process: GO:0006986 [response to unfolded protein] evidence: IEA
            GeneID:153090 -> Biological process: GO:0007049 [cell cycle] evidence: IEA
            GeneID:153090 -> Biological process: GO:0007252 [I-kappaB phosphorylation] evidence: ISS
            GeneID:153090 -> Biological process: GO:0007257 [activation of JUN kinase activity] evidence: IDA
            GeneID:153090 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IDA
            GeneID:153090 -> Biological process: GO:0008625 [extrinsic apoptotic signaling pathway via death domain receptors] evidence: IMP
            GeneID:153090 -> Biological process: GO:0010596 [negative regulation of endothelial cell migration] evidence: IMP
            GeneID:153090 -> Biological process: GO:0010633 [negative regulation of epithelial cell migration] evidence: IMP
            GeneID:153090 -> Biological process: GO:0010633 [negative regulation of epithelial cell migration] evidence: TAS
            GeneID:153090 -> Biological process: GO:0010719 [negative regulation of epithelial to mesenchymal transition] evidence: IDA
            GeneID:153090 -> Biological process: GO:0010719 [negative regulation of epithelial to mesenchymal transition] evidence: IMP
            GeneID:153090 -> Biological process: GO:0010976 [positive regulation of neuron projection development] evidence: ISS
            GeneID:153090 -> Biological process: GO:0014067 [negative regulation of phosphatidylinositol 3-kinase cascade] evidence: IDA
            GeneID:153090 -> Biological process: GO:0016525 [negative regulation of angiogenesis] evidence: IDA
            GeneID:153090 -> Biological process: GO:0021814 [cell motility involved in cerebral cortex radial glia guided migration] evidence: ISS
            GeneID:153090 -> Biological process: GO:0021819 [layer formation in cerebral cortex] evidence: ISS
            GeneID:153090 -> Biological process: GO:0030948 [negative regulation of vascular endothelial growth factor receptor signaling pathway] evidence: IMP
            GeneID:153090 -> Biological process: GO:0032088 [negative regulation of NF-kappaB transcription factor activity] evidence: IMP
            GeneID:153090 -> Biological process: GO:0032312 [regulation of ARF GTPase activity] evidence: ISS
            GeneID:153090 -> Biological process: GO:0032320 [positive regulation of Ras GTPase activity] evidence: IBA
            GeneID:153090 -> Biological process: GO:0034144 [negative regulation of toll-like receptor 4 signaling pathway] evidence: IDA
            GeneID:153090 -> Biological process: GO:0034260 [negative regulation of GTPase activity] evidence: ISS
            GeneID:153090 -> Biological process: GO:0034261 [negative regulation of Ras GTPase activity] evidence: IMP
            GeneID:153090 -> Biological process: GO:0035148 [tube formation] evidence: IMP
            GeneID:153090 -> Biological process: GO:0035414 [negative regulation of catenin import into nucleus] evidence: ISS
            GeneID:153090 -> Biological process: GO:0035924 [cellular response to vascular endothelial growth factor stimulus] evidence: IDA
            GeneID:153090 -> Biological process: GO:0035924 [cellular response to vascular endothelial growth factor stimulus] evidence: ISS
            GeneID:153090 -> Biological process: GO:0036324 [vascular endothelial growth factor receptor-2 signaling pathway] evidence: ISS
            GeneID:153090 -> Biological process: GO:0040008 [regulation of growth] evidence: IEA
            GeneID:153090 -> Biological process: GO:0042059 [negative regulation of epidermal growth factor receptor signaling pathway] evidence: ISS
            GeneID:153090 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IDA
            GeneID:153090 -> Biological process: GO:0043122 [regulation of I-kappaB kinase/NF-kappaB cascade] evidence: ISS
            GeneID:153090 -> Biological process: GO:0043124 [negative regulation of I-kappaB kinase/NF-kappaB cascade] evidence: IDA
            GeneID:153090 -> Biological process: GO:0043254 [regulation of protein complex assembly] evidence: IDA
            GeneID:153090 -> Biological process: GO:0043407 [negative regulation of MAP kinase activity] evidence: IDA
            GeneID:153090 -> Biological process: GO:0043407 [negative regulation of MAP kinase activity] evidence: IMP
            GeneID:153090 -> Biological process: GO:0043410 [positive regulation of MAPK cascade] evidence: IDA
            GeneID:153090 -> Biological process: GO:0043507 [positive regulation of JUN kinase activity] evidence: IDA
            GeneID:153090 -> Biological process: GO:0043553 [negative regulation of phosphatidylinositol 3-kinase activity] evidence: IDA
            GeneID:153090 -> Biological process: GO:0044257 [cellular protein catabolic process] evidence: IDA
            GeneID:153090 -> Biological process: GO:0045087 [innate immune response] evidence: IEA
            GeneID:153090 -> Biological process: GO:0045732 [positive regulation of protein catabolic process] evidence: ISS
            GeneID:153090 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IMP
            GeneID:153090 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:153090 -> Biological process: GO:0046330 [positive regulation of JNK cascade] evidence: IDA
            GeneID:153090 -> Biological process: GO:0046580 [negative regulation of Ras protein signal transduction] evidence: IBA
            GeneID:153090 -> Biological process: GO:0046580 [negative regulation of Ras protein signal transduction] evidence: IC
            GeneID:153090 -> Biological process: GO:0048147 [negative regulation of fibroblast proliferation] evidence: ISS
            GeneID:153090 -> Biological process: GO:0048812 [neuron projection morphogenesis] evidence: ISS
            GeneID:153090 -> Biological process: GO:0050680 [negative regulation of epithelial cell proliferation] evidence: IMP
            GeneID:153090 -> Biological process: GO:0070059 [intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress] evidence: ISS
            GeneID:153090 -> Biological process: GO:0070317 [negative regulation of G0 to G1 transition] evidence: IDA
            GeneID:153090 -> Biological process: GO:0070373 [negative regulation of ERK1 and ERK2 cascade] evidence: IDA
            GeneID:153090 -> Biological process: GO:0071158 [positive regulation of cell cycle arrest] evidence: IDA
            GeneID:153090 -> Biological process: GO:0071222 [cellular response to lipopolysaccharide] evidence: IDA
            GeneID:153090 -> Biological process: GO:0071347 [cellular response to interleukin-1] evidence: IDA
            GeneID:153090 -> Biological process: GO:0071356 [cellular response to tumor necrosis factor] evidence: IDA
            GeneID:153090 -> Biological process: GO:0071364 [cellular response to epidermal growth factor stimulus] evidence: ISS
            GeneID:153090 -> Biological process: GO:0071901 [negative regulation of protein serine/threonine kinase activity] evidence: IDA
            GeneID:153090 -> Biological process: GO:0071901 [negative regulation of protein serine/threonine kinase activity] evidence: IMP
            GeneID:153090 -> Biological process: GO:0071902 [positive regulation of protein serine/threonine kinase activity] evidence: IDA
            GeneID:153090 -> Biological process: GO:0071902 [positive regulation of protein serine/threonine kinase activity] evidence: IMP
            GeneID:153090 -> Biological process: GO:0072577 [endothelial cell apoptotic process] evidence: TAS
            GeneID:153090 -> Biological process: GO:0090090 [negative regulation of canonical Wnt receptor signaling pathway] evidence: IMP
            GeneID:153090 -> Biological process: GO:0090129 [positive regulation of synapse maturation] evidence: ISS
            GeneID:153090 -> Biological process: GO:1900006 [positive regulation of dendrite development] evidence: ISS
            GeneID:153090 -> Biological process: GO:1900744 [regulation of p38MAPK cascade] evidence: ISS
            GeneID:153090 -> Biological process: GO:1900747 [negative regulation of vascular endothelial growth factor signaling pathway] evidence: ISS
            GeneID:153090 -> Biological process: GO:1901800 [positive regulation of proteasomal protein catabolic process] evidence: IMP
            GeneID:153090 -> Biological process: GO:2000599 [negative regulation of cyclin catabolic process] evidence: IDA
            GeneID:153090 -> Biological process: GO:2001224 [positive regulation of neuron migration] evidence: ISS
            GeneID:153090 -> Biological process: GO:2001235 [positive regulation of apoptotic signaling pathway] evidence: IDA
            GeneID:153090 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:153090 -> Cellular component: GO:0005886 [plasma membrane] evidence: IDA
            GeneID:153090 -> Cellular component: GO:0030139 [endocytic vesicle] evidence: IDA
            GeneID:153090 -> Cellular component: GO:0030424 [axon] evidence: ISS
            GeneID:153090 -> Cellular component: GO:0030425 [dendrite] evidence: IEA
            GeneID:153090 -> Cellular component: GO:0031235 [intrinsic to internal side of plasma membrane] evidence: IBA
            GeneID:153090 -> Cellular component: GO:0032809 [neuronal cell body membrane] evidence: ISS
            GeneID:153090 -> Cellular component: GO:0043025 [neuronal cell body] evidence: ISS
            GeneID:153090 -> Cellular component: GO:0044300 [cerebellar mossy fiber] evidence: ISS
            GeneID:153090 -> Cellular component: GO:0044301 [climbing fiber] evidence: ISS
            GeneID:153090 -> Cellular component: GO:1990032 [parallel fiber] evidence: ISS

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.