GGRNA Home | Help | Advanced search

2020-10-26 19:27:04, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_133437              82605 bp    mRNA    linear   PRI 29-APR-2013
DEFINITION  Homo sapiens titin (TTN), transcript variant novex-2, mRNA.
ACCESSION   NM_133437
VERSION     NM_133437.3  GI:291045229
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 82605)
  AUTHORS   LeWinter,M.M. and Granzier,H.L.
  TITLE     Titin is a major human disease gene
  JOURNAL   Circulation 127 (8), 938-944 (2013)
   PUBMED   23439446
  REMARK    GeneRIF: [review] Signal pathways of titin isoforms are described
            in a major human cardiovascular disease.
            Review article
REFERENCE   2  (bases 1 to 82605)
  AUTHORS   Hamdani,N., Krysiak,J., Kreusser,M.M., Neef,S., Dos Remedios,C.G.,
            Maier,L.S., Kruger,M., Backs,J. and Linke,W.A.
  TITLE     Crucial role for Ca2(+)/calmodulin-dependent protein kinase-II in
            regulating diastolic stress of normal and failing hearts via titin
            phosphorylation
  JOURNAL   Circ. Res. 112 (4), 664-674 (2013)
   PUBMED   23283722
  REMARK    GeneRIF: Human end-stage failing hearts revealed higher CaMKII
            expression/activity & phosphorylation at PEVK/titin N2B-unique
            sequence sites than donor hearts. Deranged CaMKII-dependent titin
            phosphorylation contributes to altered diastolic stress.
REFERENCE   3  (bases 1 to 82605)
  AUTHORS   Somkuti,J., Martonfalvi,Z., Kellermayer,M.S. and Smeller,L.
  TITLE     Different pressure-temperature behavior of the structured and
            unstructured regions of titin
  JOURNAL   Biochim. Biophys. Acta 1834 (1), 112-118 (2013)
   PUBMED   23063534
  REMARK    GeneRIF: Different pressure-temperature behavior of the structured
            and unstructured regions of titin.
REFERENCE   4  (bases 1 to 82605)
  AUTHORS   Tskhovrebova,L. and Trinick,J.
  TITLE     Roles of titin in the structure and elasticity of the sarcomere
  JOURNAL   J. Biomed. Biotechnol. 2010, 612482 (2010)
   PUBMED   20625501
  REMARK    GeneRIF: Recent titin data is reviewed and its implications for
            sarcomere architecture and elasticity, are discussed.
            Review article
REFERENCE   5  (bases 1 to 82605)
  AUTHORS   Labeit,S., Lahmers,S., Burkart,C., Fong,C., McNabb,M., Witt,S.,
            Witt,C., Labeit,D. and Granzier,H.
  TITLE     Expression of distinct classes of titin isoforms in striated and
            smooth muscles by alternative splicing, and their conserved
            interaction with filamins
  JOURNAL   J. Mol. Biol. 362 (4), 664-681 (2006)
   PUBMED   16949617
  REMARK    GeneRIF: This suggests that the titin Z2-Zis1 domain can link
            filamins and alpha-actinin together in the periphery of the
            Z-line/dense bodies in a fashion that is conserved in smooth and
            striated muscles.
REFERENCE   6  (bases 1 to 82605)
  AUTHORS   Bang,M.L., Centner,T., Fornoff,F., Geach,A.J., Gotthardt,M.,
            McNabb,M., Witt,C.C., Labeit,D., Gregorio,C.C., Granzier,H. and
            Labeit,S.
  TITLE     The complete gene sequence of titin, expression of an unusual
            approximately 700-kDa titin isoform, and its interaction with
            obscurin identify a novel Z-line to I-band linking system
  JOURNAL   Circ. Res. 89 (11), 1065-1072 (2001)
   PUBMED   11717165
REFERENCE   7  (bases 1 to 82605)
  AUTHORS   Freiburg,A., Trombitas,K., Hell,W., Cazorla,O., Fougerousse,F.,
            Centner,T., Kolmerer,B., Witt,C., Beckmann,J.S., Gregorio,C.C.,
            Granzier,H. and Labeit,S.
  TITLE     Series of exon-skipping events in the elastic spring region of
            titin as the structural basis for myofibrillar elastic diversity
  JOURNAL   Circ. Res. 86 (11), 1114-1121 (2000)
   PUBMED   10850961
REFERENCE   8  (bases 1 to 82605)
  AUTHORS   Labeit,S. and Kolmerer,B.
  TITLE     Titins: giant proteins in charge of muscle ultrastructure and
            elasticity
  JOURNAL   Science 270 (5234), 293-296 (1995)
   PUBMED   7569978
REFERENCE   9  (bases 1 to 82605)
  AUTHORS   Furst,D.O., Vinkemeier,U. and Weber,K.
  TITLE     Mammalian skeletal muscle C-protein: purification from bovine
            muscle, binding to titin and the characterization of a full-length
            human cDNA
  JOURNAL   J. Cell. Sci. 102 (PT 4), 769-778 (1992)
   PUBMED   1429890
REFERENCE   10 (bases 1 to 82605)
  AUTHORS   Labeit,S., Gautel,M., Lakey,A. and Trinick,J.
  TITLE     Towards a molecular understanding of titin
  JOURNAL   EMBO J. 11 (5), 1711-1716 (1992)
   PUBMED   1582406
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC023270.7, AC010680.10,
            FJ695199.1 and AC009948.3.
            On Mar 13, 2010 this sequence version replaced gi:110349716.
            
            Summary: This gene encodes a large abundant protein of striated
            muscle. The product of this gene is divided into two regions, a
            N-terminal I-band and a C-terminal A-band. The I-band, which is the
            elastic part of the molecule, contains two regions of tandem
            immunoglobulin domains on either side of a PEVK region that is rich
            in proline, glutamate, valine and lysine. The A-band, which is
            thought to act as a protein-ruler, contains a mixture of
            immunoglobulin and fibronectin repeats, and possesses kinase
            activity. An N-terminal Z-disc region and a C-terminal M-line
            region bind to the Z-line and M-line of the sarcomere,
            respectively, so that a single titin molecule spans half the length
            of a sarcomere. Titin also contains binding sites for muscle
            associated proteins so it serves as an adhesion template for the
            assembly of contractile machinery in muscle cells. It has also been
            identified as a structural protein for chromosomes. Alternative
            splicing of this gene results in multiple transcript variants.
            Considerable variability exists in the I-band, the M-line and the
            Z-disc regions of titin. Variability in the I-band region
            contributes to the differences in elasticity of different titin
            isoforms and, therefore, to the differences in elasticity of
            different muscle types. Mutations in this gene are associated with
            familial hypertrophic cardiomyopathy 9, and autoantibodies to titin
            are produced in patients with the autoimmune disease scleroderma.
            [provided by RefSeq, Feb 2012].
            
            Transcript Variant: This variant (novex-2) encodes the minor
            cardiac and skeletal muscle isoform (novex-2 or novex-2/N2B), which
            is nearly identical to the major cardiac isoform N2-B but contains
            a unique stretch of 192 aa in the I-band region. This variant is
            supported by data in PMID:11717165.
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data to make the sequence consistent with the reference genome
            assembly. The genomic coordinates used for the transcript record
            were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-212               AC023270.7         65697-65908         c
            213-316             AC023270.7         63037-63140         c
            317-520             AC023270.7         60623-60826         c
            521-808             AC023270.7         58880-59167         c
            809-894             AC023270.7         58310-58395         c
            895-1139            AC023270.7         57972-58216         c
            1140-1470           AC023270.7         53407-53737         c
            1471-1623           AC023270.7         52884-53036         c
            1624-1761           AC023270.7         51889-52026         c
            1762-1887           AC023270.7         50557-50682         c
            1888-2025           AC023270.7         48463-48600         c
            2026-2163           AC023270.7         47845-47982         c
            2164-2457           AC023270.7         44333-44626         c
            2458-2580           AC023270.7         44105-44227         c
            2581-2862           AC023270.7         42555-42836         c
            2863-2928           AC023270.7         42205-42270         c
            2929-3187           AC023270.7         41291-41549         c
            3188-3251           AC023270.7         41024-41087         c
            3252-3467           AC023270.7         40697-40912         c
            3468-3610           AC023270.7         39606-39748         c
            3611-3816           AC023270.7         38485-38690         c
            3817-4050           AC023270.7         37714-37947         c
            4051-4295           AC023270.7         37359-37603         c
            4296-4567           AC023270.7         36189-36460         c
            4568-4732           AC023270.7         35905-36069         c
            4733-4901           AC023270.7         35634-35802         c
            4902-6595           AC023270.7         33841-35534         c
            6596-6877           AC023270.7         33406-33687         c
            6878-7144           AC023270.7         32692-32958         c
            7145-7417           AC023270.7         32323-32595         c
            7418-7681           AC023270.7         31947-32210         c
            7682-7942           AC023270.7         31594-31854         c
            7943-8203           AC023270.7         29696-29956         c
            8204-8467           AC023270.7         28897-29160         c
            8468-8728           AC023270.7         28545-28805         c
            8729-8989           AC023270.7         28164-28424         c
            8990-9250           AC023270.7         27158-27418         c
            9251-9392           AC023270.7         26499-26640         c
            9393-9558           AC023270.7         26244-26409         c
            9559-9790           AC023270.7         24866-25097         c
            9791-10075          AC023270.7         23012-23296         c
            10076-10201         AC023270.7         22662-22787         c
            10202-10390         AC023270.7         17469-17657         c
            10391-10966         AC023270.7         14707-15282         c
            10967-11023         AC023270.7         11609-11665         c
            11024-11429         AC023270.7         1-406               c
            11430-13804         AC010680.10        173102-175476       c
            13805-14083         AC010680.10        172043-172321       c
            14084-14164         AC010680.10        76198-76278         c
            14165-14239         AC010680.10        75202-75276         c
            14240-14329         AC010680.10        74502-74591         c
            14330-14392         AC010680.10        74009-74071         c
            14393-14482         AC010680.10        73660-73749         c
            14483-14533         AC010680.10        71330-71380         c
            14534-14935         AC010680.10        70359-70760         c
            14936-15214         AC010680.10        69924-70202         c
            15215-15490         AC010680.10        69401-69676         c
            15491-15630         AC010680.10        69126-69265         c
            15631-15757         AC010680.10        68684-68810         c
            15758-16021         AC010680.10        68327-68590         c
            16022-16288         AC010680.10        67778-68044         c
            16289-16552         AC010680.10        67374-67637         c
            16553-16692         AC010680.10        67148-67287         c
            16693-16819         AC010680.10        66879-67005         c
            16820-17086         AC010680.10        66487-66753         c
            17087-17353         AC010680.10        66108-66374         c
            17354-17620         AC010680.10        64995-65261         c
            17621-17760         AC010680.10        64765-64904         c
            17761-17887         AC010680.10        64202-64328         c
            17888-18030         AC010680.10        63262-63404         c
            18031-18154         AC010680.10        59234-59357         c
            18155-18421         AC010680.10        58426-58692         c
            18422-18519         AC010680.10        56631-56728         c
            18520-18688         AC010680.10        55801-55969         c
            18689-18955         AC010680.10        55436-55702         c
            18956-19222         AC010680.10        55063-55329         c
            19223-19501         AC010680.10        54676-54954         c
            19502-19910         AC010680.10        54178-54586         c
            19911-20035         AC010680.10        53949-54073         c
            20036-20302         AC010680.10        53582-53848         c
            20303-20572         AC010680.10        52545-52814         c
            20573-20875         AC010680.10        52150-52452         c
            20876-21178         AC010680.10        51740-52042         c
            21179-21366         AC010680.10        51286-51473         c
            21367-21481         AC010680.10        51081-51195         c
            21482-21766         AC010680.10        50690-50974         c
            21767-21918         AC010680.10        50440-50591         c
            21919-22066         AC010680.10        49602-49749         c
            22067-22244         AC010680.10        49268-49445         c
            22245-22366         AC010680.10        48808-48929         c
            22367-22654         AC010680.10        48427-48714         c
            22655-22951         AC010680.10        48013-48309         c
            22952-23138         AC010680.10        47712-47898         c
            23139-23254         AC010680.10        47122-47237         c
            23255-23554         AC010680.10        46734-47033         c
            23555-23854         AC010680.10        46238-46537         c
            23855-23960         AC010680.10        46018-46123         c
            23961-24157         AC010680.10        45719-45915         c
            24158-24463         AC010680.10        45333-45638         c
            24464-24742         AC010680.10        44954-45232         c
            24743-25042         AC010680.10        44051-44350         c
            25043-25345         AC010680.10        43645-43947         c
            25346-25708         AC010680.10        43169-43531         c
            25709-26011         AC010680.10        42567-42869         c
            26012-26311         AC010680.10        42139-42438         c
            26312-26608         AC010680.10        41746-42042         c
            26609-26893         AC010680.10        41362-41646         c
            26894-27187         AC010680.10        40982-41275         c
            27188-27487         AC010680.10        39375-39674         c
            27488-27796         AC010680.10        38948-39256         c
            27797-27987         AC010680.10        38669-38859         c
            27988-28417         AC010680.10        37837-38266         c
            28418-28726         AC010680.10        36243-36551         c
            28727-28875         AC010680.10        35963-36111         c
            28876-28908         AC010680.10        35843-35875         c
            28909-29038         AC010680.10        35619-35748         c
            29039-29338         AC010680.10        35226-35525         c
            29339-29656         AC010680.10        34815-35132         c
            29657-29953         AC010680.10        33515-33811         c
            29954-30253         AC010680.10        33107-33406         c
            30254-30568         AC010680.10        32709-33023         c
            30569-30717         AC010680.10        32467-32615         c
            30718-30868         AC010680.10        31869-32019         c
            30869-31020         AC010680.10        31629-31780         c
            31021-31150         FJ695199.1         64-193              c
            31151-31453         AC010680.10        29469-29771         c
            31454-31756         AC010680.10        28306-28608         c
            31757-32038         AC010680.10        27923-28204         c
            32039-32338         AC010680.10        27530-27829         c
            32339-32641         AC010680.10        27135-27437         c
            32642-32950         AC010680.10        26737-27045         c
            32951-33232         AC010680.10        26341-26622         c
            33233-33532         AC010680.10        25940-26239         c
            33533-33826         AC010680.10        25561-25854         c
            33827-36793         AC010680.10        22500-25466         c
            36794-37114         AC010680.10        21861-22181         c
            37115-37399         AC010680.10        21478-21762         c
            37400-37699         AC010680.10        21080-21379         c
            37700-38002         AC010680.10        20467-20769         c
            38003-38278         AC010680.10        19034-19309         c
            38279-38578         AC010680.10        18631-18930         c
            38579-38881         AC010680.10        18238-18540         c
            38882-39181         AC010680.10        17569-17868         c
            39182-39469         AC010680.10        16902-17189         c
            39470-39766         AC010680.10        16258-16554         c
            39767-40069         AC010680.10        15868-16170         c
            40070-40375         AC010680.10        15461-15766         c
            40376-40663         AC010680.10        14284-14571         c
            40664-40954         AC010680.10        13901-14191         c
            40955-41242         AC010680.10        13523-13810         c
            41243-41830         AC010680.10        12768-13355         c
            41831-41935         AC010680.10        12573-12677         c
            41936-42133         AC010680.10        11950-12147         c
            42134-42430         AC010680.10        11564-11860         c
            42431-43018         AC010680.10        10885-11472         c
            43019-43321         AC010680.10        10491-10793         c
            43322-53699         AC010680.10        1-10378             c
            53700-60427         AC009948.3         165901-172628       c
            60428-60724         AC009948.3         164931-165227       c
            60725-61312         AC009948.3         164238-164825       c
            61313-61615         AC009948.3         163843-164145       c
            61616-61912         AC009948.3         163438-163734       c
            61913-62200         AC009948.3         161455-161742       c
            62201-62500         AC009948.3         161043-161342       c
            62501-62803         AC009948.3         160504-160806       c
            62804-63109         AC009948.3         160092-160397       c
            63110-64876         AC009948.3         158220-159986       c
            64877-65170         AC009948.3         157557-157850       c
            65171-65458         AC009948.3         156576-156863       c
            65459-65758         AC009948.3         156160-156459       c
            65759-67825         AC009948.3         153997-156063       c
            67826-68128         AC009948.3         153593-153895       c
            68129-68434         AC009948.3         153190-153495       c
            68435-68725         AC009948.3         152802-153092       c
            68726-69022         AC009948.3         152410-152706       c
            69023-69328         AC009948.3         151978-152283       c
            69329-69634         AC009948.3         150791-151096       c
            69635-69916         AC009948.3         150424-150705       c
            69917-70510         AC009948.3         149659-150252       c
            70511-70798         AC009948.3         149252-149539       c
            70799-71098         AC009948.3         148854-149153       c
            71099-71401         AC009948.3         147872-148174       c
            71402-71704         AC009948.3         146658-146960       c
            71705-72289         AC009948.3         145972-146556       c
            72290-72595         AC009948.3         145536-145841       c
            72596-72895         AC009948.3         145130-145429       c
            72896-73471         AC009948.3         143932-144507       c
            73472-73777         AC009948.3         143528-143833       c
            73778-74371         AC009948.3         142572-143165       c
            74372-79980         AC009948.3         136831-142439       c
            79981-80137         AC009948.3         136550-136706       c
            80138-80829         AC009948.3         135118-135809       c
            80830-80983         AC009948.3         134864-135017       c
            80984-81286         AC009948.3         134036-134338       c
            81287-82605         AC009948.3         132579-133897       c
FEATURES             Location/Qualifiers
     source          1..82605
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q31"
     gene            1..82605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="titin"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
     exon            1..212
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       85
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647840"
     misc_feature    202..204
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="upstream in-frame stop codon"
     exon            213..316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     CDS             226..81582
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /EC_number="2.7.11.1"
                     /note="isoform novex-2 is encoded by transcript variant
                     novex-2; connectin; rhabdomyosarcoma antigen MU-RMS-40.14"
                     /codon_start=1
                     /product="titin isoform novex-2"
                     /protein_id="NP_597681.3"
                     /db_xref="GI:291045230"
                     /db_xref="CCDS:CCDS54422.1"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
                     /translation="
MTTQAPTFTQPLQSVVVLEGSTATFEAHISGFPVPEVSWFRDGQVISTSTLPGVQISFSDGRAKLTIPAVTKANSGRYSLKATNGSGQATSTAELLVKAETAPPNFVQRLQSMTVRQGSQVRLQVRVTGIPTPVVKFYRDGAEIQSSLDFQISQEGDLYSLLIAEAYPEDSGTYSVNATNSVGRATSTAELLVQGEEEVPAKKTKTIVSTAQISESRQTRIEKKIEAHFDARSIATVEMVIDGAAGQQLPHKTPPRIPPKPKSRSPTPPSIAAKAQLARQQSPSPIRHSPSPVRHVRAPTPSPVRSVSPAARISTSPIRSVRSPLLMRKTQASTVATGPEVPPPWKQEGYVASSSEAEMRETTLTTSTQIRTEERWEGRYGVQEQVTISGAAGAAASVSASASYAAEAVATGAKEVKQDADKSAAVATVVAAVDMARVREPVISAVEQTAQRTTTTAVHIQPAQEQVRKEAEKTAVTKVVVAADKAKEQELKSRTKEVITTKQEQMHVTHEQIRKETEKTFVPKVVISAAKAKEQETRISEEITKKQKQVTQEAIMKETRKTVVPKVIVATPKVKEQDLVSRGREGITTKREQVQITQEKMRKEAEKTALSTIAVATAKAKEQETILRTRETMATRQEQIQVTHGKVDVGKKAEAVATVVAAVDQARVREPREPGHLEESYAQQTTLEYGYKERISAAKVAEPPQRPASEPHVVPKAVKPRVIQAPSETHIKTTDQKGMHISSQIKKTTDLTTERLVHVDKRPRTASPHFTVSKISVPKTEHGYEASIAGSAIATLQKELSATSSAQKITKSVKAPTVKPSETRVRAEPTPLPQFPFADTPDTYKSEAGVEVKKEVGVSITGTTVREERFEVLHGREAKVTETARVPAPVEIPVTPPTLVSGLKNVTVIEGESVTLECHISGYPSPTVTWYREDYQIESSIDFQITFQSGIARLMIREAFAEDSGRFTCSAVNEAGTVSTSCYLAVQVSEEFEKETTAVTEKFTTEEKRFVESRDVVMTDTSLTEEQAGPGEPAAPYFITKPVVQKLVEGGSVVFGCQVGGNPKPHVYWKKSGVPLTTGYRYKVSYNKQTGECKLVISMTFADDAGEYTIVVRNKHGETSASASLLEEADYELLMKSQQEMLYQTQVTAFVQEPKVGETAPGFVYSEYEKEYEKEQALIRKKMAKDTVVVRTYVEDQEFHISSFEERLIKEIEYRIIKTTLEELLEEDGEEKMAVDISESEAVESGFDSRIKNYRILEGMGVTFHCKMSGYPLPKIAWYKDGKRIKHGERYQMDFLQDGRASLRIPVVLPEDEGIYTAFASNIKGNAICSGKLYVEPAAPLGAPTYIPTLEPVSRIRSLSPRSVSRSPIRMSPARMSPARMSPARMSPARMSPGRRLEETDESQLERLYKPVFVLKPVSFKCLEGQTARFDLKVVGRPMPETFWFHDGQQIVNDYTHKVVIKEDGTQSLIIVPATPSDSGEWTVVAQNRAGRSSISVILTVEAVEHQVKPMFVEKLKNVNIKEGSRLEMKVRATGNPNPDIVWLKNSDIIVPHKYPKIRIEGTKGEAALKIDSTVSQDSAWYTATAINKAGRDTTRCKVNVEVEFAEPEPERKLIIPRGTYRAKEIAAPELEPLHLRYGQEQWEEGDLYDKEKQQKPFFKKKLTSLRLKRFGPAHFECRLTPIGDPTMVVEWLHDGKPLEAANRLRMINEFGYCSLDYGVAYSRDSGIITCRATNKYGTDHTSATLIVKDEKSLVEESQLPEGRKGLQRIEELERMAHEGALTGVTTDQKEKQKPDIVLYPEPVRVLEGETARFRCRVTGYPQPKVNWYLNGQLIRKSKRFRVRYDGIHYLDIVDCKSYDTGEVKVTAENPEGVIEHKVKLEIQQREDFRSVLRRAPEPRPEFHVHEPGKLQFEVQKVDRPVDTTETKEVVKLKRAERITHEKVPEESEELRSKFKRRTEEGYYEAITAVELKSRKKDESYEELLRKTKDELLHWTKELTEEEKKALAEEGKITIPTFKPDKIELSPSMEAPKIFERIQSQTVGQGSDAHFRVRVVGKPDPECEWYKNGVKIERSDRIYWYWPEDNVCELVIRDVTAEDSASIMVKAINIAGETSSHAFLLVQAKQLITFTQELQDVVAKEKDTMATFECETSEPFVKVKWYKDGMEVHEGDKYRMHSDRKVHFLSILTIDTSDAEDYSCVLVEDENVKTTAKLIVEGAVVEFVKELQDIEVPESYSGELECIVSPENIEGKWYHNDVELKSNGKYTITSRRGRQNLTVKDVTKEDQGEYSFVIDGKKTTCKLKMKPRPIAILQGLSDQKVCEGDIVQLEVKVSLESVEGVWMKDGQEVQPSDRVHIVIDKQSHMLLIEDMTKEDAGNYSFTIPALGLSTSGRVSVYSVDVITPLKDVNVIEGTKAVLECKVSVPDVTSVKWYLNDEQIKPDDRVQAIVKGTKQRLVINRTHASDEGPYKLIVGRVETNCNLSVEKIKIIRGLRDLTCTETQNVVFEVELSHSGIDVLWNFKDKEIKPSSKYKIEAHGKIYKLTVLNMMKDDEGKYTFYAGENMTSGKLTVAGGAISKPLTDQTVAESQEAVFECEVANPDSKGEWLRDGKHLPLTNNIRSESDGHKRRLIIAATKLDDIGEYTYKVATSKTSAKLKVEAVKIKKTLKNLTVTETQDAVFTVELTHPNVKGVQWIKNGVVLESNEKYAISVKGTIYSLRIKNCAIVDESVYGFRLGRLGASARLHVETVKIIKKPKDVTALENATVAFEVSVSHDTVPVKWFHKSVEIKPSDKHRLVSERKVHKLMLQNISPSDAGEYTAVVGQLECKAKLFVETLHITKTMKNIEVPETKTASFECEVSHFNVPSMWLKNGVEIEMSEKFKIVVQGKLHQLIIMNTSTEDSAEYTFVCGNDQVSATLTVTPIMITSMLKDINAEEKDTITFEVTVNYEGISYKWLKNGVEIKSTDKCQMRTKKLTHSLNIRNVHFGDAADYTFVAGKATSTATLYVEARHIEFRKHIKDIKVLEKKRAMFECEVSEPDITVQWMKDDQELQITDRIKIQKEKYVHRLLIPSTRMSDAGKYTVVAGGNVSTAKLFVEGRDVRIRSIKKEVQVIEKQRAVVEFEVNEDDVDAHWYKDGIEINFQVQERHKYVVERRIHRMFISETRQSDAGEYTFVAGRNRSSVTLYVNAPEPPQVLQELQPVTVQSGKPARFCAVISGRPQPKISWYKEEQLLSTGFKCKFLHDGQEYTLLLIEAFPEDAAVYTCEAKNDYGVATTSASLSVEVPEVVSPDQEMPVYPPAIITPLQDTVTSEGQPARFQCRVSGTDLKVSWYSKDKKIKPSRFFRMTQFEDTYQLEIAEAYPEDEGTYTFVASNAVGQVSSTANLSLEVQALDRQSSGKDVRESAKSQAVADSSFTKEESKISQKEIKSFQGSSYEYEVQVFESVSQSSIHTAASVQDTQLCHTASLSQIAESTELSKECAKESTGEAPKIFLHLQDVTVKCGDTAQFLCVLKDDSFIDVTWTHEGAKIEESERLKQSQNGNIQFLTICNVQLVDQGLYSCIVHNDCGERTTSAVLSVEGAPESILHERIEQEIEMEMKEFSSSFLSAEEEGLHSAELQLSKINETLELLSESPVYPTKFDSEKEGTGPIFIKEVSNADISMGDVATLSVTVIGIPKPKIQWFFNGVLLTPSADYKFVFDGDDHSLIILFTKLEDEGEYTCMASNDYGKTICSAYLKINSKGEGHKDTETESAVAKSLEKLGGPCPPHFLKELKPIRCAQGLPAIFEYTVVGEPAPTVTWFKENKQLCTSVYYTIIHNPNGSGTFIVNDPQREDSGLYICKAENMLGESTCAAELLVLLEDTDMTDTPCKAKSTPEAPEDFPQTPLKGPAVEALDSEQEIATFVKDTILKAALITEENQQLSYEHIAKANELSSQLPLGAQELQSILEQDKLTPESTREFLCINGSIHFQPLKEPSPNLQLQIVQSQKTFSKEGILMPEEPETQAVLSDTEKIFPSAMSIEQINSLTVEPLKTLLAEPEGNYPQSSIEPPMHSYLTSVAEEVLSPKEKTVSDTNREQRVTLQKQEAQSALILSQSLAEGHVESLQSPDVMISQVNYEPLVPSEHSCTEGGKILIESANPLENAGQDSAVRIEEGKSLRFPLALEEKQVLLKEEHSDNVVMPPDQIIESKREPVAIKKVQEVQGRDLLSKESLLSGIPEEQRLNLKIQICRALQAAVASEQPGLFSEWLRNIEKVEVEAVNITQEPRHIMCMYLVTSAKSVTEEVTIIIEDVDPQMANLKMELRDALCAIIYEEIDILTAEGPRIQQGAKTSLQEEMDSFSGSQKVEPITEPEVESKYLISTEEVSYFNVQSRVKYLDATPVTKGVASAVVSDEKQDESLKPSEEKEESSSESGTEEVATVKIQEAEGGLIKEDGPMIHTPLVDTVSEEGDIVHLTTSITNAKEVNWYFENKLVPSDEKFKCLQDQNTYTLVIDKVNTEDHQGEYVCEALNDSGKTATSAKLTVVKRAAPVIKRKIEPLEVALGHLAKFTCEIQSAPNVRFQWFKAGREIYESDKCSIRSSKYISSLEILRTQVVDCGEYTCKASNEYGSVSCTATLTVTVPGGEKKVRKLLPERKPEPKEEVVLKSVLRKRPEEEEPKVEPKKLEKVKKPAVPEPPPPKPVEEVEVPTVTKRERKIPEPTKVPEIKPAIPLPAPEPKPKPEAEVKTIKPPPVEPEPTPIAAPVTVPVVGKKAEAKAPKEEAAKPKGPIKGVPKKTPSPIEAERRKLRPGSGGEKPPDEAPFTYQLKAVPLKFVKEIKDIILTESEFVGSSAIFECLVSPSTAITTWMKDGSNIRESPKHRFIADGKDRKLHIIDVQLSDAGEYTCVLRLGNKEKTSTAKLVVEELPVRFVKTLEEEVTVVKGQPLYLSCELNKERDVVWRKDGKIVVEKPGRIVPGVIGLMRALTINDADDTDAGTYTVTVENANNLECSSCVKVVEVIRDWLVKPIRDQHVKPKGTAIFACDIAKDTPNIKWFKGYDEIPAEPNDKTEILRDGNHLYLKIKNAMPEDIAEYAVEIEGKRYPAKLTLGEREVELLKPIEDVTIYEKESASFDAEISEADIPGQWKLKGELLRPSPTCEIKAEGGKRFLTLHKVKLDQAGEVLYQALNAITTAILTVKEIELDFAVPLKDVTVPERRQARFECVLTREANVIWSKGPDIIKSSDKFDIIADGKKHILVINDSQFDDEGVYTAEVEGKKTSARLFVTGIRLKFMSPLEDQTVKEGETATFVCELSHEKMHVVWFKNDAKLHTSRTVLISSEGKTHKLEMKEVTLDDISQIKAQVKELSSTAQLKVLEADPYFTVKLHDKTAVEKDEITLKCEVSKDVPVKWFKDGEEIVPSPKYSIKADGLRRILKIKKADLKDKGEYVCDCGTDKTKANVTVEARLIKVEKPLYGVEVFVGETAHFEIELSEPDVHGQWKLKGQPLTASPDCEIIEDGKKHILILHNCQLGMTGEVSFQAANAKSAANLKVKELPLIFITPLSDVKVFEKDEAKFECEVSREPKTFRWLKGTQEITGDDRFELIKDGTKHSMVIKSAAFEDEAKYMFEAEDKHTSGKLIIEGIRLKFLTPLKDVTAKEKESAVFTVELSHDNIRVKWFKNDQRLHTTRSVSMQDEGKTHSITFKDLSIDDTSQIRVEAMGMSSEAKLTVLEGDPYFTGKLQDYTGVEKDEVILQCEISKADAPVKWFKDGKEIKPSKNAVIKADGKKRMLILKKALKSDIGQYTCDCGTDKTSGKLDIEDREIKLVRPLHSVEVMETETARFETEISEDDIHANWKLKGEALLQTPDCEIKEEGKIHSLVLHNCRLDQTGGVDFQAANVKSSAHLRVKPRVIGLLRPLKDVTVTAGETATFDCELSYEDIPVEWYLKGKKLEPSDKVVPRSEGKVHTLTLRDVKLEDAGEVQLTAKDFKTHANLFVKEPPVEFTKPLEDQTVEEGATAVLECEVSRENAKVKWFKNGTEILKSKKYEIVADGRVRKLVIHDCTPEDIKTYTCDAKDFKTSCNLNVVPPHVEFLRPLTDLQVREKEMARFECELSRENAKVKWFKDGAEIKKGKKYDIISKGAVRILVINKCLLDDEAEYSCEVRTARTSGMLTVLEEEAVFTKNLANIEVSETDTIKLVCEVSKPGAEVIWYKGDEEIIETGRYEILTEGRKRILVIQNAHLEDAGNYNCRLPSSRTDGKVKVHELAAEFISKPQNLEILEGEKAEFVCSISKESFPVQWKRDDKTLESGDKYDVIADGKKRVLVVKDATLQDMGTYVVMVGAARAAAHLTVIEKLRIVVPLKDTRVKEQQEVVFNCEVNTEGAKAKWFRNEEAIFDSSKYIILQKDLVYTLRIRDAHLDDQANYNVSLTNHRGENVKSAANLIVEEEDLRIVEPLKDIETMEKKSVTFWCKVNRLNVTLKWTKNGEEVPFDNRVSYRVDKYKHMLTIKDCGFPDEGEYIVTAGQDKSVAELLIIEAPTEFVEHLEDQTVTEFDDAVFSCQLSREKANVKWYRNGREIKEGKKYKFEKDGSIHRLIIKDCRLDDECEYACGVEDRKSRARLFVEEIPVEIIRPPQDILEAPGADVVFLAELNKDKVEVQWLRNNMVVVQGDKHQMMSEGKIHRLQICDIKPRDQGEYRFIAKDKEARAKLELAAAPKIKTADQDLVVDVGKPLTMVVPYDAYPKAEAEWFKENEPLSTKTIDTTAEQTSFRILEAKKGDKGRYKIVLQNKHGKAEGFINLKVIDVPGPVRNLEVTETFDGEVSLAWEEPLTDGGSKIIGYVVERRDIKRKTWVLATDRAESCEFTVTGLQKGGVEYLFRVSARNRVGTGEPVETDNPVEARSKYDVPGPPLNVTITDVNRFGVSLTWEPPEYDGGAEITNYVIELRDKTSIRWDTAMTVRAEDLSATVTDVVEGQEYSFRVRAQNRIGVGKPSAATPFVKVADPIERPSPPVNLTSSDQTQSSVQLKWEPPLKDGGSPILGYIIERCEEGKDNWIRCNMKLVPELTYKVTGLEKGNKYLYRVSAENKAGVSDPSEILGPLTADDAFVEPTMDLSAFKDGLEVIVPNPITILVPSTGYPRPTATWCFGDKVLETGDRVKMKTLSAYAELVISPSERSDKGIYTLKLENRVKTISGEIDVNVIARPSAPKELKFGDITKDSVHLTWEPPDDDGGSPLTGYVVEKREVSRKTWTKVMDFVTDLEFTVPDLVQGKEYLFKVCARNKCGPGEPAYVDEPVNMSTPATVPDPPENVKWRDRTANSIFLTWDPPKNDGGSRIKGYIVERCPRGSDKWVACGEPVAETKMEVTGLEEGKWYAYRVKALNRQGASKPSRPTEEIQAVDTQEAPEIFLDVKLLAGLTVKAGTKIELPATVTGKPEPKITWTKADMILKQDKRITIENVPKKSTVTIVDSKRSDTGTYIIEAVNVCGRATAVVEVNVLDKPGPPAAFDITDVTNESCLLTWNPPRDDGGSKITNYVVERRATDSEVWHKLSSTVKDTNFKATKLIPNKEYIFRVAAENMYGVGEPVQASPITAKYQFDPPGPPTRLEPSDITKDAVTLTWCEPDDDGGSPITGYWVERLDPDTDKWVRCNKMPVKDTTYRVKGLTNKKKYRFRVLAENLAGPGKPSKSTEPILIKDPIDPPWPPGKPTVKDVGKTSVRLNWTKPEHDGGAKIESYVIEMLKTGTDEWVRVAEGVPTTQHLLPGLMEGQEYSFRVRAVNKAGESEPSEPSDPVLCREKLYPPSPPRWLEVINITKNTADLKWTVPEKDGGSPITNYIVEKRDVRRKGWQTVDTTVKDTKCTVTPLTEGSLYVFRVAAENAIGQSDYTEIEDSVLAKDTFTTPGPPYALAVVDVTKRHVDLKWEPPKNDGGRPIQRYVIEKKERLGTRWVKAGKTAGPDCNFRVTDVIEGTEVQFQVRAENEAGVGHPSEPTEILSIEDPTSPPSPPLDLHVTDAGRKHIAIAWKPPEKNGGSPIIGYHVEMCPVGTEKWMRVNSRPIKDLKFKVEEGVVPDKEYVLRVRAVNAIGVSEPSEISENVVAKDPDCKPTIDLETHDIIVIEGEKLSIPVPFRAVPVPTVSWHKDGKEVKASDRLTMKNDHISAHLEVPKSVRADAGIYTITLENKLGSATASINVKVIGLPGPCKDIKASDITKSSCKLTWEPPEFDGGTPILHYVLERREAGRRTYIPVMSGENKLSWTVKDLIPNGEYFFRVKAVNKVGGGEYIELKNPVIAQDPKQPPDPPVDVEVHNPTAEAMTITWKPPLYDGGSKIMGYIIEKIAKGEERWKRCNEHLVPILTYTAKGLEEGKEYQFRVRAENAAGISEPSRATPPTKAVDPIDAPKVILRTSLEVKRGDEIALDASISGSPYPTITWIKDENVIVPEEIKKRAAPLVRRRKGEVQEEEPFVLPLTQRLSIDNSKKGESQLRVRDSLRPDHGLYMIKVENDHGIAKAPCTVSVLDTPGPPINFVFEDIRKTSVLCKWEPPLDDGGSEIINYTLEKKDKTKPDSEWIVVTSTLRHCKYSVTKLIEGKEYLFRVRAENRFGPGPPCVSKPLVAKDPFGPPDAPDKPIVEDVTSNSMLVKWNEPKDNGSPILGYWLEKREVNSTHWSRVNKSLLNALKANVDGLLEGLTYVFRVCAENAAGPGKFSPPSDPKTAHDPISPPGPPIPRVTDTSSTTIELEWEPPAFNGGGEIVGYFVDKQLVGTNEWSRCTEKMIKVRQYTVKEIREGADYKLRVSAVNAAGEGPPGETQPVTVAEPQEPPAVELDVSVKGGIQIMAGKTLRIPAVVTGRPVPTKVWTKEEGELDKDRVVIDNVGTKSELIIKDALRKDHGRYVITATNSCGSKFAAARVEVFDVPGPVLDLKPVVTNRKMCLLNWSDPEDDGGSEITGFIIERKDAKMHTWRQPIETERSKCDITGLLEGQEYKFRVIAKNKFGCGPPVEIGPILAVDPLGPPTSPERLTYTERTKSTITLDWKEPRSNGGSPIQGYIIEKRRHDKPDFERVNKRLCPTTSFLVENLDEHQMYEFRVKAVNEIGESEPSLPLNVVIQDDEVPPTIKLRLSVRGDTIKVKAGEPVHIPADVTGLPMPKIEWSKNETVIEKPTDALQITKEEVSRSEAKTELSIPKAVREDKGTYTVTASNRLGSVFRNVHVEVYDRPSPPRNLAVTDIKAESCYLTWDAPLDNGGSEITHYVIDKRDASRKKAEWEEVTNTAVEKRYGIWKLIPNGQYEFRVRAVNKYGISDECKSDKVVIQDPYRLPGPPGKPKVLARTKGSMLVSWTPPLDNGGSPITGYWLEKREEGSPYWSRVSRAPITKVGLKGVEFNVPRLLEGVKYQFRAMAINAAGIGPPSEPSDPEVAGDPIFPPGPPSCPEVKDKTKSSISLGWKPPAKDGGSPIKGYIVEMQEEGTTDWKRVNEPDKLITTCECVVPNLKELRKYRFRVKAVNEAGESEPSDTTGEIPATDIQEEPEVFIDIGAQDCLVCKAGSQIRIPAVIKGRPTPKSSWEFDGKAKKAMKDGVHDIPEDAQLETAENSSVIIIPECKRSHTGKYSITAKNKAGQKTANCRVKVMDVPGPPKDLKVSDITRGSCRLSWKMPDDDGGDRIKGYVIEKRTIDGKAWTKVNPDCGSTTFVVPDLLSEQQYFFRVRAENRFGIGPPVETIQRTTARDPIYPPDPPIKLKIGLITKNTVHLSWKPPKNDGGSPVTHYIVECLAWDPTGTKKEAWRQCNKRDVEELQFTVEDLVEGGEYEFRVKAVNAAGVSKPSATVGPVTVKDQTCPPSIDLKEFMEVEEGTNVNIVAKIKGVPFPTLTWFKAPPKKPDNKEPVLYDTHVNKLVVDDTCTLVIPQSRRSDTGLYTITAVNNLGTASKEMRLNVLGRPGPPVGPIKFESVSADQMTLSWFPPKDDGGSKITNYVIEKREANRKTWVHVSSEPKECTYTIPKLLEGHEYVFRIMAQNKYGIGEPLDSEPETARNLFSVPGAPDKPTVSSVTRNSMTVNWEEPEYDGGSPVTGYWLEMKDTTSKRWKRVNRDPIKAMTLGVSYKVTGLIEGSDYQFRVYAINAAGVGPASLPSDPATARDPIAPPGPPFPKVTDWTKSSADLEWSPPLKDGGSKVTGYIVEYKEEGKEEWEKGKDKEVRGTKLVVTGLKEGAFYKFRVRAVNIAGIGEPGEVTDVIEMKDRLVSPDLQLDASVRDRIVVHAGGVIRIIAYVSGKPPPTVTWNMNERTLPQEATIETTAISSSMVIKNCQRSHQGVYSLLAKNEAGERKKTIIVDVLDVPGPVGTPFLAHNLTNESCKLTWFSPEDDGGSPITNYVIEKRESDRRAWTPVTYTVTRQNATVQGLIQGKAYFFRIAAENSIGMGPFVETSEALVIREPITVPERPEDLEVKEVTKNTVTLTWNPPKYDGGSEIINYVLESRLIGTEKFHKVTNDNLLSRKYTVKGLKEGDTYEYRVSAVNIVGQGKPSFCTKPITCKDELAPPTLHLDFRDKLTIRVGEAFALTGRYSGKPKPKVSWFKDEADVLEDDRTHIKTTPATLALEKIKAKRSDSGKYCVVVENSTGSRKGFCQVNVVDRPGPPVGPVSFDEVTKDYMVISWKPPLDDGGSKITNYIIEKKEVGKDVWMPVTSASAKTTCKVSKLLEGKDYIFRIHAENLYGISDPLVSDSMKAKDRFRVPDAPDQPIVTEVTKDSALVTWNKPHDGGKPITNYILEKRETMSKRWARVTKDPIHPYTKFRVPDLLEGCQYEFRVSAENEIGIGDPSPPSKPVFAKDPIAKPSPPVNPEAIDTTCNSVDLTWQPPRHDGGSKILGYIVEYQKVGDEEWRRANHTPESCPETKYKVTGLRDGQTYKFRVLAVNAAGESDPAHVPEPVLVKDRLEPPELILDANMAREQHIKVGDTLRLSAIIKGVPFPKVTWKKEDRDAPTKARIDVTPVGSKLEIRNAAHEDGGIYSLTVENPAGSKTVSVKVLVLDKPGPPRDLEVSEIRKDSCYLTWKEPLDDGGSVITNYVVERRDVASAQWSPLSATSKKKSHFAKHLNEGNQYLFRVAAENQYGRGPFVETPKPIKALDPLHPPGPPKDLHHVDVDKTEVSLVWNKPDRDGGSPITGYLVEYQEEGTQDWIKFKTVTNLECVVTGLQQGKTYRFRVKAENIVGLGLPDTTIPIECQEKLVPPSVELDVKLIEGLVVKAGTTVRFPAIIRGVPVPTAKWTTDGSEIKTDEHYTVETDNFSSVLTIKNCLRRDTGEYQITVSNAAGSKTVAVHLTVLDVPGPPTGPINILDVTPEHMTISWQPPKDDGGSPVINYIVEKQDTRKDTWGVVSSGSSKTKLKIPHLQKGCEYVFRVRAENKIGVGPPLDSTPTVAKHKFSPPSPPGKPVVTDITENAATVSWTLPKSDGGSPITGYYMERREVTGKWVRVNKTPIADLKFRVTGLYEGNTYEFRVFAENLAGLSKPSPSSDPIKACRPIKPPGPPINPKLKDKSRETADLVWTKPLSDGGSPILGYVVECQKPGTAQWNRINKDELIRQCAFRVPGLIEGNEYRFRIKAANIVGEGEPRELAESVIAKDILHPPEVELDVTCRDVITVRVGQTIRILARVKGRPEPDITWTKEGKVLVREKRVDLIQDLPRVELQIKEAVRADHGKYIISAKNSSGHAQGSAIVNVLDRPGPCQNLKVTNVTKENCTISWENPLDNGGSEITNFIVEYRKPNQKGWSIVASDVTKRLIKANLLANNEYYFRVCAENKVGVGPTIETKTPILAINPIDRPGEPENLHIADKGKTFVYLKWRRPDYDGGSPNLSYHVERRLKGSDDWERVHKGSIKETHYMVDRCVENQIYEFRVQTKNEGGESDWVKTEEVVVKEDLQKPVLDLKLSGVLTVKAGDTIRLEAGVRGKPFPEVAWTKDKDATDLTRSPRVKIDTRADSSKFSLTKAKRSDGGKYVVTATNTAGSFVAYATVNVLDKPGPVRNLKIVDVSSDRCTVCWDPPEDDGGCEIQNYILEKCETKRMVWSTYSATVLTPGTTVTRLIEGNEYIFRVRAENKIGTGPPTESKPVIAKTKYDKPGRPDPPEVTKVSKEEMTVVWNPPEYDGGKSITGYFLEKKEKHSTRWVPVNKSAIPERRMKVQNLLPDHEYQFRVKAENEIGIGEPSLPSRPVVAKDPIEPPGPPTNFRVVDTTKHSITLGWGKPVYDGGAPIIGYVVEMRPKIADASPDEGWKRCNAAAQLVRKEFTVTSLDENQEYEFRVCAQNQVGIGRPAELKEAIKPKEILEPPEIDLDASMRKLVIVRAGCPIRLFAIVRGRPAPKVTWRKVGIDNVVRKGQVDLVDTMAFLVIPNSTRDDSGKYSLTLVNPAGEKAVFVNVRVLDTPGPVSDLKVSDVTKTSCHVSWAPPENDGGSQVTHYIVEKREADRKTWSTVTPEVKKTSFHVTNLVPGNEYYFRVTAVNEYGPGVPTDVPKPVLASDPLSEPDPPRKLEVTEMTKNSATLAWLPPLRDGGAKIDGYITSYREEEQPADRWTEYSVVKDLSLVVTGLKEGKKYKFRVAARNAVGVSLPREAEGVYEAKEQLLPPKILMPEQITIKAGKKLRIEAHVYGKPHPTCKWKKGEDEVVTSSHLAVHKADSSSILIIKDVTRKDSGYYSLTAENSSGTDTQKIKVVVMDAPGPPQPPFDISDIDADACSLSWHIPLEDGGSNITNYIVEKCDVSRGDWVTALASVTKTSCRVGKLIPGQEYIFRVRAENRFGISEPLTSPKMVAQFPFGVPSEPKNARVTKVNKDCIFVAWDRPDSDGGSPIIGYLIERKERNSLLWVKANDTLVRSTEYPCAGLVEGLEYSFRIYALNKAGSSPPSKPTEYVTARMPVDPPGKPEVIDVTKSTVSLIWARPKHDGGSKIIGYFVEACKLPGDKWVRCNTAPHQIPQEEYTATGLEEKAQYQFRAIARTAVNISPPSEPSDPVTILAENVPPRIDLSVAMKSLLTVKAGTNVCLDATVFGKPMPTVSWKKDGTLLKPAEGIKMAMQRNLCTLELFSVNRKDSGDYTITAENSSGSKSATIKLKVLDKPGPPASVKINKMYSDRAMLSWEPPLEDGGSEITNYIVDKRETSRPNWAQVSATVPITSCSVEKLIEGHEYQFRICAENKYGVGDPVFTEPAIAKNPYDPPGRCDPPVISNITKDHMTVSWKPPADDGGSPITGYLLEKRETQAVNWTKVNRKPIIERTLKATGLQEGTEYEFRVTAINKAGPGKPSDASKAAYARDPQYPPGPPAFPKVYDTTRSSVSLSWGKPAYDGGSPIIGYLVEVKRADSDNWVRCNLPQNLQKTRFEVTGLMEDTQYQFRVYAVNKIGYSDPSDVPDKHYPKDILIPPEGELDADLRKTLILRAGVTMRLYVPVKGRPPPKITWSKPNVNLRDRIGLDIKSTDFDTFLRCENVNKYDAGKYILTLENSCGKKEYTIVVKVLDTPGPPVNVTVKEISKDSAYVTWEPPIIDGGSPIINYVVQKRDAERKSWSTVTTECSKTSFRVANLEEGKSYFFRVFAENEYGIGDPGETRDAVKASQTPGPVVDLKVRSVSKSSCSIGWKKPHSDGGSRIIGYVVDFLTEENKWQRVMKSLSLQYSAKDLTEGKEYTFRVSAENENGEGTPSEITVVARDDVVAPDLDLKGLPDLCYLAKENSNFRLKIPIKGKPAPSVSWKKGEDPLATDTRVSVESSAVNTTLIVYDCQKSDAGKYTITLKNVAGTKEGTISIKVVGKPGIPTGPIKFDEVTAEAMTLKWAPPKDDGGSEITNYILEKRDSVNNKWVTCASAVQKTTFRVTRLHEGMEYTFRVSAENKYGVGEGLKSEPIVARHPFDVPDAPPPPNIVDVRHDSVSLTWTDPKKTGGSPITGYHLEFKERNSLLWKRANKTPIRMRDFKVTGLTEGLEYEFRVMAINLAGVGKPSLPSEPVVALDPIDPPGKPEVINITRNSVTLIWTEPKYDGGHKLTGYIVEKRDLPSKSWMKANHVNVPECAFTVTDLVEGGKYEFRIRAKNTAGAISAPSESTETIICKDEYEAPTIVLDPTIKDGLTIKAGDTIVLNAISILGKPLPKSSWSKAGKDIRPSDITQITSTPTSSMLTIKYATRKDAGEYTITATNPFGTKVEHVKVTVLDVPGPPGPVEISNVSAEKATLTWTPPLEDGGSPIKSYILEKRETSRLLWTVVSEDIQSCRHVATKLIQGNEYIFRVSAVNHYGKGEPVQSEPVKMVDRFGPPGPPEKPEVSNVTKNTATVSWKRPVDDGGSEITGYHVERREKKSLRWVRAIKTPVSDLRCKVTGLQEGSTYEFRVSAENRAGIGPPSEASDSVLMKDAAYPPGPPSNPHVTDTTKKSASLAWGKPHYDGGLEITGYVVEHQKVGDEAWIKDTTGTALRITQFVVPDLQTKEKYNFRISAINDAGVGEPAVIPDVEIVEREMAPDFELDAELRRTLVVRAGLSIRIFVPIKGRPAPEVTWTKDNINLKNRANIENTESFTLLIIPECNRYDTGKFVMTIENPAGKKSGFVNVRVLDTPGPVLNLRPTDITKDSVTLHWDLPLIDGGSRITNYIVEKREATRKSYSTATTKCHKCTYKVTGLSEGCEYFFRVMAENEYGIGEPTETTEPVKASEAPSPPDSLNIMDITKSTVSLAWPKPKHDGGSKITGYVIEAQRKGSDQWTHITTVKGLECVVRNLTEGEEYTFQVMAVNSAGRSAPRESRPVIVKEQTMLPELDLRGIYQKLVIAKAGDNIKVEIPVLGRPKPTVTWKKGDQILKQTQRVNFETTATSTILNINECVRSDSGPYPLTARNIVGEVGDVITIQVHDIPGPPTGPIKFDEVSSDFVTFSWDPPENDGGVPISNYVVEMRQTDSTTWVELATTVIRTTYKATRLTTGLEYQFRVKAQNRYGVGPGITSACIVANYPFKVPGPPGTPQVTAVTKDSMTISWHEPLSDGGSPILGYHVERKERNGILWQTVSKALVPGNIFKSSGLTDGIAYEFRVIAENMAGKSKPSKPSEPMLALDPIDPPGKPVPLNITRHTVTLKWAKPEYTGGFKITSYIVEKRDLPNGRWLKANFSNILENEFTVSGLTEDAAYEFRVIAKNAAGAISPPSEPSDAITCRDDVEAPKIKVDVKFKDTVILKAGEAFRLEADVSGRPPPTMEWSKDGKELEGTAKLEIKIADFSTNLVNKDSTRRDSGAYTLTATNPGGFAKHIFNVKVLDRPGPPEGPLAVTEVTSEKCVLSWFPPLDDGGAKIDHYIVQKRETSRLAWTNVASEVQVTKLKVTKLLKGNEYIFRVMAVNKYGVGEPLESEPVLAVNPYGPPDPPKNPEVTTITKDSMVVCWGHPDSDGGSEIINYIVERRDKAGQRWIKCNKKTLTDLRYKVSGLTEGHEYEFRIMAENAAGISAPSPTSPFYKACDTVFKPGPPGNPRVLDTSRSSISIAWNKPIYDGGSEITGYMVEIALPEEDEWQIVTPPAGLKATSYTITGLTENQEYKIRIYAMNSEGLGEPALVPGTPKAEDRMLPPEIELDADLRKVVTIRACCTLRLFVPIKGRPAPEVKWARDHGESLDKASIESTSSYTLLIVGNVNRFDSGKYILTVENSSGSKSAFVNVRVLDTPGPPQDLKVKEVTKTSVTLTWDPPLLDGGSKIKNYIVEKRESTRKAYSTVATNCHKTSWKVDQLQEGCSYYFRVLAENEYGIGLPAETAESVKASERPLPPGKITLMDVTRNSVSLSWEKPEHDGGSRILGYIVEMQTKGSDKWATCATVKVTEATITGLIQGEEYSFRVSAQNEKGISDPRQLSVPVIAKDLVIPPAFKLLFNTFTVLAGEDLKVDVPFIGRPTPAVTWHKDNVPLKQTTRVNAESTENNSLLTIKDACREDVGHYVVKLTNSAGEAIETLNVIVLDKPGPPTGPVKMDEVTADSITLSWGPPKYDGGSSINNYIVEKRDTSTTTWQIVSATVARTTIKACRLKTGCEYQFRIAAENRYGKSTYLNSEPTVAQYPFKVPGPPGTPVVTLSSRDSMEVQWNEPISDGGSRVIGYHLERKERNSILWVKLNKTPIPQTKFKTTGLEEGVEYEFRVSAENIVGIGKPSKVSECYVARDPCDPPGRPEAIIVTRNSVTLQWKKPTYDGGSKITGYIVEKKELPEGRWMKASFTNIIDTHFEVTGLVEDHRYEFRVIARNAAGVFSEPSESTGAITARDEVDPPRISMDPKYKDTIVVHAGESFKVDADIYGKPIPTIQWIKGDQELSNTARLEIKSTDFATSLSVKDAVRVDSGNYILKAKNVAGERSVTVNVKVLDRPGPPEGPVVISGVTAEKCTLAWKPPLQDGGSDIINYIVERRETSRLVWTVVDANVQTLSCKVTKLLEGNEYTFRIMAVNKYGVGEPLESEPVVAKNPFVVPDAPKAPEVTTVTKDSMIVVWERPASDGGSEILGYVLEKRDKEGIRWTRCHKRLIGELRLRVTGLIENHDYEFRVSAENAAGLSEPSPPSAYQKACDPIYKPGPPNNPKVIDITRSSVFLSWSKPIYDGGCEIQGYIVEKCDVSVGEWTMCTPPTGINKTNIEVEKLLEKHEYNFRICAINKAGVGEHADVPGPIIVEEKLEAPDIDLDLELRKIINIRAGGSLRLFVPIKGRPTPEVKWGKVDGEIRDAAIIDVTSSFTSLVLDNVNRYDSGKYTLTLENSSGTKSAFVTVRVLDTPSPPVNLKVTEITKDSVSITWEPPLLDGGSKIKNYIVEKREATRKSYAAVVTNCHKNSWKIDQLQEGCSYYFRVTAENEYGIGLPAQTADPIKVAEVPQPPGKITVDDVTRNSVSLSWTKPEHDGGSKIIQYIVEMQAKHSEKWSECARVKSLQAVITNLTQGEEYLFRVVAVNEKGRSDPRSLAVPIVAKDLVIEPDVKPAFSSYSVQVGQDLKIEVPISGRPKPTITWTKDGLPLKQTTRINVTDSLDLTTLSIKETHKDDGGQYGITVANVVGQKTASIEIVTLDKPDPPKGPVKFDDVSAESITLSWNPPLYTGGCQITNYIVQKRDTTTTVWDVVSATVARTTLKVTKLKTGTEYQFRIFAENRYGQSFALESDPIVAQYPYKEPGPPGTPFATAISKDSMVIQWHEPVNNGGSPVIGYHLERKERNSILWTKVNKTIIHDTQFKAQNLEEGIEYEFRVYAENIVGVGKASKNSECYVARDPCDPPGTPEPIMVKRNEITLQWTKPVYDGGSMITGYIVEKRDLPDGRWMKASFTNVIETQFTVSGLTEDQRYEFRVIAKNAAGAISKPSDSTGPITAKDEVELPRISMDPKFRDTIVVNAGETFRLEADVHGKPLPTIEWLRGDKEIEESARCEIKNTDFKALLIVKDAIRIDGGQYILRASNVAGSKSFPVNVKVLDRPGPPEGPVQVTGVTSEKCSLTWSPPLQDGGSDISHYVVEKRETSRLAWTVVASEVVTNSLKVTKLLEGNEYVFRIMAVNKYGVGEPLESAPVLMKNPFVLPGPPKSLEVTNIAKDSMTVCWNRPDSDGGSEIIGYIVEKRDRSGIRWIKCNKRRITDLRLRVTGLTEDHEYEFRVSAENAAGVGEPSPATVYYKACDPVFKPGPPTNAHIVDTTKNSITLAWGKPIYDGGSEILGYVVEICKADEEEWQIVTPQTGLRVTRFEISKLTEHQEYKIRVCALNKVGLGEATSVPGTVKPEDKLEAPELDLDSELRKGIVVRAGGSARIHIPFKGRPTPEITWSREEGEFTDKVQIEKGVNYTQLSIDNCDRNDAGKYILKLENSSGSKSAFVTVKVLDTPGPPQNLAVKEVRKDSAFLVWEPPIIDGGAKVKNYVIDKRESTRKAYANVSSKCSKTSFKVENLTEGAIYYFRVMAENEFGVGVPVETVDAVKAAEPPSPPGKVTLTDVSQTSASLMWEKPEHDGGSRVLGYVVEMQPKGTEKWSIVAESKVCNAVVTGLSSGQEYQFRVKAYNEKGKSDPRVLGVPVIAKDLTIQPSLKLPFNTYSIQAGEDLKIEIPVIGRPRPNISWVKDGEPLKQTTRVNVEETATSTVLHIKEGNKDDFGKYTVTATNSAGTATENLSVIVLEKPGPPVGPVRFDEVSADFVVISWEPPAYTGGCQISNYIVEKRDTTTTTWHMVSATVARTTIKITKLKTGTEYQFRIFAENRYGKSAPLDSKAVIVQYPFKEPGPPGTPFVTSISKDQMLVQWHEPVNDGGTKIIGYHLEQKEKNSILWVKLNKTPIQDTKFKTTGLDEGLEYEFKVSAENIVGIGKPSKVSECFVARDPCDPPGRPEAIVITRNNVTLKWKKPAYDGGSKITGYIVEKKDLPDGRWMKASFTNVLETEFTVSGLVEDQRYEFRVIARNAAGNFSEPSDSSGAITARDEIDAPNASLDPKYKDVIVVHAGETFVLEADIRGKPIPDVVWSKDGKELEETAARMEIKSTIQKTTLVVKDCIRTDGGQYILKLSNVGGTKSIPITVKVLDRPGPPEGPLKVTGVTAEKCYLAWNPPLQDGGANISHYIIEKRETSRLSWTQVSTEVQALNYKVTKLLPGNEYIFRVMAVNKYGIGEPLESGPVTACNPYKPPGPPSTPEVSAITKDSMVVTWARPVDDGGTEIEGYILEKRDKEGVRWTKCNKKTLTDLRLRVTGLTEGHSYEFRVAAENAAGVGEPSEPSVFYRACDALYPPGPPSNPKVTDTSRSSVSLAWSKPIYDGGAPVKGYVVEVKEAAADEWTTCTPPTGLQGKQFTVTKLKENTEYNFRICAINSEGVGEPATLPGSVVAQERIEPPEIELDADLRKVVVLRASATLRLFVTIKGRPEPEVKWEKAEGILTDRAQIEVTSSFTMLVIDNVTRFDSGRYNLTLENNSGSKTAFVNVRVLDSPSAPVNLTIREVKKDSVTLSWEPPLIDGGAKITNYIVEKRETTRKAYATITNNCTKTTFRIENLQEGCSYYFRVLASNEYGIGLPAETTEPVKVSEPPLPPGRVTLVDVTRNTATIKWEKPESDGGSKITGYVVEMQTKGSEKWSTCTQVKTLEATISGLTAGEEYVFRVAAVNEKGRSDPRQLGVPVIARDIEIKPSVELPFHTFNVKAREQLKIDVPFKGRPQATVNWRKDGQTLKETTRVNVSSSKTVTSLSIKEASKEDVGTYELCVSNSAGSITVPITIIVLDRPGPPGPIRIDEVSCDSITISWNPPEYDGGCQISNYIVEKKETTSTTWHIVSQAVARTSIKIVRLTTGSEYQFRVCAENRYGKSSYSESSAVVAEYPFSPPGPPGTPKVVHATKSTMLVTWQVPVNDGGSRVIGYHLEYKERSSILWSKANKILIADTQMKVSGLDEGLMYEYRVYAENIAGIGKCSKSCEPVPARDPCDPPGQPEVTNITRKSVSLKWSKPHYDGGAKITGYIVERRELPDGRWLKCNYTNIQETYFEVTELTEDQRYEFRVFARNAADSVSEPSESTGPIIVKDDVEPPRVMMDVKFRDVIVVKAGEVLKINADIAGRPLPVISWAKDGIEIEERARTEIISTDNHTLLTVKDCIRRDTGQYVLTLKNVAGTRSVAVNCKVLDKPGPPAGPLEINGLTAEKCSLSWGRPQEDGGADIDYYIVEKRETSHLAWTICEGELQMTSCKVTKLLKGNEYIFRVTGVNKYGVGEPLESVAIKALDPFTVPSPPTSLEITSVTKESMTLCWSRPESDGGSEISGYIIERREKNSLRWVRVNKKPVYDLRVKSTGLREGCEYEYRVYAENAAGLSLPSETSPLIRAEDPVFLPSPPSKPKIVDSGKTTITIAWVKPLFDGGAPITGYTVEYKKSDDTDWKTSIQSLRGTEYTISGLTTGAEYVFRVKSVNKVGASDPSDSSDPQIAKEREEEPLFDIDSEMRKTLIVKAGASFTMTVPFRGRPVPNVLWSKPDTDLRTRAYVDTTDSRTSLTIENANRNDSGKYTLTIQNVLSAASLTLVVKVLDTPGPPTNITVQDVTKESAVLSWDVPENDGGAPVKNYHIEKREASKKAWVSVTNNCNRLSYKVTNLQEGAIYYFRVSGENEFGVGIPAETKEGVKITEKPSPPEKLGVTSISKDSVSLTWLKPEHDGGSRIVHYVVEALEKGQKNWVKCAVAKSTHHVVSGLRENSEYFFRVFAENQAGLSDPRELLLPVLIKEQLEPPEIDMKNFPSHTVYVRAGSNLKVDIPISGKPLPKVTLSRDGVPLKATMRFNTEITAENLTINLKESVTADAGRYEITAANSSGTTKAFINIVVLDRPGPPTGPVVISDITEESVTLKWEPPKYDGGSQVTNYILLKRETSTAVWTEVSATVARTMMKVMKLTTGEEYQFRIKAENRFGISDHIDSACVTVKLPYTTPGPPSTPWVTNVTRESITVGWHEPVSNGGSAVVGYHLEMKDRNSILWQKANKLVIRTTHFKVTTISAGLIYEFRVYAENAAGVGKPSHPSEPVLAIDACEPPRNVRITDISKNSVSLSWQQPAFDGGSKITGYIVERRDLPDGRWTKASFTNVTETQFIISGLTQNSQYEFRVFARNAVGSISNPSEVVGPITCIDSYGGPVIDLPLEYTEVVKYRAGTSVKLRAGISGKPAPTIEWYKDDKELQTNALVCVENTTDLASILIKDADRLNSGCYELKLRNAMGSASATIRVQILDKPGPPGGPIEFKTVTAEKITLLWRPPADDGGAKITHYIVEKRETSRVVWSMVSEHLEECIITTTKIIKGNEYIFRVRAVNKYGIGEPLESDSVVAKNAFVTPGPPGIPEVTKITKNSMTVVWSRPIADGGSDISGYFLEKRDKKSLGWFKVLKETIRDTRQKVTGLTENSDYQYRVCAVNAAGQGPFSEPSEFYKAADPIDPPGPPAKIRIADSTKSSITLGWSKPVYDGGSAVTGYVVEIRQGEEEEWTTVSTKGEVRTTEYVVSNLKPGVNYYFRVSAVNCAGQGEPIEMNEPVQAKDILEAPEIDLDVALRTSVIAKAGEDVQVLIPFKGRPPPTVTWRKDEKNLGSDARYSIENTDSSSLLTIPQVTRNDTGKYILTIENGVGEPKSSTVSVKVLDTPAACQKLQVKHVSRGTVTLLWDPPLIDGGSPIINYVIEKRDATKRTWSVVSHKCSSTSFKLIDLSEKTPFFFRVLAENEIGIGEPCETTEPVKAAEVPAPIRDLSMKDSTKTSVILSWTKPDFDGGSVITEYVVERKGKGEQTWSHAGISKTCEIEVSQLKEQSVLEFRVFAKNEKGLSDPVTIGPITVKELIITPEVDLSDIPGAQVTVRIGHNVHLELPYKGKPKPSISWLKDGLPLKESEFVRFSKTENKITLSIKNAKKEHGGKYTVILDNAVCRIAVPITVITLGPPSKPKGPIRFDEIKADSVILSWDVPEDNGGGEITCYSIEKRETSQTNWKMVCSSVARTTFKVPNLVKDAEYQFRVRAENRYGVSQPLVSSIIVAKHQFRIPGPPGKPVIYNVTSDGMSLTWDAPVYDGGSEVTGFHVEKKERNSILWQKVNTSPISGREYRATGLVEGLDYQFRVYAENSAGLSSPSDPSKFTLAVSPVDPPGTPDYIDVTRETITLKWNPPLRDGGSKIVGYSIEKRQGNERWVRCNFTDVSECQYTVTGLSPGDRYEFRIIARNAVGTISPPSQSSGIIMTRDENVPPIVEFGPEYFDGLIIKSGESLRIKALVQGRPVPRVTWFKDGVEIEKRMNMEITDVLGSTSLFVRDATRDHRGVYTVEAKNASGSAKAEIKVKVQDTPGKVVGPIRFTNITGEKMTLWWDAPLNDGCAPITHYIIEKRETSRLAWALIEDKCEAQSYTAIKLINGNEYQFRVSAVNKFGVGRPLDSDPVVAQIQYTVPDAPGIPEPSNITGNSITLTWARPESDGGSEIQQYILERREKKSTRWVKVISKRPISETRFKVTGLTEGNEYEFHVMAENAAGVGPASGISRLIKCREPVNPPGPPTVVKVTDTSKTTVSLEWSKPVFDGGMEIIGYIIEMCKADLGDWHKVNAEACVKTRYTVTDLQAGEEYKFRVSAINGAGKGDSCEVTGTIKAVDRLTAPELDIDANFKQTHVVRAGASIRLFIAYQGRPTPTAVWSKPDSNLSLRADIHTTDSFSTLTVENCNRNDAGKYTLTVENNSGSKSITFTVKVLDTPGPPGPITFKDVTRGSATLMWDAPLLDGGARIHHYVVEKREASRRSWQVISEKCTRQIFKVNDLAEGVPYYFRVSAVNEYGVGEPYEMPEPIVATEQPAPPRRLDVVDTSKSSAVLAWLKPDHDGGSRITGYLLEMRQKGSDFWVEAGHTKQLTFTVERLVEKTEYEFRVKAKNDAGYSEPREAFSSVIIKEPQIEPTADLTGITNQLITCKAGSPFTIDVPISGRPAPKVTWKLEEMRLKETDRVSITTTKDRTTLTVKDSMRGDSGRYFLTLENTAGVKTFSVTVVVIGRPGPVTGPIEVSSVSAESCVLSWGEPKDGGGTEITNYIVEKRESGTTAWQLVNSSVKRTQIKVTHLTKYMEYSFRVSSENRFGVSKPLESAPIIAEHPFVPPSAPTRPEVYHVSANAMSIRWEEPYHDGGSKIIGYWVEKKERNTILWVKENKVPCLECNYKVTGLVEGLEYQFRTYALNAAGVSKASEASRPIMAQNPVDAPGRPEVTDVTRSTVSLIWSAPAYDGGSKVVGYIIERKPVSEVGDGRWLKCNYTIVSDNFFTVTALSEGDTYEFRVLAKNAAGVISKGSESTGPVTCRDEYAPPKAELDARLHGDLVTIRAGSDLVLDAAVGGKPEPKIIWTKGDKELDLCEKVSLQYTGKRATAVIKFCDRSDSGKYTLTVKNASGTKAVSVMVKVLDSPGPCGKLTVSRVTQEKCTLAWSLPQEDGGAEITHYIVERRETSRLNWVIVEGECPTLSYVVTRLIKNNEYIFRVRAVNKYGPGVPVESEPIVARNSFTIPSPPGIPEEVGTGKEHIIIQWTKPESDGGNEISNYLVDKREKKSLRWTRVNKDYVVYDTRLKVTSLMEGCDYQFRVTAVNAAGNSEPSEASNFISCREPSYTPGPPSAPRVVDTTKHSISLAWTKPMYDGGTDIVGYVLEMQEKDTDQWYRVHTNATIRNTEFTVPDLKMGQKYSFRVAAVNVKGMSEYSESIAEIEPVERIEIPDLELADDLKKTVTIRAGASLRLMVSVSGRPPPVITWSKQGIDLASRAIIDTTESYSLLIVDKVNRYDAGKYTIEAENQSGKKSATVLVKVYDTPGPCPSVKVKEVSRDSVTITWEIPTIDGGAPVNNYIVEKREAAMRAFKTVTTKCSKTLYRISGLVEGTMYYFRVLPENIYGIGEPCETSDAVLVSEVPLVPAKLEVVDVTKSTVTLAWEKPLYDGGSRLTGYVLEACKAGTERWMKVVTLKPTVLEHTVTSLNEGEQYLFRIRAQNEKGVSEPRETVTAVTVQDLRVLPTIDLSTMPQKTIHVPAGRPVELVIPIAGRPPPAASWFFAGSKLRESERVTVETHTKVAKLTIRETTIRDTGEYTLELKNVTGTTSETIKVIILDKPGPPTGPIKIDEIDATSITISWEPPELDGGAPLSGYVVEQRDAHRPGWLPVSESVTRSTFKFTRLTEGNEYVFRVAATNRFGIGSYLQSEVIECRSSIRIPGPPETLQIFDVSRDGMTLTWYPPEDDGGSQVTGYIVERKEVRADRWVRVNKVPVTMTRYRSTGLTEGLEYEHRVTAINARGSGKPSRPSKPIVAMDPIAPPGKPQNPRVTDTTRTSVSLAWSVPEDEGGSKVTGYLIEMQKVDQHEWTKCNTTPTKIREYTLTHLPQGAEYRFRVLACNAGGPGEPAEVPGTVKVTEMLEYPDYELDERYQEGIFVRQGGVIRLTIPIKGKPFPICKWTKEGQDISKRAMIATSETHTELVIKEADRGDSGTYDLVLENKCGKKAVYIKVRVIGSPNSPEGPLEYDDIQVRSVRVSWRPPADDGGADILGYILERREVPKAAWYTIDSRVRGTSLVVKGLKENVEYHFRVSAENQFGISKPLKSEEPVTPKTPLNPPEPPSNPPEVLDVTKSSVSLSWSRPKDDGGSRVTGYYIERKETSTDKWVRHNKTQITTTMYTVTGLVPDAEYQFRIIAQNDVGLSETSPASEPVVCKDPFDKPSQPGELEILSISKDSVTLQWEKPECDGGKEILGYWVEYRQSGDSAWKKSNKERIKDKQFTIGGLLEATEYEFRVFAENETGLSRPRRTAMSIKTKLTSGEAPGIRKEMKDVTTKLGEAAQLSCQIVGRPLPDIKWYRFGKELIQSRKYKMSSDGRTHTLTVMTEEQEDEGVYTCIATNEVGEVETSSKLLLQATPQFHPGYPLKEKYYGAVGSTLRLHVMYIGRPVPAMTWFHGQKLLQNSENITIENTEHYTHLVMKNVQRKTHAGKYKVQLSNVFGTVDAILDVEIQDKPDKPTGPIVIEALLKNSAVISWKPPADDGGSWITNYVVEKCEAKEGAEWQLVSSAISVTTCRIVNLTENAGYYFRVSAQNTFGISDPLEVSSVVIIKSPFEKPGAPGKPTITAVTKDSCVVAWKPPASDGGAKIRNYYLEKREKKQNKWISVTTEEIRETVFSVKNLIEGLEYEFRVKCENLGGESEWSEISEPITPKSDVPIQAPHFKEELRNLNVRYQSNATLVCKVTGHPKPIVKWYRQGKEIIADGLKYRIQEFKGGYHQLIIASVTDDDATVYQVRATNQGGSVSGTASLEVEVPAKIHLPKTLEGMGAVHALRGEVVSIKIPFSGKPDPVITWQKGQDLIDNNGHYQVIVTRSFTSLVFPNGVERKDAGFYVVCAKNRFGIDQKTVELDVADVPDPPRGVKVSDVSRDSVNLTWTEPASDGGSKITNYIVEKCATTAERWLRVGQARETRYTVINLFGKTSYQFRVIAENKFGLSKPSEPSEPTITKEDKTRAMNYDEEVDETREVSMTKASHSSTKELYEKYMIAEDLGRGEFGIVHRCVETSSKKTYMAKFVKVKGTDQVLVKKEISILNIARHRNILHLHESFESMEELVMIFEFISGLDIFERINTSAFELNEREIVSYVHQVCEALQFLHSHNIGHFDIRPENIIYQTRRSSTIKIIEFGQARQLKPGDNFRLLFTAPEYYAPEVHQHDVVSTATDMWSLGTLVYVLLSGINPFLAETNQQIIENIMNAEYTFDEEAFKEISIEAMDFVDRLLVKERKSRMTASEALQHPWLKQKIERVSTKVIRTLKHRRYYHTLIKKDLNMVVSAARISCGGAIRSQKGVSVAKVKVASIEIGPVSGQIMHAVGEEGGHVKYVCKIENYDQSTQVTWYFGVRQLENSEKYEITYEDGVAILYVKDITKLDDGTYRCKVVNDYGEDSSYAELFVKGVREVYDYYCRRTMKKIKRRTDTMRLLERPPEFTLPLYNKTAYVGENVRFGVTITVHPEPHVTWYKSGQKIKPGDNDKKYTFESDKGLYQLTINSVTTDDDAEYTVVARNKYGEDSCKAKLTVTLHPPPTDSTLRPMFKRLLANAECQEGQSVCFEIRVSGIPPPTLKWEKDGQPLSLGPNIEIIHEGLDYYALHIRDTLPEDTGYYRVTATNTAGSTSCQAHLQVERLRYKKQEFKSKEEHERHVQKQIDKTLRMAEILSGTESVPLTQVAKEALREAAVLYKPAVSTKTVKGEFRLEIEEKKEERKLRMPYDVPEPRKYKQTTIEEDQRIKQFVPMSDMKWYKKIRDQYEMPGKLDRVVQKRPKRIRLSRWEQFYVMPLPRITDQYRPKWRIPKLSQDDLEIVRPARRRTPSPDYDFYYRPRRRSLGDISDEELLLPIDDYLAMKRTEEERLRLEEELELGFSASPPSRSPPHFELSSLRYSSPQAHVKVEETRKDFRYSTYHIPTKAEASTSYAELRERHAQAAYRQPKQRQRIMAEREDEELLRPVTTTQHLSEYKSELDFMSKEEKSRKKSRRQREVTEITEIEEEYEISKHAQRESSSSASRLLRRRRSLSPTYIELMRPVSELIRSRPQPAEEYEDDTERRSPTPERTRPRSPSPVSSERSLSRFERSARFDIFSRYESMKAALKTQKTSERKYEVLSQQPFTLDHAPRITLRMRSHRVPCGQNTRFILNVQSKPTAEVKWYHNGVELQESSKIHYTNTSGVLTLEILDCHTDDSGTYRAVCTNYKGEASDYATLDVTGGDYTTYASQRRDEEVPRSVFPELTRTEAYAVSSFKKTSEMEASSSVREVKSQMTETRESLSSYEHSASAEMKSAALEEKSLEEKSTTRKIKTTLAARILTKPRSMTVYEGESARFSCDTDGEPVPTVTWLRKGQVLSTSARHQVTTTKYKSTFEISSVQASDEGNYSVVVENSEGKQEAEFTLTIQKARVTEKAVTSPPRVKSPEPRVKSPEAVKSPKRVKSPEPSHPKAVSPTETKPTPTEKVQHLPVSAPPKITQFLKAEASKEIAKLTCVVESSVLRAKEVTWYKDGKKLKENGHFQFHYSADGTYELKINNLTESDQGEYVCEISGEGGTSKTNLQFMGQAFKSIHEKVSKISETKKSDQKTTESTVTRKTEPKAPEPISSKPVIVTGLQDTTVSSDSVAKFAVKATGEPRPTAIWTKDGKAITQGGKYKLSEDKGGFFLEIHKTDTSDSGLYTCTVKNSAGSVSSSCKLTIKAIKDTEAQKVSTQKTSEITPQKKAVVQEEISQKALRSEEIKMSEAKSQEKLALKEEASKVLISEEVKKSAATSLEKSIVHEEITKTSQASEEVRTHAEIKAFSTQMSINEGQRLVLKANIAGATDVKWVLNGVELTNSEEYRYGVSGSDQTLTIKQASHRDEGILTCISKTKEGIVKCQYDLTLSKELSDAPAFISQPRSQNINEGQNVLFTCEISGEPSPEIEWFKNNLPISISSNVSISRSRNVYSLEIRNASVSDSGKYTIKAKNFRGQCSATASLMVLPLVEEPSREVVLRTSGDTSLQGSFSSQSVQMSASKQEASFSSFSSSSASSMTEMKFASMSAQSMSSMQESFVEMSSSSFMGISNMTQLESSTSKMLKAGIRGIPPKIEALPSDISIDEGKVLTVACAFTGEPTPEVTWSCGGRKIHSQEQGRFHIENTDDLTTLIIMDVQKQDGGLYTLSLGNEFGSDSATVNIHIRSI
"
     misc_feature    241..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    262..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    535..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    556..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    1753..1872
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    1879..2004
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2017..2142
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2914..3183
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    2965..3168
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    3331..3600
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    3382..3597
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    3964..4230
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4009..4215
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    4456..4728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4495..4728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    4753..5028
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4774..5028
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    <5251..5469
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    5608..5874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    5626..5874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    6319..6591
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6370..6579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    6610..6873
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6628..6873
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    6889..7143
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6907..>7095
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    <7249..>7374
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    7426..7677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7441..7677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    7687..7938
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7951..8199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7969..8199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    8209..8463
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8473..8724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8488..8724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    8734..8985
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8752..8988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    8998..9246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9013..9246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    9262..9513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9280..9513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    <9622..9786
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9844..10065
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9871..10062
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    10120..10380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10141..10383
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    10690..10959
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10711..10959
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    11170..11439
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    11221..11430
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    11524..11796
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    11590..11787
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    13528..13794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    <13612..13794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    13810..14079
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    13861..14070
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14656..14931
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    14716..14922
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14989..15180
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    15247..>15441
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    15508..15753
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15772..16020
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16033..16284
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16051..16284
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    16297..16548
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16327..16548
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    16564..16815
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16588..16815
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    16849..17073
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    17098..17349
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17383..>17577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    17632..17883
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17905..18150
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17917..18150
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    18166..18417
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18190..18426
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of semaphorin;
                     Region: Ig_Semaphorin_C; cd04979"
                     /db_xref="CDD:143180"
     misc_feature    order(18211..18213,18340..18342)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:143180"
     misc_feature    18493..18651
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    18721..18915
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    18967..19218
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18982..19218
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    19231..19497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19249..19497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    19513..19764
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19531..19764
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    19780..20031
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19798..20031
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    20047..>20256
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20329..20568
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20356..20568
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    20578..20844
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(20578..20580,20773..20775,20821..20823)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(20824..20829,20833..20838)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    20881..21159
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(20881..20883,21079..21081,21124..21126)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(21127..21132,21136..21141)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    21184..21465
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(21184..21186,21382..21384,21427..21429)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(21430..21435,21439..21444)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    21526..21762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21541..21762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    21772..22029
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(21772..21774,21967..21969,22012..22014)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(22015..22020,22024..22029)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    22072..22341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(22072..22074,22267..22269,22312..22314)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(22315..22320,22324..22329)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    22408..22650
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    22429..22650
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    22660..22938
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(22660..22662,22855..22857,22900..22902)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(22903..22908,22912..22917)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    22957..23229
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(22957..22959,23155..23157,23200..23202)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23203..23208,23212..23217)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23281..23529
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(23455..23457,23500..23502)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23503..23508,23512..23517)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23560..23829
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(23560..23562,23755..23757,23800..23802)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23803..23808,23812..23817)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23860..24135
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(23860..23862,24058..24060,24103..24105)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(24106..24111,24115..24120)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    24184..24438
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(24364..24366,24409..24411)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(24412..24417,24421..24426)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    24469..24738
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24517..24738
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    24748..25008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(24748..24750,24943..24945,24988..24990)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(24991..24996,25000..25005)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    25084..25326
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(25246..25248,25291..25293)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(25294..25299,25303..25308)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    25369..25704
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    25405..25704
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    25714..25998
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(25714..25716,25915..25917,25960..25962)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(25963..25968,25972..25977)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    26017..26295
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(26017..26019,26212..26214,26257..26259)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(26260..26265,26269..26274)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    26335..26595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(26512..26514,26557..26559)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(26560..26565,26569..26574)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    26671..26889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    26899..27168
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(26899..26901,27091..27093,27136..27138)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(27139..27144,27148..27153)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    27193..27471
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(27193..27195,27391..27393,27436..27438)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(27439..27444,27448..27453)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    27553..27792
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    27802..28083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(27802..27804,28003..28005,28048..28050)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(28051..28056,28060..28065)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    28105..28392
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(28105..28107,28318..28320,28363..28365)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(28366..28371,28375..28380)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    28423..28698
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(28423..28425,28627..28629,28672..28674)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(28675..28680,28684..28689)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    28789..29034
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    29044..29322
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(29044..29046,29239..29241,29284..29286)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(29287..29292,29296..29301)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    29344..29640
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(29344..29346,29557..29559,29602..29604)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(29605..29610,29614..29619)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    29686..29949
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    29959..30240
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(29959..29961,30157..30159,30202..30204)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(30205..30210,30214..30219)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    30259..30552
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(30259..30261,30469..30471,30514..30516)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(30517..30522,30526..30531)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    30571..30849
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(30571..30573,30769..30771,30814..30816)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(30817..30822,30826..30831)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    30931..31146
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    31156..31431
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(31156..31158,31354..31356,31399..31401)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(31402..31407,31411..31416)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    31459..31740
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(31459..31461,31657..31659,31702..31704)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(31705..31710,31714..31719)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    31834..32022
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    32068..32325
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(32242..32244,32287..32289)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(32290..32295,32299..32304)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    32344..32613
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(32344..32346,32542..32544,32587..32589)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(32590..32595,32599..32604)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    32647..32913
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(32647..32649,32851..32853,32896..32898)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(32899..32904,32908..32913)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    33013..33228
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    33238..33501
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(33238..33240,33433..33435,33478..33480)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(33481..33486,33490..33495)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    33538..33807
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(33538..33540,33730..33732,33775..33777)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(33778..33783,33787..33792)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    33868..34110
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    33889..34110
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    34120..34401
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(34120..34122,34318..34320,34363..34365)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(34366..34371,34375..34380)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    34420..34695
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(34420..34422,34615..34617,34660..34662)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(34663..34668,34672..34677)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    34744..34995
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(34921..34923,34966..34968)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(34969..34974,34978..34983)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    35083..35304
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    35314..35586
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(35314..35316,35506..35508,35551..35553)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(35554..35559,35563..35568)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    35611..35892
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(35611..35613,35809..35811,35854..35856)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(35857..35862,35866..35871)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    35911..36189
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    35962..36189
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    36199..36477
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(36199..36201,36394..36396,36439..36441)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(36442..36447,36451..36456)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    36496..36777
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(36496..36498,36694..36696,36739..36741)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(36742..36747,36751..36756)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    36799..37095
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(36799..36801,37015..37017,37060..37062)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(37063..37068,37072..37077)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    37177..37395
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    37405..37665
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(37405..37407,37600..37602,37645..37647)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(37648..37653,37657..37662)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    37705..37983
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(37705..37707,37903..37905,37948..37950)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(37951..37956,37960..37965)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    38023..38274
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    38053..38274
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    38284..38550
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(38284..38286,38482..38484,38527..38529)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(38530..38535,38539..38544)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    38584..38865
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(38584..38586,38782..38784,38827..38829)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(38830..38835,38839..38844)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    38881..39165
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39082..39084,39127..39129)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(39130..39135,39139..39144)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    39223..39465
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    39244..39465
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    39475..39753
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39475..39477,39670..39672,39715..39717)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(39718..39723,39727..39732)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    39772..40041
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39772..39774,39970..39972,40015..40017)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40018..40023,40027..40032)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40075..40341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40075..40077,40276..40278,40321..40323)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40324..40329,40333..40338)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40411..40659
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    40438..40659
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    40669..40944
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40669..40671,40864..40866,40909..40911)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40912..40917,40921..40926)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40960..41226
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40960..40962,41149..41151,41194..41196)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(41197..41202,41206..41211)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41305..41526
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    41536..41817
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(41536..41538,41734..41736,41779..41781)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(41782..41787,41791..41796)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41878..42117
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42034..42036,42079..42081)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42082..42087,42091..42096)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42133..42411
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42328..42330,42373..42375)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42379..42384,42388..42393)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42511..42717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    42727..43002
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42727..42729,42922..42924,42967..42969)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42970..42975,42979..42984)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43024..43296
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43024..43026,43222..43224,43267..43269)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43270..43275,43279..43284)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43327..43590
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43327..43329,43528..43530,43573..43575)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43576..43581,43585..43590)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43660..43902
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    43687..43902
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    43912..44181
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43912..43914,44107..44109,44152..44154)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44155..44160,44164..44169)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44203..44478
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44203..44205,44395..44397,44440..44442)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44443..44448,44452..44457)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44554..44778
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    44785..45066
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44785..44787,44983..44985,45028..45030)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45031..45036,45040..45045)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45085..45357
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45085..45087,45283..45285,45328..45330)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45331..45336,45340..45345)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45382..45663
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45577..45579,45622..45624)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45628..45633,45637..45642)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45694..45963
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    45745..45963
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    45973..46248
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45973..45975,46171..46173,46216..46218)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46219..46224,46228..46233)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46294..46551
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46471..46473,46516..46518)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46519..46524,46528..46533)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46576..46839
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46576..46578,46777..46779,46822..46824)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46825..46830,46834..46839)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46912..47154
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    46939..47154
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    47164..47433
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47164..47166,47359..47361,47404..47406)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47407..47412,47416..47421)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47455..47706
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47455..47457,47647..47649,47692..47694)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47695..47700,47704..47706)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47752..48021
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    47800..48021
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    48031..48312
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48031..48033,48229..48231,48274..48276)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48277..48282,48286..48291)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48367..48612
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48529..48531,48574..48576)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48577..48582,48586..48591)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48628..48909
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48823..48825,48868..48870)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48871..48873,48877..48879,48883..48888)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48967..49209
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    48988..49209
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    49219..49500
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49219..49221,49417..49419,49462..49464)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49465..49470,49474..49479)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49519..49788
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49519..49521,49717..49719,49762..49764)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49765..49770,49774..49779)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49822..50088
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49822..49824,50023..50025,50068..50070)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50071..50076,50080..50085)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50185..50400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    50410..50685
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50410..50412,50605..50607,50650..50652)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50653..50658,50662..50667)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50701..50952
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50701..50703,50893..50895,50938..50940)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50941..50946,50950..50952)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51031..51258
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    51046..51261
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    51277..51558
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51277..51279,51475..51477,51520..51522)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51523..51528,51532..51537)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51577..51858
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51577..51579,51775..51777,51820..51822)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51823..51828,51832..51837)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51874..52155
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52069..52071,52114..52116)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52120..52125,52129..52134)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52195..52455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    52234..52455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    52465..52740
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52465..52467,52663..52665,52708..52710)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52711..52716,52720..52725)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52765..53043
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52765..52767,52963..52965,53008..53010)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53011..53016,53020..53025)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53068..53334
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53068..53070,53269..53271,53314..53316)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53317..53322,53326..53331)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53404..53646
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    53437..53646
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    53656..53931
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53656..53658,53851..53853,53896..53898)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53899..53904,53908..53913)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53947..54198
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53947..53949,54139..54141,54184..54186)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54187..54192,54196..54198)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54277..54513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    54292..54513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    54523..54804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54523..54525,54721..54723,54766..54768)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54769..54774,54778..54783)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54823..55098
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54823..54825,55021..55023,55066..55068)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55069..55074,55078..55083)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55120..55401
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55315..55317,55360..55362)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55363..55365,55369..55371,55375..55380)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55480..55704
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    55714..55995
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55714..55716,55912..55914,55957..55959)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55960..55965,55969..55974)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56014..56292
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56014..56016,56212..56214,56257..56259)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56260..56265,56269..56274)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56317..56583
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56317..56319,56518..56520,56563..56565)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56566..56571,56575..56580)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56653..56895
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    56680..56895
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    56905..57174
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56905..56907,57100..57102,57145..57147)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(57148..57153,57157..57162)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    57196..57447
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57196..57198,57388..57390,57433..57435)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(57436..57441,57445..57447)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    57493..57762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    57541..57762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    57772..58017
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57772..57774,57967..57969,58012..58014)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    58090..58341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58267..58269,58312..58314)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58315..58320,58324..58329)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58366..58635
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58561..58563,58609..58611)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58612..58617,58621..58626)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58726..58947
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    58957..59238
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58957..58959,59155..59157,59200..59202)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59203..59208,59212..59217)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59257..59535
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59257..59259,59455..59457,59500..59502)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59503..59508,59512..59517)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59560..59835
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59560..59562,59755..59757,59800..59802)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59803..59808,59812..59817)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59890..60132
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    59917..60132
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    60142..60417
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60142..60144,60337..60339,60382..60384)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60385..60390,60394..60399)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60433..60684
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60433..60435,60625..60627,60670..60672)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60673..60678,60682..60684)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60754..61008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    60787..61008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    61018..61299
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61018..61020,61216..61218,61261..61263)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61264..61269,61273..61278)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61318..61590
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61318..61320,61516..61518,61561..61563)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61564..61569,61573..61578)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61615..61896
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61810..61812,61855..61857)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61861..61866,61870..61875)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61918..62196
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    61975..62196
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    62206..62487
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62206..62208,62404..62406,62449..62451)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62452..62457,62461..62466)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62506..62784
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62506..62508,62704..62706,62749..62751)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62752..62757,62761..62766)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62830..63075
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63010..63012,63055..63057)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63058..63063,63067..63072)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63145..63396
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    63172..63396
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    63406..63675
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63406..63408,63601..63603,63646..63648)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63649..63654,63658..63663)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63697..63972
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63697..63699,63889..63891,63934..63936)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63937..63942,63946..63951)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64048..64230
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    64279..64560
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64279..64281,64477..64479,64522..64524)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64525..64530,64534..64539)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64579..64857
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64579..64581,64777..64779,64822..64824)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64825..64830,64834..64839)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64876..65151
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65068..65070,65113..65115)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65116..65118,65122..65124,65128..65133)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65233..65454
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    65485..65745
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65662..65664,65707..65709)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65710..65715,65719..65724)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65764..66027
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65764..65766,65965..65967,66010..66012)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66013..66018,66022..66027)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66070..66339
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66070..66072,66268..66270,66313..66315)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66316..66321,66325..66330)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66430..66645
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    66655..66909
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66655..66657,66850..66852,66895..66897)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66898..66903,66907..66909)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66946..67212
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66946..66948,67138..67140,67183..67185)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67186..67191,67195..67200)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67300..67521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    67531..67812
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67531..67533,67729..67731,67774..67776)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67777..67782,67786..67791)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67831..68109
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67831..67833,68029..68031,68074..68076)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68077..68082,68086..68091)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68128..68418
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68332..68334,68377..68379)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68380..68382,68386..68388,68392..68397)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68500..68721
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    68731..69009
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68731..68733,68926..68928,68971..68973)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68974..68979,68983..68988)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69028..69312
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69028..69030,69229..69231,69274..69276)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69277..69282,69286..69291)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69334..69606
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69334..69336,69535..69537,69580..69582)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69583..69588,69592..69597)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69670..69912
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    69697..69912
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    69922..70197
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69922..69924,70117..70119,70162..70164)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70165..70170,70174..70179)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70213..70494
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70213..70215,70411..70413,70456..70458)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70459..70464,70468..70473)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70546..70794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    70573..70794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    70804..71079
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70804..70806,71002..71004,71047..71049)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71050..71055,71059..71064)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71104..71373
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71104..71106,71302..71304,71347..71349)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71350..71355,71359..71364)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71407..71643
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71407..71409,71605..71607)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    71767..71982
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    71992..72264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71992..71994,72190..72192,72235..72237)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72238..72243,72247..72252)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72328..72579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72496..72498,72541..72543)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72544..72549,72553..72558)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72601..72858
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72601..72603,72799..72801,72844..72846)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72847..72852,72856..72858)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72907..73170
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    72958..73161
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    73243..73461
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    73477..73758
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(73477..73479,73678..73680,73723..73725)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73726..73731,73735..73740)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73783..74064
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(73783..73785,73981..73983,74026..74028)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(74029..74034,74038..74043)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    74092..74367
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    74143..74358
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    74440..74664
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    74674..74946
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(74674..74676,74866..74868,74911..74913)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(74914..74919,74923..74928)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    75061..75825
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    75079..75819
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Catalytic domain of Protein Kinases; Region: PKc;
                     cd00180"
                     /db_xref="CDD:173623"
     misc_feature    order(75079..75093,75103..75105,75142..75144,75148..75150,
                     75232..75234,75280..75291,75301..75303,75307..75309,
                     75421..75423,75427..75429,75433..75438,75442..75444,
                     75481..75483,75490..75492,75535..75546)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="active site"
                     /db_xref="CDD:173623"
     misc_feature    order(75079..75093,75103..75105,75142..75144,75148..75150,
                     75232..75234,75280..75291,75301..75303,75421..75423,
                     75427..75429,75433..75438,75442..75444,75481..75483)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173623"
     misc_feature    order(75091..75093,75301..75303,75307..75309,75421..75423,
                     75427..75429,75433..75435,75490..75492,75535..75546)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173623"
     misc_feature    order(75478..75498,75535..75546)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173623"
     misc_feature    76063..76275
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    76378..76656
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    76402..76656
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    76693..76965
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    76729..76965
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    78430..78699
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    78451..78699
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    78982..79257
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="M5, fifth immunoglobulin (Ig)-like domain of human
                     titin C terminus and similar proteins; Region:
                     Ig5_Titin_like; cd05747"
                     /db_xref="CDD:143224"
     misc_feature    78994..79260
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    79462..79716
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    79507..79725
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    79864..80133
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    79885..80133
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    80443..80685
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    80710..80979
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    80728..80979
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    81295..81570
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    81364..81570
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     exon            317..520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       381
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647842"
     exon            521..808
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       767
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647843"
     exon            809..894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647844"
     exon            895..1139
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1140..1470
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647845"
     variation       1228
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647846"
     exon            1471..1623
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1624..1761
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1672
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34337578"
     variation       1717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647851"
     exon            1762..1887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1888..2025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2026..2163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2160
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72647860"
     exon            2164..2457
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2458..2580
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2519
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35813871"
     exon            2581..2862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2698
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647861"
     variation       2851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647862"
     exon            2863..2928
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2929..3187
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2945
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647865"
     exon            3188..3251
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647867"
     variation       3220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647868"
     exon            3252..3467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             3399..3542
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1574E"
                     /db_xref="UniSTS:150658"
     exon            3468..3610
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3496
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647870"
     exon            3611..3816
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            3817..4050
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3846
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2291308"
     variation       3971
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1552280"
     exon            4051..4295
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4071
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72647872"
     exon            4296..4567
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647875"
     variation       4409
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647876"
     exon            4568..4732
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             4622..4728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="A008T22"
                     /db_xref="UniSTS:24210"
     variation       4717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647877"
     exon            4733..4901
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            4902..6595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       5475
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647878"
     STS             6193..6321
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1524E"
                     /db_xref="UniSTS:45880"
     variation       6335
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:72647879"
     exon            6596..6877
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       6747
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647880"
     variation       6860
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647881"
     exon            6878..7144
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7145..7417
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7418..7681
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7682..7942
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7943..8203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8204..8467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8468..8728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8676
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647883"
     exon            8729..8989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8774
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647884"
     exon            8990..9250
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647885"
     variation       9237
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647886"
     exon            9251..9392
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9393..9558
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9446
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647894"
     exon            9559..9790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9791..10075
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10076..10201
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10202..10390
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10391..10966
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10967..11023
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            11024..13804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       11082
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648918"
     variation       11687
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648919"
     variation       11967
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742357"
     variation       12128
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648920"
     variation       12270
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648921"
     variation       12492
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746578"
     variation       12930
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1883084"
     variation       12974
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648922"
     variation       13512
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1883085"
     exon            13805..14083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14084..14164
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14165..14239
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14240..14329
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14330..14392
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14393..14482
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14483..14533
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14534..14935
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       14709
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650077"
     variation       14710
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650078"
     exon            14936..15214
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15018
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650079"
     exon            15215..15490
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            15491..15630
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            15631..15757
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            15758..16021
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15910
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650080"
     exon            16022..16288
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16153
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650081"
     exon            16289..16552
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            16553..16692
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             16554..16662
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1881"
                     /db_xref="UniSTS:153573"
     exon            16693..16819
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650084"
     exon            16820..17086
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17087..17353
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17354..17620
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17524
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650088"
     exon            17621..17760
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17761..17887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17888..18030
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17956
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677216"
     exon            18031..18154
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            18155..18421
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            18422..18519
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            18520..18688
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18659
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677221"
     exon            18689..18955
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18879
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677223"
     exon            18956..19222
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19014
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677225"
     exon            19223..19501
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19344
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303829"
     variation       19366
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677226"
     exon            19502..19910
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19773
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72677227"
     exon            19911..20035
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            20036..20302
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20057
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677229"
     exon            20303..20572
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            20573..20875
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20797
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677231"
     variation       20854
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677232"
     exon            20876..21178
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20921
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677233"
     exon            21179..21366
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21329
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677237"
     exon            21367..21481
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            21482..21766
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            21767..21918
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21770
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677238"
     exon            21919..22066
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22000
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303830"
     exon            22067..22244
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22230
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677240"
     exon            22245..22366
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677242"
     exon            22367..22654
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22559
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677243"
     variation       22602
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677244"
     exon            22655..22951
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            22952..23138
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23012
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677245"
     exon            23139..23254
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23255..23554
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23337
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2115558"
     variation       23364
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677247"
     exon            23555..23854
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23855..23960
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23961..24157
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23964
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677249"
     exon            24158..24463
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24418
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677250"
     exon            24464..24742
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24715
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78462639"
     exon            24743..25042
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24863
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632860"
     exon            25043..25345
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25290
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288566"
     exon            25346..25708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25491
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632861"
     exon            25709..26011
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26012..26311
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26312..26608
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       26427
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303831"
     exon            26609..26893
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       26702
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646808"
     variation       26729
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2303832"
     variation       26798
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646809"
     exon            26894..27187
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27188..27487
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27488..27796
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       27606
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646813"
     variation       27795
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303834"
     exon            27797..27987
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27988..28417
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28418..28726
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28727..28875
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28745
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646819"
     exon            28876..28908
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28909..29038
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29023
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646822"
     exon            29039..29338
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29159
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646823"
     exon            29339..29656
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29657..29953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29707
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001238"
     STS             29854..29959
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1532E"
                     /db_xref="UniSTS:150620"
     exon            29954..30253
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       30135
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646827"
     exon            30254..30568
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             30358..30496
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65766"
                     /db_xref="UniSTS:17479"
     variation       30412
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646828"
     STS             30503..30601
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1570E"
                     /db_xref="UniSTS:150654"
     exon            30569..30717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30718..30868
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30869..31150
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       30937
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646831"
     variation       31068
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646832"
     variation       31070
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646833"
     exon            31151..31453
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31454..31756
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31757..32038
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31876
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646837"
     exon            32039..32338
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32042
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288569"
     variation       32156
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646838"
     exon            32339..32641
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32539
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303836"
     exon            32642..32950
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32719
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646839"
     variation       32921
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646840"
     exon            32951..33232
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33233..33532
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33441
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646842"
     exon            33533..33826
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1560220"
     exon            33827..36793
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       34096
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646843"
     variation       34424
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646844"
     variation       34427
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646845"
     variation       34851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2163009"
     variation       35482
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646846"
     variation       35664
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1560221"
     variation       35784
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646847"
     variation       35991
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646848"
     variation       36038
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646849"
     variation       36629
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646850"
     variation       36632
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646851"
     variation       36771
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646852"
     exon            36794..37114
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37045
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646853"
     exon            37115..37399
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37133
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646854"
     variation       37195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646855"
     exon            37400..37699
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37638
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646857"
     exon            37700..38002
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37780
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646859"
     variation       37814
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2042996"
     exon            38003..38278
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            38279..38578
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38293
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646860"
     exon            38579..38881
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38698
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646861"
     exon            38882..39181
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            39182..39469
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39235
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646866"
     variation       39381
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646867"
     exon            39470..39766
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39692
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646868"
     exon            39767..40069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            40070..40375
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646869"
     variation       40279
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646870"
     exon            40376..40663
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40498
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646871"
     variation       40645
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303837"
     exon            40664..40954
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40681
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303838"
     variation       40705
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646873"
     STS             40893..41293
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_23497-23498:1027358865:1"
                     /db_xref="UniSTS:268713"
     exon            40955..41242
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646876"
     variation       41241
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288570"
     exon            41243..41830
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41565
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646877"
     exon            41831..41935
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            41936..42133
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42064
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646880"
     exon            42134..42430
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            42431..43018
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42751
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646881"
     variation       42989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646882"
     exon            43019..43321
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43031
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288572"
     variation       43191
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:67041405"
     variation       43256
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646884"
     variation       43282
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646885"
     exon            43322..60427
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646887"
     variation       44086
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646888"
     variation       44257
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646889"
     variation       44283
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646890"
     variation       44438
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646891"
     variation       44470
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646892"
     variation       45546
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646893"
     variation       45639
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646894"
     STS             45815..45940
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1571E"
                     /db_xref="UniSTS:150655"
     variation       46633
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646895"
     variation       46826
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646896"
     variation       47152
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646897"
     variation       48208
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646898"
     variation       48445
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744426"
     variation       48497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646899"
     variation       48578
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744427"
     variation       48643
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744428"
     variation       48680
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731743"
     variation       49226
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646900"
     variation       49243
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646901"
     STS             49349..49550
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1580E"
                     /db_xref="UniSTS:150664"
     STS             49672..49772
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1593E"
                     /db_xref="UniSTS:150677"
     variation       49949
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813243"
     variation       50019
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646902"
     variation       50305
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3813244"
     variation       50326
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3813245"
     STS             50511..50851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="TTN-1"
                     /db_xref="UniSTS:254009"
     variation       50885
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813246"
     variation       51519
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648203"
     variation       51669
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648204"
     variation       52352
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010407"
     variation       52498
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648205"
     variation       52832
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648206"
     variation       52871
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731745"
     variation       53232
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648207"
     variation       53468
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731746"
     variation       53547
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648208"
     variation       53550
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648209"
     variation       54079
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648210"
     variation       54405
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3813247"
     variation       54628
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648211"
     variation       54711
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648212"
     STS             55372..55498
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1550E"
                     /db_xref="UniSTS:150635"
     variation       56091
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648213"
     variation       56293
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648214"
     variation       56360
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648215"
     variation       56403
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648216"
     variation       56722
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648217"
     variation       56819
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648218"
     variation       56929
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829746"
     variation       57809
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648219"
     variation       57959
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648220"
     variation       58246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648221"
     variation       58425
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648222"
     variation       58809
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648223"
     STS             59005..59220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1560E"
                     /db_xref="UniSTS:150645"
     STS             59549..59727
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH48674"
                     /db_xref="UniSTS:32026"
     variation       59575
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648224"
     variation       59608
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648225"
     STS             59648..59759
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1572E"
                     /db_xref="UniSTS:150656"
     variation       60132
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648226"
     exon            60428..60724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             60472..60553
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1553E"
                     /db_xref="UniSTS:150638"
     exon            60725..61312
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61018
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648227"
     variation       61217
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648228"
     variation       61275
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648229"
     exon            61313..61615
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61377
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648230"
     variation       61513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648231"
     STS             61543..61680
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_21540-21541:1033053987:1"
                     /db_xref="UniSTS:268573"
     exon            61616..61912
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            61913..62200
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       62102
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648234"
     exon            62201..62500
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       62291
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648235"
     variation       62374
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648236"
     exon            62501..62803
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            62804..63109
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             62843..62956
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1519E"
                     /db_xref="UniSTS:22697"
     variation       62992
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648237"
     variation       63032
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648238"
     exon            63110..64876
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       63314
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648240"
     variation       63513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648241"
     variation       64047
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648242"
     STS             64395..64537
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65575"
                     /db_xref="UniSTS:58532"
     variation       64679
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648243"
     exon            64877..65170
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            65171..65458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       65179
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648244"
     exon            65459..65758
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             65513..65651
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH98821"
                     /db_xref="UniSTS:85869"
     variation       65543
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648245"
     variation       65605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648246"
     exon            65759..67825
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       65782
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648247"
     variation       66467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648248"
     variation       66482
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648249"
     STS             66717..66808
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1540E"
                     /db_xref="UniSTS:150626"
     variation       66772
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648250"
     variation       66849
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731748"
     variation       67130
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648251"
     variation       67199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648252"
     STS             67248..67349
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1546E"
                     /db_xref="UniSTS:150631"
     exon            67826..68128
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            68129..68434
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68304
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648253"
     exon            68435..68725
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68448
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370821616"
     variation       68449
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648254"
     variation       68452
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648255"
     variation       68457
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648256"
     variation       68653
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648257"
     exon            68726..69022
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68795..68796
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857280"
     variation       68865
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648258"
     variation       68876
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648259"
     exon            69023..69328
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       69154
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857267"
     variation       69159
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648260"
     variation       69172
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648261"
     variation       69253
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648262"
     variation       69259
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648263"
     variation       69295..69296
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857270"
     exon            69329..69634
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       69572
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:72648265"
     exon            69635..69916
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            69917..70510
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       70015
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857279"
     variation       70481
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200676850"
     exon            70511..70798
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       70524
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648266"
     exon            70799..71098
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       70900
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648267"
     exon            71099..71401
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       71219
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3731749"
     exon            71402..71704
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            71705..72289
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       71724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648269"
     variation       71770
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648270"
     variation       71778
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648271"
     variation       71848
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648272"
     variation       71900
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648273"
     variation       71973
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648274"
     exon            72290..72595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            72596..72895
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       72761
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648276"
     exon            72896..73471
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            73472..73777
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       73507
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648278"
     variation       73561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648279"
     exon            73778..74371
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       73850
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648282"
     variation       73979
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648283"
     variation       74012
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857264"
     variation       74065
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629779"
     exon            74372..79980
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       74708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962659"
     variation       75045
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629781"
     variation       75314
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629782"
     variation       76125
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857265"
     variation       76439
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3731752"
     variation       76483
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629783"
     variation       76580
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857266"
     variation       76659
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731753"
     variation       76838
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72629784"
     variation       76969
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629785"
     variation       77387
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829747"
     variation       77564
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629786"
     variation       77779
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857268"
     variation       77983
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72629787"
     STS             78062..78186
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65621"
                     /db_xref="UniSTS:70042"
     variation       78182
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:68080670"
     variation       78197
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629788"
     STS             78593..78801
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1568E"
                     /db_xref="UniSTS:150652"
     variation       78594
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829748"
     variation       78696
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629789"
     variation       78799
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857269"
     variation       78818
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3813249"
     variation       78990
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813250"
     variation       79188
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829749"
     variation       79393
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:67254537"
     variation       79427
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2857271"
     exon            79981..80137
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            80138..80829
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             80342..80520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1564E"
                     /db_xref="UniSTS:150649"
     exon            80830..80983
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            80984..81286
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       81182
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629793"
     exon            81287..82605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       81625
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629794"
     variation       81641
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629795"
     STS             82200..82314
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S2648"
                     /db_xref="UniSTS:75793"
     variation       82246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629796"
     variation       82324
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629797"
     polyA_signal    82578..82583
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
     variation       82597
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629798"
     polyA_site      82605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
ORIGIN      
gagcagtcgtgcattcccagcctcgcctcgggtgtagggattgcatagaaaagcaaaactacacagtcttgactgtgtagttttgtttttaggattagaggctcaccgattcatgtcggagatggtcagaaaaaccaactctccataggacgtcgtttcagaagcaaccttgggcttagtcccaccctttttaggcactcttgagaaatcagagtgcctagaaagatgacaactcaagcaccgacgtttacgcagccgttacaaagcgttgtggtactggagggtagtaccgcaacctttgaggctcacattagtggttttccagttcctgaggtgagctggtttagggatggccaggtgatttccacttccactctgcccggcgtgcagatctcctttagcgatggccgcgctaaactgacgatccccgccgtgactaaagccaacagtggacgatattccctgaaagccaccaatggatctggacaagcgactagtactgctgagcttctcgtgaaagctgagacagcaccacccaacttcgttcaacgactgcagagcatgaccgtgagacaaggaagccaagtgagactccaagtgagagtgactggaatccctacacctgtggtgaagttctaccgggatggagccgaaatccagagctcccttgatttccaaatttcacaagaaggcgacctctacagcttactgattgcagaagcataccctgaggactcagggacctattcagtaaatgccaccaatagcgttggaagagctacttcgactgctgaattactggttcaaggtgaagaagaagtacctgctaaaaagacaaagacaattgtttcgactgctcagatctcagaatcaagacaaacccgaattgaaaagaagattgaagcccactttgatgccagatcaattgcaacagttgagatggtcatagatggtgccgctgggcaacagctgccacataaaacacctcccaggattcctccgaagccaaagtcaagatccccaacaccaccgtctattgctgccaaagcacagctggctcggcagcagtccccatcgcccataagacactccccttccccggtcagacacgtgcgggcaccgaccccatctccggtcaggtccgtgtctccagcagcaagaatctccacatcccccatcaggtctgttaggtctccattgctcatgcgtaagactcaggcatccaccgtggccacaggtcctgaagtgcctcccccttggaagcaagagggctacgtggcctcctcatctgaggctgagatgagagagacaacgctgacaacctctactcagatcaggacagaagagagatgggaagggagatacggtgtccaggagcaagtgaccatcagtggtgctgcgggtgctgccgccagtgtgtcggccagtgctagctacgcagcagaggctgttgccactggtgctaaagaggtgaaacaagatgctgacaaaagtgcagctgttgcgactgttgttgctgccgttgatatggccagagtgagagaaccagtgatcagcgctgtagagcagactgctcagaggacaaccacgactgctgtgcacatccaacctgctcaagaacaggtaagaaaggaagcggagaagactgctgtaactaaggtagtagtggccgccgataaagccaaggaacaagaattaaaatcaagaaccaaagaagtaattaccacaaagcaagagcagatgcacgtaactcatgagcagataagaaaagaaactgaaaaaacatttgtaccaaaggtagtaatttccgcagctaaagccaaagaacaagaaactagaatttctgaagaaattactaagaaacagaaacaagtaactcaagaagcaataatgaaggaaactaggaaaacagttgtacctaaagtcatagttgccacacccaaagtcaaagaacaagatttagtatcaagaggtagagaaggcattactaccaaaagagaacaagtgcaaataactcaggagaagatgagaaaggaagccgagaaaactgccttgtctacaatagcagttgctactgctaaagccaaagaacaagaaacaatactgagaactagagaaactatggctactagacaagaacaaatccaagttacccatggaaaggtggacgttggaaaaaaggctgaagctgtagcaacagttgttgctgcagtagaccaggcccgagtcagagagcccagagagcctgggcatcttgaagaatcctatgctcagcagaccactttggagtacggatataaggaacgcatttccgccgcaaaggtagctgagcctccccaacgtccagcctcagaaccccacgttgtccctaaagcagtcaagcctagagtaatccaggctccttctgagactcatatcaaaactactgatcaaaagggaatgcacatatcatcacagatcaagaaaactacagatctaacaacggaaagattagtccatgtggataaacgcccccgcacagctagccctcactttactgtttcaaaaatttctgttcctaagacagaacatggatatgaggcatcaatagccggtagtgctattgccacattacaaaaagagttgtcagccacatcttctgctcagaagatcaccaaatcggtgaaggctcctactgtgaagcccagtgagactagagtaagggcagagcccacacccttgccacagttccccttcgctgacacaccagatacttacaagagtgaagctggcgttgaggtgaaaaaggaagtaggggtgagcatcactggcaccaccgtccgtgaagagcgctttgaagtactgcacggacgcgaagccaaggtaacagaaacagcaagagtaccagcacctgttgaaattcctgttactccaccaactttggtctcgggcttaaaaaatgtgactgtcatagaaggtgaatctgtcaccttggagtgccacatctctggatacccatccccgacagtgacatggtacagggaagactaccaaatcgaaagttccattgacttccagataaccttccagagtggaattgctcgtcttatgattcgcgaagcatttgcggaagacagcgggcgatttacttgcagtgctgtaaatgaggctggaaccgtcagcacatcctgctatctggctgtgcaggtgtcagaagaatttgaaaaggaaaccacagccgtgactgagaaatttactacagaagagaaacgctttgttgagtcaagagatgtggttatgactgatactagcctcacagaggaacaagcagggcctggagaacctgccgcgccttactttattacaaaaccagtggtccagaaactggtggaaggtgggagcgtggtgtttggatgccaagttggcggcaacccaaagccccatgtatactggaaaaaatctggtgttcctctaaccactggatacagatacaaagtgagttacaacaaacaaaccggtgaatgcaagctggtgatttctatgacttttgctgatgatgctggagaatacactattgttgttcgcaataagcatggagaaacttctgcatctgcttccttgcttgaagaagctgattatgagttactgatgaagtcccagcaagaaatgctttatcagacacaagtgactgcatttgttcaagaacctaaagttggagaaacagcacctggatttgtatactctgagtatgaaaaagagtatgaaaaagaacaagccttaattaggaagaaaatggccaaagatactgtagtggtcagaacttatgtagaagatcaggaattccatatttcttcctttgaagagagacttattaaagaaattgaatatagaataataaagactacattagaagaacttcttgaagaagatggagaagaaaagatggcagttgacatttctgaatctgaagctgttgaatcaggatttgattcaagaatcaagaattatagaattcttgaggggatgggtgtcacttttcattgcaagatgtctggatatccattaccaaagattgcttggtacaaagatggcaagcgcatcaaacatggagaaagataccaaatggactttctacaagatggcagagctagtctgcgtatacctgttgttcttccagaagatgaaggaatctacactgcatttgccagcaatattaaaggaaatgcaatttgctcagggaaattgtatgtggagcctgctgcaccacttggagctccgacttacattcccacactagagccagtgagcagaatcagatctctctctccacgttcagtgagcaggtctcctatacgcatgtctcctgcacggatgtcacctgcaaggatgtctcctgcacggatgtcccctgcaagaatgtcccctggacgtaggctggaggagacagatgagtcacaacttgagagactatataaaccagtctttgtgttaaaacctgtttctttcaaatgtttagaagggcaaactgccagatttgacttaaaggttgttggtagacctatgccagagacgttctggtttcatgatggccagcaaattgtcaatgactatacccataaagtagtcattaaagaagatggtactcaatcactaattattgtccctgccacacccagtgattctggggaatggactgtggttgcccaaaacagggcaggcagatcttcaatttcagtgattttaactgtggaagctgtggaacatcaggtaaaaccgatgtttgtagaaaaactgaaaaatgtcaatataaaggaaggttcccgacttgaaatgaaagtcagagctacgggtaaccccaaccctgacattgtatggttgaaaaacagtgacatcattgtgcctcataaatatcccaaaatcagaattgaaggaaccaagggagaagctgcccttaaaatcgattccactgtcagccaagattctgcctggtatactgcgactgctattaataaagctggcagagacactacaagatgcaaagtaaatgttgaagttgagtttgcagagcctgagccagagagaaagttaatcatcccacgggggacatatagagcaaaggagattgcagccccagaactggagcccctccatttgcgatatggccaagagcaatgggaagaaggtgatctctatgacaaagagaaacaacagaaaccatttttcaagaaaaaactcacttccttaagacttaagcgctttgggcctgcccactttgaatgcaggctaacacccattggtgacccaacgatggtggtggagtggctccatgatggaaagccacttgaagcagccaacaggctccgtatgatcaatgaatttgggtactgcagccttgattatggcgttgcatattctagagacagtggtatcattacttgcagagccactaacaaatatggaacagatcacacatctgctacccttattgttaaagatgagaaaagtcttgtggaagaatcccaattgcctgaggggaggaaaggcttacagagaattgaagaattagagagaatggctcatgaaggtgcacttacaggtgtaacaacagatcagaaagaaaagcaaaagccagacattgtcttgtacccagagccagttagagtacttgaaggggagactgcaaggttccgctgcagggtaacaggctaccctcagcccaaagtcaactggtacctcaatggacagctcatccgcaaaagcaaaaggttcagagttcgctatgatggtatccattacctggacatcgtggactgcaaatcatatgacacaggtgaagtgaaggtcaccgcggaaaatcctgaaggtgtgatagagcataaagtgaagcttgagattcaacagagggaagattttaggtctgtccttaggagagctcctgaaccaaggcctgagtttcacgtacatgaaccaggaaagcttcagtttgaagtacaaaaagtggatagacctgttgacaccactgaaaccaaagaagttgtgaagttgaaaagggctgaaagaattacccatgaaaaagtgcctgaagagtcggaagagctgcgcagtaaattcaagcgcagaacagaagagggctattatgaagccattaccgctgtggagctcaagtctcgaaagaaggatgaatcctatgaggaactcctcaggaagacaaaagatgaacttctccactggaccaaagagttaactgaagaggaaaagaaagctcttgccgaagaaggcaaaatcacgattccaacttttaaacctgacaagattgaactaagtcctagtatggaggctccaaaaatcttcgaaagaatccagagccaaacagtgggccaaggatctgatgcacacttccgggtcagagtcgtggggaaaccagaccccgaatgtgaatggtacaaaaatggtgtcaaaattgaacggtctgaccggatctactggtactggcccgaagacaatgtttgtgaattggtcataagagatgtgactgctgaggactctgccagcatcatggtaaaagccatcaacatagctggagaaacctccagtcacgcattcttacttgtccaagccaagcaattgatcactttcacacaggaattacaagatgttgttgctaaggaaaaagacactatggcaacctttgaatgtgaaacttcagaaccatttgtcaaagtgaaatggtataaagatggtatggaggttcatgagggagataaatacaggatgcactctgacagaaaggttcacttcctctccatactgaccattgatacgtctgatgctgaagattacagctgtgtacttgtggaagatgaaaatgtcaaaacgactgctaaacttattgttgaaggtgcagttgttgagtttgtgaaagaacttcaggacatagaagttccagaatcatattcaggagaattagagtgcattgtatccccagaaaatatagaaggaaaatggtatcataatgatgtggagcttaaatccaatggcaaatatacaattacatctcgtcgtggacgtcagaacctcacggtcaaggatgtaaccaaggaggaccagggagaatacagctttgtcatcgacgggaaaaagacaacctgtaaattaaagatgaaaccccgccccattgctatcctacaaggacttagtgaccaaaaagtctgtgagggtgacattgttcagcttgaagttaaagtctccttggaaagtgtggaaggcgtctggatgaaagacggccaagaagtgcagcccagtgacagggttcacattgtgatagacaaacaatctcatatgctgctcattgaagacatgactaaggaagatgctggaaattactctttcaccattccagcccttggcctctccaccagtgggcgtgtctctgtctatagtgtggacgtgataacacctctaaaagatgttaatgtgattgaaggcaccaaggctgtgcttgaatgtaaggtgtcagtccctgatgtgacttctgttaagtggtacttaaatgatgaacaaatcaagcctgatgaccgtgtacaggccattgtgaaaggtactaaacagcgactagtcattaaccgaactcatgcttcagacgaaggaccttacaagctgatagttggcagagttgaaaccaactgtaatctctctgtagaaaaaattaaaattatcagaggtcttcgtgaccttacctgtacagaaactcaaaatgtggtgtttgaggttgagctgtcccactctggaattgatgtcctgtggaattttaaggacaaggaaatcaagcccagttctaaatataaaattgaagcacatggaaaaatatataaattgacagttctaaatatgatgaaagatgatgaaggaaaatacacattttacgcgggagaaaatatgacatctggaaaacttactgtggcaggtggggccatctccaagccactcacagatcagaccgtagctgaatcccaggaagctgtgtttgaatgtgaagttgccaacccagattccaaaggcgaatggttgagggatggcaaacacctaccactgactaacaacatcagaagtgagtctgatggccacaaaaggagacttatcattgctgccaccaaattagatgacattggagaatatacctacaaggtggccacctccaaaacatctgccaaactcaaagttgaagctgtcaaaattaagaagactctgaagaacctcacagtgacagaaacacaggatgctgttttcactgtcgagcttacacaccctaatgtcaaaggtgtccagtggatcaaaaatggagttgtgctggaatccaatgaaaagtatgctatctctgtcaaaggaacaatttactctctgaggattaaaaactgtgccatcgtggatgagtctgtttatggcttcaggcttggaaggcttggagccagtgccagactgcacgtggagactgtcaagatcattaaaaagccaaaggatgtgacagccttggaaaatgccactgttgcctttgaagttagtgtttcccatgacactgttccagtaaaatggttccataagagtgtggaaattaagccaagtgacaaacacagactggtctcagaaaggaaagtccacaagctgatgctgcagaacatctccccctcagatgctggggaatacacagctgtggtcgggcaattggaatgcaaagcaaaactgtttgtggagacattacatattacaaaaaccatgaaaaatatcgaggtgcctgagaccaaaactgcctcttttgagtgtgaggtgtcccacttcaatgtcccttccatgtggctgaagaatggtgtggaaattgagatgagtgaaaagttcaagatagttgtgcagggaaaactccatcagctgatcatcatgaacaccagcacagaggactcggcagaatacacatttgtctgtggcaatgaccaagtcagtgccaccctgacagtcaccccaatcatgattacttccatgctgaaagacatcaacgctgaagaaaaagacactattacttttgaggtgacagtgaactatgaaggcatctcttacaaatggttaaagaatggtgtggaaatcaaatcaactgacaagtgccagatgagaaccaaaaagctcacacactcactgaacatcaggaatgttcactttggggatgctgctgactacacctttgtggctggaaaagcaacatcaacagccacactttatgtggaagctcgtcatatagaatttaggaaacacattaaggacattaaggtactggagaagaagcgagccatgtttgaatgtgaagtttctgaacctgacatcactgtacagtggatgaaagatgaccaggaactgcagatcacagacagaataaagattcagaaggagaaatatgtccaccgccttctgatcccatccacccggatgtctgatgctgggaagtacacagtggtggcaggaggcaacgtgtcaactgcaaaactctttgtagaaggcagagatgttcgcatccgaagtattaaaaaggaggttcaggtcattgagaaacagcgtgctgttgttgaatttgaggtcaatgaagacgatgttgatgcccactggtataaagatggcattgaaatcaatttccaagttcaagaacgacacaaatatgtagtggaaagaagaatccaccgaatgtttatctctgagaccagacagagcgatgcaggagaatacacctttgtggcaggaaggaacaggagttctgtcactctctatgtcaatgctcctgaaccgccccaagttctgcaggagctccagcctgtcactgtgcagtctggcaagcctgcccgcttctgtgccgtgatatccggaagaccacagcccaaaatttcctggtacaaggaagagcagctgctttccactggcttcaagtgcaaatttcttcatgatgggcaagaatacacgcttttgctaattgaagccttcccagaggatgcggcagtctatacctgtgaagccaagaatgactatggtgttgccacaacatcagcttcactctcagtggaagttccagaagttgtgtctcctgatcaggaaatgcctgtttatccacctgccatcatcaccccgcttcaggacactgtcacttctgaagggcagccagcccgttttcaatgccgggtttctggaacagatctaaaagtgtcgtggtacagcaaagacaagaaaatcaagccatctcggttctttagaatgactcaatttgaagacacttatcaactggaaattgccgaagcttatccagaagatgaaggaacttacacgtttgttgctagtaatgctgtaggccaagtatcaagcacagccaacctgagtctggaagtgcaagccctagataggcaaagttctgggaaagatgtaagagagtccgccaagtcccaggcagtggcagattcctctttcacaaaggaggagagcaaaatatctcaaaaggaaattaagtcatttcaaggatcatcatatgaatatgaagtgcaggtttttgaaagtgtatctcaaagttccatccacacagctgcatctgttcaagatacacagttgtgccatactgcatccctttcacaaattgcagaaagcactgagctatctaaggaatgtgctaaagagtccacgggtgaggcgcccaagattttcctgcatcttcaggacgtcactgtaaagtgcggtgacacggctcaattcctctgtgttttaaaagatgattctttcattgatgtaacctggactcacgaaggtgcaaagatagaggaatccgagagactgaaacaatcacaaaatggaaatattcagtttcttaccatatgtaatgttcagctggtagaccaaggactatacagctgcattgtacacaatgactgtggagagaggacaacgtcagcagtactaagtgtagaaggtgctcctgaatcaattttgcatgagaggattgaacaagagattgagatggaaatgaaagagttttctagttcttttctgtctgccgaggaagaaggacttcatagcgccgaacttcaattatctaaaataaatgaaacacttgaacttttgtctgaatctccagtttacccaactaaatttgattccgaaaaggaaggcactggcccaattttcatcaaagaagtgtcaaatgctgatataagcatgggggatgtggctacactgtctgtaactgtcattggcatccccaaacctaaaattcagtggttctttaatggagtgctattaaccccttctgctgactacaaatttgtttttgacggtgatgatcatagcctgatcattctgttcaccaaattggaggatgagggagagtatacatgtatggccagtaatgactatggaaagacaatatgtagtgcctatctaaaaattaattccaaaggagagggtcacaaagacactgaaacagaatcagcagtggcaaaatctctggaaaagctgggaggtccttgtcctcctcacttccttaaggagttaaaaccaattcgctgtgctcaagggcttcctgccatctttgagtacacagtggttggagagcctgcccctactgttacatggttcaaagaaaacaagcagctttgcaccagtgtttattacactatcattcataaccctaatggctctggaactttcattgtcaatgaccctcagagggaagacagtggcctctatatctgtaaagcagagaatatgttgggtgagtccacctgtgcagcagagctgcttgtgcttctggaagacacagacatgactgataccccctgcaaagcaaagtccacaccagaggctcctgaggattttccacagacacccttaaagggtcccgcagttgaagcacttgactcagagcaggaaattgcaacgtttgtaaaagacaccattttgaaagctgctttaattacagaagaaaaccagcaactatcttatgagcatattgctaaagccaatgaattgagcagtcagcttcctttgggagctcaggaattgcaatccattttggagcaagacaagctcactcctgaaagcaccagggaatttctttgcatcaatggcagtattcactttcagcctctcaaggaaccatctcccaacctacagctgcagattgtacagtcccagaaaaccttctccaaagaaggtattctaatgcctgaagagcctgagacacaggcagttctatcagataccgagaaaatcttcccaagtgccatgtccatagaacaaattaattcattaacagttgagcctctgaaaactttattagctgaacctgaagggaattatccacagtcttcaatagaacctccaatgcattcttatctaacctctgtggctgaggaagtactttcaccaaaagaaaagacagtatctgacaccaacagagagcaaagagtgactcttcaaaagcaagaggcacaaagtgcgctcatcttgagtcagagcttagctgagggacacgtggagagtctccagagtcctgatgtcatgatctctcaggtaaactatgagcccctagtcccttcagaacactcatgcacagaaggaggtaaaattttgatagaaagtgcaaatccactggaaaatgcagggcaagattctgcggtcagaattgaggaaggcaagtccttaagatttccactagcacttgaagaaaagcaggtactgctcaaagaagagcattctgacaacgtggtgatgcccccagaccaaatcattgagtctaaaagagagcccgtggcaataaagaaagtgcaggaggtacagggaagggaccttctttctaaggaaagcttgctttctggtattccagaagagcagagattaaacctgaaaattcaaatctgccgggctttgcaagcagccgtggccagcgagcagccaggtcttttctctgagtggctaagaaatattgaaaaggtggaggtcgaggctgtaaacatcacccaagagcccagacacatcatgtgcatgtaccttgttacttcggcaaagtctgtaacagaagaagtaaccatcattattgaagatgttgatcctcaaatggctaacctgaaaatggaacttagggatgctttgtgtgctattatatatgaggaaatagacatcctaacagctgagggtcctagaattcagcaaggagccaaaacaagtttgcaagaagaaatggattctttttcaggttcacagaaggttgaacccattactgaaccagaagttgaatctaaatatctgatctcaactgaagaggtcagttattttaacgtgcaaagtagggttaaatatttggatgccacacctgtcactaaaggggttgcttcagctgttgtctctgacgaaaaacaagatgagagtctgaaaccatcagaggaaaaagaggagtcttcctctgaaagtggtactgaggaggttgctacagtaaagatacaggaagctgagggtggcttaatcaaagaggatggccccatgatacatacacctttagtggacactgtttctgaggaaggtgatattgtacacctcacaacatccataacaaatgctaaagaggtgaattggtattttgagaataaactggtgccttcagatgaaaagttcaagtgtttacaagatcaaaatacatatacgctagtcatcgacaaagtaaataccgaagaccatcaaggagagtatgtctgtgaggccttgaatgacagcggaaaaacagcaacttcagccaaactcactgtagtaaaaagagctgccccagtgatcaagaggaaaatcgaacccctggaagtagcactgggccacctagccaaattcacctgtgagatccaaagtgctcccaatgtccggttccagtggtttaaagctggccgagaaatttatgagagtgacaagtgttctattcgatcttcaaagtatatctccagccttgaaatcctgagaacccaggtggttgactgcggcgagtatacatgcaaagcttccaatgagtatggcagtgtcagctgtacagccacactaactgtgacagtgcctggaggtgaaaagaaagttcgcaaattacttccggaacgtaaacctgaaccaaaggaagaagttgttctgaaaagcgttctaagaaaaagacctgaagaagaagaacctaaagtagaacctaaaaaactagaaaaagttaaaaaacctgcagtaccagaaccaccacctccaaaacctgttgaagaggttgaagtacctactgttacaaaaagggaaaggaagattcctgaaccaacaaaagtgcctgaaatcaagccagcaatacctctccctgcacctgaaccgaaaccaaagcccgaagcagaagtgaaaacaatcaaaccacctcctgtggaacctgaaccaacccccatcgctgccccagtaacagtgccagtggttggaaagaaagcagaagccaaagcacctaaggaagaggctgccaagccaaaaggtcctatcaaaggtgtacccaaaaagactccttcaccaatagaagccgaaaggagaaagttaaggccaggaagtggtggagagaaacctcctgatgaagccccgttcacctaccagctaaaggctgtgccactgaagtttgtgaaagaaatcaaagacatcatcttgacagaatcagagttcgttggctcttcagcaatctttgaatgtttggtctccccttccactgcaattacaacctggatgaaagacggtagcaatatccgtgagagtcccaagcacaggtttattgcagatggtaaagacagaaagctgcacatcattgatgttcaactttccgatgctggtgaatacacctgtgttttacgtttgggaaacaaagaaaagacctccacggctaaacttgttgtagaagaacttcctgtgcgttttgtaaaaacactggaagaggaagtcacagtggtcaaaggacagccattgtacttgagctgcgagttaaacaaagagcgtgacgtggtctggaggaaggatggcaagattgtggtggagaaacctggccgaattgtgccaggcgtcattggcttgatgcgggctctgaccatcaacgatgcagatgacacagatgctggaacatacacagttactgtggaaaacgccaacaacctggagtgttcatcttgcgtaaaagtagtagaagtcattagagattggctggtgaaacctatacgagaccagcatgtgaaacccaaggggacagctatttttgcctgtgatatagcaaaagatactccaaacattaagtggttcaaaggatatgatgaaatccctgcggaaccaaatgataagactgaaatactgagagatggaaatcatctgtacctcaaaattaagaatgctatgccagaagatattgctgagtatgcagtggaaattgaaggaaaaagataccctgcaaagctgacacttggagagcgtgaagttgaactgcttaaaccaatagaggacgttaccatttatgagaaagaaagtgcaagctttgatgcagaaatctcagaggcagacattcctggacaatggaaactgaaaggagaacttctaaggccctcacctacttgtgaaatcaaagcagaaggtggaaaacgcttcttaactttgcacaaagtcaaactggaccaagctggtgaagtcctctaccaggcccttaatgcaattacaactgccattttgacagtaaaagaaatcgaacttgactttgctgtgcccctgaaggatgtcactgttccagaaaggcgacaggctcgattcgaatgtgtcctcacccgagaggcaaatgttatatggtccaaaggacctgatataattaagtcatctgacaaatttgatatcatcgctgatggaaagaaacatattcttgttattaatgattctcaatttgatgatgaaggggtctatactgctgaggtggagggcaagaagacctcagctcggttgtttgtcacaggtataagactgaaattcatgtcacctcttgaagatcaaacagtaaaagaaggtgaaacagcaacttttgtttgtgaactttctcatgaaaaaatgcatgtagtctggttcaaaaatgatgccaaactccatacaagcagaacagtactcatctcttctgagggcaagactcacaaattggaaatgaaagaagtgacattggatgatatatctcagataaaagctcaagtcaaggagctgagctccacagcacagctgaaggtcttagaggccgatccctacttcactgtgaaattacatgacaaaactgcagtggagaaggatgagattactttgaagtgtgaagtgagcaaagatgtaccagtgaaatggttcaaagatggtgaagagattgtcccttcacccaaatattctatcaaggcagatggcctgcgccgcatcttaaaaatcaaaaaggcggaccttaaagataaaggcgaatatgtgtgtgactgtggcacagacaagaccaaggcaaatgttactgttgaggctcgactaataaaagtggaaaagcctctgtacggagtagaggtgtttgttggtgaaacagcccactttgaaattgaactttctgaacctgatgttcacggccagtggaagctgaaaggacagcctttgacagcttcccctgactgtgaaatcattgaggatggaaagaagcatattctgatccttcataactgtcagctgggtatgacaggagaggtttccttccaggctgctaatgccaaatctgcagccaatctgaaagtgaaagaattgcctcttatcttcatcacacctctcagtgatgttaaagtcttcgagaaagatgaggctaagtttgagtgtgaagtatccagggagcccaaaacattccgttggctaaaaggaacccaggaaatcacaggtgatgacagatttgagcttataaaggatggcactaagcattcaatggtgatcaagtcagctgcttttgaagatgaagcaaaatacatgtttgaagctgaagataagcacacaagtggcaaactgatcattgaaggaatccggctcaaattcctcacccctctcaaagatgtaactgccaaagagaaggaaagtgctgtatttactgtggagttatctcatgataacatccgagttaaatggttcaagaatgaccagcgcctacacaccaccaggtcggtctcaatgcaagacgaagggaaaactcattcgatcacattcaaagacctgtctattgatgacacctcccaaattagagtagaagctatggggatgagttcagaagctaaactcactgtgcttgagggagacccatattttacaggaaaacttcaagattatactggtgtagagaaagatgaagttattctacagtgtgaaattagcaaagcagatgcaccagtgaaatggtttaaggatgggaaggaaataaagccatccaaaaatgctgttattaaggcagatggcaagaaacgcatgctaatcctaaagaaagccttgaaatcagatattggacagtacacctgtgactgtgggacagataagacctcaggaaaacttgacattgaggatcgggaaattaaactggtgcgacccctgcacagtgtggaggtgatggagactgagacagcacgctttgaaaccgaaatctctgaagatgatatccacgccaactggaaactcaagggagaggccctactccaaacacctgattgtgaaattaaggaagaaggcaaaatacactcccttgttttgcacaactgtcgcctggaccagacgggtggggtggatttccaagctgccaatgttaaatctagtgcccacctccgagttaagccacgagtaattggtcttctgaggcctttaaaggatgtcaccgtgactgcaggggaaacagccaccttcgactgcgagctctcctacgaagatatcccagtggaatggtatctcaaagggaagaaactagagcccagcgataaggtggtcccacgttcagaaggaaaagttcatacacttactctgagggatgtaaagttagaagatgctggggaagtccaactaacagcaaaagatttcaaaactcacgccaacctctttgtgaaagaacccccagttgaattcactaagcctcttgaggaccagacggtcgaagagggagccactgcagtgctggagtgtgaagtctccagagaaaatgctaaggtgaaatggttcaaaaatgggacagaaatcctcaaaagcaagaagtatgaaattgttgctgatggcagggtcagaaaacttgttatacatgactgtaccccagaggatattaaaacatacacttgtgatgctaaggattttaagacttcctgtaacctgaatgtcgtgcctcctcatgtggaattcttaagaccactcaccgaccttcaagttagagaaaaagaaatggctcgatttgagtgtgaactttcccgagaaaatgctaaggttaagtggtttaaagatggtgctgaaattaaaaagggcaaaaaatatgacatcatatccaagggagcagtgcgcattcttgtcatcaacaaatgtctactggatgatgaagctgaatattcctgtgaagtaaggacagcgagaacttctggcatgctgacagttctggaagaagaagctgtctttaccaaaaatcttgccaacattgaagttagtgaaacagacactataaaactggtttgtgaagtctccaaacctggcgcagaagtgatttggtataaaggggatgaggagatcattgaaacaggaagatatgaaatactgactgaaggacggaagagaatcctggtcattcagaacgctcaccttgaggatgctggcaactacaactgtcgactcccaagctctcgaaccgatggcaaagtcaaagtacatgaactggctgctgaatttatctcaaagcctcaaaaccttgaaatacttgaaggagaaaaggctgaatttgtctgctctatatcaaaagaaagctttccagtccagtggaagagggatgataagacacttgaatctggagataaatatgacgttattgctgatggtaaaaagagggtcctagttgtgaaagatgccacattacaagatatgggcacttacgttgtcatggtaggggccgccagagcagcagctcacttgacagtcattgaaaaactcaggatcgtagttcctcttaaggacacccgggtgaaggaacaacaggaagttgtcttcaactgtgaagtcaatactgaaggtgccaaagccaaatggttcagaaatgaagaagctatatttgatagttcaaaatacatcattctccaaaaagacctagtctacaccctcagaattagagatgcacacttagatgaccaagccaactataatgtgtctttgaccaatcacagaggtgaaaatgttaaaagtgcagccaatctaatagtagaagaggaagaccttaggattgttgagcctcttaaagatattgaaacaatggagaagaaatctgtcacattctggtgcaaggtgaatcgtctcaatgtaacactgaagtggaccaaaaatggtgaagaagtgccttttgacaaccgtgtctcatacagagttgataagtacaagcacatgttaaccattaaagactgtggcttcccagatgaaggtgaatacattgtcactgctggacaagataaatctgttgctgagcttctcatcatagaagccccgacagaatttgtggaacacttggaagatcagacagtcactgagttcgatgacgctgtcttctcctgccagctctccagagagaaagccaatgtaaaatggtacagaaatgggagagaaatcaaagaaggcaaaaaatacaaatttgaaaaagatggaagtatacacagactcattataaaagattgcaggctggatgatgagtgtgaatatgcttgcggggtagaagacaggaagtctcgtgctagactttttgtggaagaaattcctgttgagatcatcaggcctccacaagatattcttgaagcccctggtgctgatgttgtctttttagcagaactcaataaagataaggtggaagtccaatggctaagaaataacatggttgttgtccagggtgataaacaccagatgatgagtgaaggaaagatacatcgactacagatttgtgatattaagccccgtgaccagggtgaatacagatttattgccaaagacaaagaagccagagctaagcttgaactggcagctgcaccaaaaatcaagacagctgaccaagaccttgtggttgatgttggcaagcctctgacaatggtggtgccatatgatgcctaccccaaagcagaagctgaatggtttaaagaaaatgaacctttatctacaaaaaccattgatactacggctgaacaaacttctttcagaattttagaagccaagaaaggagacaaagggaggtataaaattgtgcttcagaacaaacatggaaaagcagaaggattcatcaatttaaaagttattgatgttcctgggccagtacgtaacttagaagtgacagaaacatttgatggtgaagtgagccttgcttgggaagaacctttaactgatggtggaagcaaaatcataggttacgttgttgaaagacgtgacattaagagaaagacctgggttctggccacagaccgtgcagagagttgtgagtttactgtcactggtctacagaaaggaggagttgagtacctattccgtgtgagtgcaagaaacagagttggcactggtgagccagtagaaactgacaatcctgtagaagcaaggagtaaatatgatgttccaggccctcctttgaatgtaaccatcactgatgtgaatcgatttggtgtctcactgacatgggaaccaccagagtatgatggaggtgctgagatcacaaactacgtcattgaattaagagacaagacttctatcaggtgggatactgccatgactgtgagagctgaagacctgtctgcaactgttactgatgtggtagaaggacaggagtacagtttccgagtgagagcccaaaatcgaattggagttggaaaaccaagtgcagccacacccttcgtcaaagttgctgatccaattgagagaccaagtcctcctgtaaacctaacttcctcagatcagactcagtcatcagttcagctcaaatgggaacctcctctgaaagatggaggaagcccaatattaggctatataattgagcgatgcgaagaaggaaaagataattggattcgttgcaatatgaaacttgtccctgaactgacttacaaggttaccggattggaaaaaggaaataaatatttatatagagtatctgcagaaaataaagctggtgtttcagatccatctgaaattcttggtcctctcaccgctgacgatgcatttgttgaaccaacaatggatttaagtgcatttaaagatggtctggaagttattgtcccaaatcctatcacgatcctggttccaagtacaggctatccaaggccaactgcaacctggtgttttggagataaagtactagaaacaggggaccgggtgaaaatgaagaccttgtctgcctatgccgaacttgtcatttctccaagtgaacgttcagacaagggcatttatacactgaaattagaaaaccgtgtgaaaacaatttctggggaaattgatgtcaatgtaattgctcgcccaagtgcacccaaagaattgaaatttggtgatataaccaaggactcagtacatttgacttgggaaccacctgatgatgatggaggaagtccgttaactggatacgttgttgaaaaacgagaagtcagccggaaaacatggactaaagttatggactttgtgactgatctagaattcacagttcctgatcttgttcaaggaaaagagtacttatttaaagtttgtgctcgtaacaaatgtggccctggagaacctgcatatgttgatgaacctgtaaatatgtcaactcctgcaacggtacctgacccaccagagaatgttaaatggagagatcgaacagccaatagcatcttcttaacatgggatccacctaaaaatgatggtggttcacgcatcaaaggatatatagttgaaagatgtccacgtggttctgataaatgggttgcctgtggagaacctgttgcagaaacaaaaatggaagtgacaggtcttgaggaaggcaaatggtatgcctaccgcgtgaaggccttaaacaggcagggtgctagcaaaccaagcagacccacagaggaaatccaggctgtggacacacaagaggccccagaaatcttcctcgatgtgaagctccttgctggtctcactgtaaaagctgggaccaagattgaacttcctgccaccgtaaccggaaaacctgaacctaaaataacttggacaaaggctgatatgattctgaagcaggacaaaagaattaccattgaaaatgtccctaagaaatccacagtgactattgttgatagtaagagaagtgacactggcacatatatcattgaggctgtgaatgtgtgtggccgggccactgctgtggtggaagtgaacgtcttagataaacccggaccaccagctgcctttgacatcacagatgtaaccaatgagtcatgtcttctaacatggaacccaccacgcgatgatggtggatctaagatcacaaactatgttgtggagagacgagcaactgatagtgaagtgtggcacaagctctcatccaccgtcaaggatacaaacttcaaggccaccaaattaatccccaataaagagtacatcttcagagttgctgcagaaaacatgtatggtgttggtgaaccagttcaggcctctccaataacagccaaatatcagtttgatccacctggtcctccaactcgcctagaaccttctgatatcactaaagacgcagtgactctcacatggtgtgagccagatgatgatggtggcagcccaatcacaggatactgggttgaaagactggatcctgatacagataaatgggttagatgcaataagatgccagtaaaggacacaacatacagagtgaaaggtctcactaataagaaaaaatacagattccgtgtgttggctgaaaatcttgctggacctggaaaaccaagcaaatcaactgaaccaatcttaataaaggatcccatagatcctccatggccccctggaaaaccaactgtaaaagatgtaggcaaaacatcagtaaggttgaattggacaaaaccagaacatgatggaggtgcaaagattgagtcttatgtcattgaaatgctgaagactggaacagatgagtgggtcagagtggcggaaggggttcccaccactcagcacttgctcccagggctcatggaaggacaggaatactcattccgagttagagctgtgaataaggctggggaaagtgaacccagtgaacccagtgaccctgtgctttgccgggagaagctatatcctccatcaccaccacgctggcttgaagttattaatatcacaaaaaatacagcagacctaaaatggacagttcctgagaaagatggagggtcccccatcaccaactacattgtggaaaagagagacgtcaggcgaaaaggctggcaaacagtggataccactgtcaaggacaccaagtgcacagtcaccccactgactgagggctctttatatgtgttccgagttgctgcagaaaatgctataggacaaagcgactacaccgaaattgaggactctgtgctggccaaagacacctttaccactcctggaccaccctacgccctggcagtggttgatgtgacaaaacgacatgttgacctaaagtgggagccacctaaaaatgatggtggaagaccaatacagagatatgtcattgagaagaaagaaaggttaggtacccgttgggtgaaagctggaaagactgcaggacctgactgtaacttcagagtaactgatgtcatcgaaggaacagaggtccagtttcaggttcgggctgaaaatgaagctggagttggccacccaagtgaacccacagaaatcctatccattgaagatccaacaagtcctccctcaccaccccttgacctacatgtgactgatgctgggagaaaacacattgccattgcttggaagcctccagagaaaaatggtggaagtcctatcataggataccatgttgaaatgtgtccagtaggcactgagaaatggatgagagttaattctcgcccaataaaggacttgaaattcaaggttgaagaaggtgttgttcctgacaaagaatatgtcctgagagtgagagcagtcaatgctattggtgtcagcgagccatctgaaatctctgaaaatgtggttgccaaagacccagactgcaagccaacaattgacctggagactcatgacattattgttattgaaggtgaaaagttaagcattcctgttcccttcagagctgtcccagttccaactgttagttggcataaagatggcaaagaagttaaagcaagtgatagattaacaatgaagaatgatcacatctctgcacaccttgaagttcccaagagtgtccgtgcagatgccggaatttataccattacactggagaataagctcggctcagcaacagcctcaatcaatgtcaaagtcataggcctacctggaccatgcaaagatattaaagcaagtgacattaccaagagttcttgtaagttaacttgggaacctccagaatttgatggtggaaccccaattcttcattatgtcctggagcgcagagaagctgggaggagaacatatataccagtcatgtctggtgagaacaaactgtcatggactgtgaaggatctcataccaaatggtgaatacttcttccgtgttaaagcagtcaacaaggttggtggaggagaatatattgaactgaaaaatccagtcattgctcaagatccaaagcaaccccctgatccacctgtagatgtagaggttcataatcctacagcggaggcaatgactattacatggaagccacctttgtatgatggagggagcaagataatgggctacatcatagagaagattgctaagggtgaagaaaggtggaagagatgcaatgaacacctggtaccaatcctgacctatacagcaaaaggacttgaagaggggaaagagtaccaattccgtgtgcgagcagagaacgccgcgggtattagtgaaccttctcgggctactcctccaaccaaagctgtagatcccattgatgcccccaaagtcattctgagaacaagcctagaagtgaaacgaggtgatgaaatagcacttgatgcaagtatttctggatcaccttacccaactattacatggataaaggatgaaaatgttattgtaccagaggaaattaagaagcgtgcagcacccttggttaggagaaggaagggtgaagttcaagaagaagaaccatttgtcctgcctctgacacagcgtttgagtattgacaacagcaaaaagggagaatctcagctacgcgtccgagattctctccgacctgaccatggtctgtatatgatcaaagttgaaaatgaccacggtattgcaaaagctccttgtactgtcagtgtgttagatacaccgggaccaccaatcaactttgtatttgaagatatcagaaagacctcagtcctttgtaaatgggaaccaccccttgatgatggtggcagtgaaatcataaactacactttggaaaagaaagacaagacaaaacccgactcagaatggattgttgtcacttcaacacttagacattgcaaatattcagtaacaaaactgattgaaggaaaagagtacctcttccgtgtaagagctgaaaacagatttgggccaggtccaccatgtgtttcaaagccacttgtggctaaagatccatttggaccacctgatgcaccagataagcccattgtggaagatgttaccagcaacagtatgctagtgaaatggaatgaaccaaaagataatggaagccccattttgggttactggcttgaaaaacgtgaagttaacagtacacattggtctcgtgtcaacaaaagccttctgaatgccttgaaagccaatgtagatggcttattagaaggactcacctatgtcttcagagtatgtgctgaaaatgcagctggacctggaaagttcagtccaccttcagatcccaaaacagcacatgatccaatctctcctcctgggccacctatcccaagagtcactgacacaagctctacaactattgaactagaatgggaacccccagctttcaatggtggtggggaaattgttggctattttgttgataagcagttggttggcacaaatgaatggtcacgctgcacagagaagatgatcaaggtccgtcagtacaccgtcaaagaaatccgagagggtgctgattacaaacttcgggtgagtgctgtcaatgccgcaggggaaggaccgcctggagaaacacaacctgttactgtggctgaaccacaagagcctccagctgtggaactggatgtttctgtcaagggtggaatacaaataatggctgggaagactcttagaattccagctgtggtgactggtcgccctgtacctacaaaagtatggaccaaagaagaaggggagctggataaagaccgtgttgtaatagacaacgttggaaccaaatctgaactaattatcaaggatgcactgcgaaaagaccatggcagatatgtgattacagctacaaatagctgtggttccaaatttgcagcagccagggtagaagtttttgatgtccctggtccagttcttgacttaaaacctgttgtaacaaacagaaaaatgtgtctacttaactggtctgatccagaagatgatggaggaagtgaaataacaggctttatcattgaaagaaaagatgccaagatgcatacttggagacaaccaatagagactgagagatctaaatgtgacatcacaggtctgcttgagggacaagaatataagttccgtgttattgccaagaacaagtttggctgtggccctcctgttgaaataggaccaattcttgcagttgatccactaggtcctccaacatctccagagaggctcacatacactgaaaggacaaagtccactatcacacttgactggaaagagccccgcagtaatggtggcagtcccatccaaggatatatcattgaaaaacggcgtcatgacaaacctgactttgaaagagttaacaagcgactctgcccaaccacatcttttctggttgaaaatcttgatgaacaccaaatgtatgagttccgtgtcaaagctgtcaatgaaattggtgaaagtgaaccatccctacctcttaatgtagtcatacaagatgatgaagtgcctccaactattaagttgcgtctgagtgttcgaggagacactatcaaagttaaggcaggagagcctgtccacatccctgcagatgtgacaggccttccaatgcctaagattgaatggtccaaaaatgaaactgtaattgaaaaacccactgatgcacttcagataaccaaggaagaggtatcccgaagtgaggcaaaaactgagcttagcattcccaaagcggtccgggaggacaaaggcacttacacagttactgcttccaatcgccttggctcagtgttccgaaatgttcacgttgaagtatatgaccgcccatccccaccaagaaatcttgctgttactgacattaaagctgaatcttgctacttgacatgggatgcccctcttgataatggtggcagtgaaatcacccattatgttattgacaaacgtgatgcaagtaggaagaaagcagaatgggaggaagtcaccaacactgctgtagagaaaagatatgggatctggaaacttatccccaatggtcagtatgagttccgagtcagggcagtgaataaatatggaatcagtgatgagtgcaaatcagataaagtagtcattcaagatccttatcgccttcctggacctccaggaaaaccaaaagttttggcacgcaccaaaggatcaatgctagtgagctggactcctcctttggacaatggtggctctccaattactggctactggctggagaaaagagaagagggaagtccttattggtcacgtgttagccgagcaccaataaccaaagtgggattgaaaggcgtggaatttaatgttcctcgtttgcttgaaggcgttaaataccagttcagagccatggcaataaatgctgcaggaattggtcctcccagtgaaccatcagatccagaggttgcaggagatcccatatttccaccggggccaccttcttgcccagaagttaaagataaaacgaagtcaagcatctcactaggatggaaacctccagccaaagatggtggcagcccaatcaaaggatacattgtagaaatgcaagaagaaggtactactgactggaaaagagtaaatgaaccagacaaacttataactacctgtgaatgtgtggtgcctaatctgaaagagctcaggaagtacagattcagagtgaaagctgtcaatgaagctggtgaatctgaaccaagtgatacaactggggagatccctgccactgatattcaagaggaaccagaagttttcattgacattggagcacaggactgtctggtttgtaaagctggctcacagattaggattcctgctgtcatcaagggacgcccaacaccaaaatcatcttgggaatttgatggaaaggcaaagaaagcaatgaaggatggagttcatgacatacccgaagatgcacagctggagactgctgaaaactcctcagtaattattattccggagtgtaaacgatctcatacaggcaaatacagcatcacagccaagaataaagcaggacaaaagactgcaaattgcagagttaaagtcatggatgtaccaggcccacccaaagatctgaaagtcagtgatatcacaaggggtagttgcagactttcatggaagatgccagacgacgatggaggagacaggatcaaaggctatgttattgagaagaggactattgatggaaaagcctggaccaaagtcaatccagactgtggaagcaccacatttgtagtgcctgatctcctctctgaacagcaatatttcttccgtgtgcgagcagaaaaccgttttggtattggcccacctgtggaaaccattcagaggaccactgccagagatccgatatatcctcctgatcctcctattaaactcaagattggcctcatcacaaagaacacagtgcatctgtcatggaaacccccgaagaatgatgggggctcccctgttacccactatattgttgagtgccttgcatgggaccctactgggacaaagaaagaagcctggaggcagtgcaataagcgtgatgtggaagaactgcaatttactgttgaagacctagtagagggtggggaatatgaattccgagtcaaagctgtcaatgctgcaggagtcagcaagccttcagccactgttggccctgtgactgtcaaagaccagacatgcccaccatcaattgatctaaaagaattcatggaggttgaagaaggaaccaatgttaacattgtggccaaaattaaaggtgtgccattcccgacactaacctggtttaaagctcctccaaagaagcctgataacaaagaacctgttctctatgacacccatgtcaacaaactggtggtagatgatacttgcactttagttattccgcagtctcgcaggagtgacactggcttatataccatcacagctgtaaataatctgggaacagcatcaaaggagatgagactgaatgtcctgggtcgtcctggccctccagtgggacccataaaatttgaatctgtttcagcagatcaaatgacactatcttggtttccacctaaagatgatggtgggtctaagattacaaactatgtaattgagaaaagagaagctaacaggaagacatgggtccatgtctccagtgaacctaaggagtgcacgtacacgattcccaaattgctagaaggccatgaatatgtattccgaatcatggcccagaataaatatggcattggagaacctcttgacagtgaacctgaaacagcaagaaacctcttctctgtccctggagcaccagataaaccaacagttagcagcgtgactcgtaactccatgactgtcaactgggaagagccagaatatgatggaggctctcctgtgacagggtactggctggaaatgaaagacaccacttcaaagagatggaagagagttaaccgagatcctatcaaagccatgactttgggtgtttcttataaagtgactggtcttattgaaggttccgactatcaattccgggtatatgcaatcaatgctgctggcgtgggtccagcaagtctgccatcagacccagcgactgctagagatccaattgcccctcctggtcctccatttcccaaagtgacagattggactaaatcatctgcagatctggagtggtctcccccactaaaagatggtggatccaaagtaactggatacatcgttgaatataaagaagaaggaaaagaagaatgggaaaagggtaaagataaagaagtgagaggaacaaagcttgttgtgacaggattaaaggaaggagcattctacaaatttagagttagagcagtcaacattgctggcattggagaacctggagaggtcacagatgtcattgaaatgaaggacagacttgtttcacctgaccttcagctagatgccagtgtcagagatagaattgttgtccatgctggaggggtgatccgaatcattgcctatgtgtctggaaagcctcctccaaccgtcacctggaacatgaatgaaagaaccttacctcaagaagccaccattgagaccacagccattagctcatccatggtcatcaagaactgccagaggagccatcaaggcgtctattctcttcttgccaaaaatgaagccggagaaagaaagaagacaattattgttgatgtattagatgttccaggtcccgttggaacaccattcctagctcacaacctaaccaatgagtcctgcaaactgacatggttttctccagaagatgatggaggctctccaatcaccaattatgtcattgaaaagcgtgaatctgaccgcagagcatggaccccagtgacatatacagttacccgacaaaatgctactgtccagggtctcattcaaggaaaagcctactttttccgaattgcggctgaaaatagtattggcatgggtccatttgttgagacatcagaggcacttgttatcagagagccaataactgtaccagagcgtcctgaagacctggaagtcaaagaagttactaaaaatactgtaactttgacttggaatcctcctaagtatgatggtgggtcagaaattattaactatgtcctagaaagtcggctcattgggactgagaagttccacaaagttacaaatgacaacttgcttagcagaaaatacactgttaaaggcttaaaagaaggtgatacctatgagtaccgtgtcagtgctgtcaacattgttggacaaggcaaaccatcattttgcaccaaaccaattacttgcaaggatgagctggcacccccaacgcttcacctcgacttcagagataagctcacgattcgagttggtgaagcttttgccctcactggccgttactcaggcaaaccaaagcctaaggtttcctggttcaaagatgaagctgatgtgctggaagatgatcgcactcatataaagactacaccagcaacacttgctttagagaagatcaaggccaaacgttcagattccggcaaatactgtgtggttgtggagaacagtacaggctctaggaaaggtttctgtcaagttaatgttgttgaccgtcctggaccaccagtaggaccagttagttttgatgaggtgaccaaagattacatggttatctcttggaagcctcctttagatgatggaggcagtaaaatcaccaattatattattgagaagaaggaagtgggtaaagacgtctggatgccagtgacatctgcaagtgctaaaacaacatgcaaagtttctaaactacttgaaggaaaagattatattttccggatacatgctgaaaatctgtatggaataagtgatcctctggtgtctgattcaatgaaagccaaagatcgtttcagggttcctgatgcacctgatcagccaattgttacagaagttaccaaagactctgcattagtaacctggaataagccacatgatggaggaaaacccatcacaaactacatcctggaaaagagagaaactatgtctaaacgatgggctagagttaccaaagatcctattcatccatacactaaatttagggttcctgatcttctagaaggatgtcagtatgaattccgggtttctgcagaaaatgaaattggtattggagatccaagcccaccatccaaaccagtctttgctaaagatccaattgctaaaccaagtccacctgttaatcctgaagcaatagatacaacatgcaattcagtcgatctaacttggcagccaccacgtcatgatggtgggagcaagattctgggttatattgttgagtaccagaaagttggagatgaagagtggagaagagccaatcacacccctgagtcatgtcctgaaactaaatataaagtcaccggtcttcgggacggtcaaacctataagtttagagtgttagcagtcaatgcagctggtgaatcagatccagctcatgttccggagccagtcctagtaaaagacaggcttgaaccccctgagttgattcttgatgccaacatggcaagagaacaacacattaaagttggtgatactctaagacttagtgccatcatcaaaggagtgccattcccaaaagtaacttggaaaaaagaagacagagatgctccaactaaagcaagaattgatgtgactccagttggtagcaagcttgaaattcgtaatgctgcccatgaagatggtggaatttattctttaacagtggagaatccagctggttcaaaaactgtctcagtaaaagtacttgtattagataaacctgggccacctagagatctggaagtcagtgaaattaggaaagattcatgttaccttacttggaaagaaccactggatgatggtggttctgttattaccaattatgtggttgagaggagagatgttgccagcgcccagtggtcacctctctcagctacatcaaagaaaaagagtcacttcgctaagcatctgaatgaaggcaaccagtacctcttccgagtagctgcggagaaccagtatggacgtggtccttttgttgaaacaccaaaaccaatcaaggctttggatcctctccatcccccagggccacccaaggacctgcaccatgtagatgttgacaagactgaagtctccctagtctggaataagccggatcgtgatggtggttctccaatcactggatatttggtagaatatcaagaagaaggcacccaggactggattaaatttaagactgtgacaaacttagagtgtgtggttactggactacaacaaggaaagacctatagattccgtgtaaaagctgaaaacattgtgggtcttggtctccctgacacaactatcccgatagaatgtcaagaaaaactagtgcctccatccgtggagctagatgtgaaattaattgaaggtcttgtggtaaaggctggaaccacagtcagattccctgctattataagaggtgtgcctgttcctactgcaaagtggacaaccgatgggagtgagattaaaaccgatgagcactacacagttgaaacagacaacttctcatcagtacttaccattaagaactgcttaaggagagacactggggaatatcaaatcacagtttccaatgcagccggtagcaaaacagtagccgtacatcttactgttcttgatgttcctgggccaccaacaggtcctattaatattctggatgttactcctgaacacatgactatctcatggcagccacctaaggatgatggaggaagccctgtgataaattatattgttgagaaacaagatacaaggaaagacacgtggggtgttgtctcttccggaagcagtaagacaaagctgaaaatcccacatctgcagaagggctgtgaatatgttttccgagttagagcagagaataagataggtgttggtcctccccttgactccacacctactgttgctaagcataaatttagtcctccgtctcctcctggtaaaccagtggttactgacattactgaaaatgcagcaacagtgtcttggaccctgccaaaatctgatggtggcagtccaataactggctactatatggaacgtcgagaagtaactggcaaatgggtgagggtcaacaaaacacctatcgctgacctgaagttcagagtgactggactctatgaaggaaatacatatgagtttagagtttttgctgaaaatcttgcaggactaagcaaaccatccccaagttctgatccaataaaagcttgccggcccatcaaaccacctggaccacctattaatcctaaactgaaagacaagagcagagaaacagctgatttggtgtggacaaagcctctcagtgatggtggtagccccattctaggatatgtagtggaatgtcagaaacctggcacagcacaatggaacaggattaataaagatgaactcattaggcaatgtgcctttagggtacctggactaattgaaggaaatgagtacagattccgtataaaggcagctaatattgtaggagagggtgagccaagagaactagcagaatctgtgattgcaaaagatatccttcatcctccagaagtagaacttgatgttacttgtcgtgatgttattaccgtgagagtaggccaaactatccgcattctagctcgagtcaaaggcagacctgaaccagacataacttggactaaggaaggcaaagtattggtccgagaaaagagggtggaccttattcaggatctacctcgtgttgagttacaaattaaagaagctgttagagctgatcatggcaagtatatcatctcagctaagaacagcagtggacatgcccaaggttcagccatcgttaacgtccttgacagacctgggccttgccagaatttgaaggttaccaatgtaaccaaagagaactgtacaatttcttgggaaaacccactagataatggtggctcagaaataacaaacttcatagtagaatatcgcaaaccaaaccagaaaggctggtcaattgttgcatcagatgtcactaaacgattaatcaaggccaaccttttagccaacaatgaatactatttccgagtttgtgcagagaataaagtaggtgttgggccaaccatcgaaacaaaaactcccattctggctattaaccctattgacagaccaggtgagcctgaaaaccttcacattgcagataaaggaaagacatttgtctatctaaagtggcggaggcctgactatgatggtggcagtccaaatctgtcatatcatgttgagagaaggcttaagggctccgatgactgggaaagagtgcataaaggaagcattaaagaaactcactacatggttgacagatgtgttgaaaaccagatttatgagttcagagtgcaaacaaagaatgaaggtggggaaagtgactgggtgaagacagaggaagttgttgtgaaagaagacttacaaaaaccagtacttgatctgaaattaagtggggtcctaactgtcaaagcaggggacaccattaggcttgaggcaggggttagaggcaaaccattcccagaagttgcatggaccaaggacaaagacgctacagacttaacaagatcaccaagggtcaagattgatacccgtgctgattcatctaaattttctcttactaaagcaaagcgaagtgatgggggtaaatatgtagttacggcaactaacacggctggcagttttgtggcctatgccactgtcaatgttttagataagcctggtcctgtgagaaatctgaaaattgttgatgtgtccagtgataggtgtactgtttgctgggatccaccagaagatgatggtggctgtgaaatccaaaattatattctagaaaaatgtgagacaaagcgaatggtttggtctacctattctgctactgtcttgacacctggtactacagtaacacgtctcatagaaggaaatgaatatattttcagagtccgtgcagaaaataaaataggcacagggcctccaacagaaagtaaaccagtcatagccaaaaccaagtatgataaacctggtcgccctgatcccccagaagtcactaaagtaagcaaagaagagatgactgtggtttggaatccacctgaatatgatggtggaaagtctataactggatactttttggagaaaaaggaaaagcattcaacacgatgggtccctgtcaacaagagtgcaatccctgagagacgtatgaaagtacagaatctcctcccagaccatgaatatcagttccgtgtcaaggcagaaaatgaaattggaattggagaaccaagcttgccttcaagaccggtggtggcaaaagaccccatagagccacctggtccaccaaccaatttcagagtggttgatacaaccaaacattccataactcttgggtggggaaaaccagtctatgatggtggtgcaccgatcattggatatgttgtggaaatgagaccaaaaatagcagatgcgtctcctgatgaaggctggaaacggtgtaatgctgcagcacagcttgtacgcaaggaattcactgttaccagcttggatgaaaaccaggaatatgagttcagggtgtgtgcccaaaaccaagttggtattgggcgccctgcagagctaaaggaagctatcaaacctaaagaaatactagaacctccggagattgatttggatgccagcatgaggaaactggtcatagtgagagcaggatgccctattcgtctctttgctatagtgagaggacgaccagcccctaaagtcacttggcgaaaagttggcattgataatgtggtcagaaaaggacaagttgatctggttgacactatggccttccttgtcatccccaattctacccgtgatgactcaggaaaatattccttaacacttgtgaacccagcaggagaaaaggctgtattcgtaaatgtcagagtattagacactcctgggcctgtgtctgatttaaaagtttcagatgtcactaaaacatcatgccatgtgtcctgggcccctcctgaaaacgacggtgggagccaagtgacacattatatcgtggagaaacgtgaggcagacagaaagacatggtcgaccgttaccccagaagttaagaaaacaagcttccatgtaaccaatcttgtccctgggaatgagtattacttcagagtaactgctgtcaacgaatatggccctggcgtcccaacagatgtcccaaaaccagtgcttgcatcagatcctctaagtgagccggatcccccaaggaaattagaagtgactgaaatgaccaagaacagtgccaccttagcctggttacctcccctacgtgatggaggtgctaaaatcgatggctacatcactagttacagagaagaagagcagcctgcagatcgctggacagagtactcagtggtaaaagatctgagccttgttgtcactggcctaaaggaaggaaagaaatacaaatttagagtagcggccagaaatgctgttggagtcagtttgccaagagaagctgaaggagtgtatgaagccaaagaacaactgttgccaccaaagatccttatgccagagcaaataactatcaaagctgggaaaaaactccgaattgaagcccatgtgtatggaaagcctcatcccacctgtaaatggaaaaaaggagaagatgaagttgtcacatccagccacctggcagtgcataaagcagacagctcttcaattctgatcataaaagatgtgactaggaaagacagtggttactacagcctcacagcagagaacagttctgggacagacactcagaaaatcaaagttgtagtcatggatgcccccggcccccctcagcctccatttgacatttctgatatagacgctgatgcttgctccctgtcatggcacatccctctggaggacggaggcagtaacatcaccaattatatagtggagaagtgtgatgtaagccgaggtgactgggtcacggctctagcttcagtcacaaaaacttcctgcagggttggaaagctgatcccaggccaggagtacatcttccgggtccgtgctgaaaaccgatttggcatttcagagcctctcacatctccaaagatggttgcgcagttcccatttggtgttcctagtgaaccaaagaatgcacgagtcaccaaagtcaacaaggactgtatttttgttgcttgggacagaccagatagtgatggagggagccccattattggttatctgattgaacgcaaggaaagaaacagtttgctgtgggtgaaagccaatgatactcttgtccggtcaactgaatatccttgtgctggccttgtagaaggtcttgagtattcattcagaatctatgccctaaacaaagctggatccagcccacccagcaaacccacagaatatgtaactgcaagaatgccagttgatcctcctgggaaacctgaggttattgatgtcaccaagagtactgtatctctgatctgggctcgtccaaagcatgatggaggcagtaaaattattggctatttcgtagaagcttgcaaacttcctggtgataaatgggtacggtgcaatactgcacctcaccagattccccaggaagagtacacagctactggcctagaagagaaagctcagtatcaatttagagctattgccaggaccgcggtaaacattagcccaccttctgaaccttctgatccagtgactatcctcgcagaaaatgtccctcccaggatagacctgagtgtggctatgaaatctttgcttactgtgaaagctggaactaatgtctgcttggatgctactgtttttggtaaaccgatgccaacagtttcttggaaaaaagatggcacactgctaaaaccagcagaaggcataaagatggccatgcagcggaatctgtgcaccttggagctattcagcgtgaaccggaaggactcaggagactataccattactgctgaaaattcaagtggttctaaatcagccaccattaagcttaaagtgttagataaaccgggtcctccagcatctgttaaaatcaacaaaatgtattcagatcgtgctatgctttcttgggaaccgcctcttgaagatggaggctcagaaatcaccaactatattgttgacaaacgtgaaacaagcaggcccaactgggctcaagtctctgcaactgtgcctatcaccagctgcagcgtggagaaacttatagagggccatgagtatcagttccgtatttgtgctgaaaataaatatggagtaggcgatccagtcttcactgaaccagcaattgccaaaaacccatatgacccaccaggacgctgtgatcctcctgttattagcaacataaccaaagatcacatgacagtcagctggaagccaccagcagatgatgggggctcacccatcactggctatttgcttgaaaagcgggaaacccaggctgttaactggactaaggtcaacagaaaacctattatagaaagaacattaaaagcaacaggtcttcaagaaggtaccgaatatgagttccgtgttacagctataaataaagctggaccaggcaaacccagtgacgcatccaaggccgcttatgctcgggaccctcagtatcctcctggcccaccggctttccctaaagtatatgatacaactcgcagctctgtgagtctatcttggggcaagccagcctatgacggcggcagccctatcattggttatctcgttgaagtaaaacgggctgactccgataactgggtgaggtgcaacttaccacagaatctacagaaaacccgctttgaggttactggcctgatggaagacacacaatatcaattccgtgtgtatgccgttaataagattggatacagtgaccccagtgatgtgccagataaacactatcccaaggacatcttaattccacctgagggagaacttgatgcggacttaaggaagacactcatattacgtgctggagttactatgagactatatgtaccagtaaaaggacgcccacctccaaagattacttggtctaaaccaaatgtcaatctaagagacaggattggactggacataaagtcaactgactttgacactttcttgcgctgtgaaaatgtgaacaaatatgatgcaggaaaatatatcttaaccctggagaacagctgtggtaaaaaggaatataccattgttgtgaaagtgcttgatactcctgggccacctgtcaatgtgactgttaaggaaatatccaaagactctgcttatgttacctgggagcctcccattattgatggcggaagccccatcataaactatgtggtacaaaaacgtgatgcagagaggaaatcctggtctacagtgacaactgagtgctccaaaacaagcttcagagtagctaatttggaggagggaaaatcctacttcttccgagtgtttgctgaaaatgagtatggcattggtgatcccggtgaaactcgtgatgctgtcaaagcttcccaaactcctggaccagttgtggacctgaaagtgaggtctgtatctaagtcatcctgtagcattggctggaaaaagcctcacagtgatggtggaagtcggattattggatatgtagttgatttcctgactgaagaaaataagtggcaacgagttatgaaatccttaagcctacagtactctgcaaaagatttgactgaagggaaggaatataccttcagagtgagtgctgagaatgaaaatggagaaggaaccccaagcgaaatcactgttgtggcaagggatgatgttgtggctcctgatcttgacttaaagggtctacctgatttgtgctacttggctaaagaaaacagcaacttccggcttaagatccccataaaaggcaagccagctccatcagtctcctggaagaaaggggaagatcctctagcaactgacactagagtcagtgttgagtcatctgcggttaacacaactcttatagtgtacgattgccaaaaatctgatgctggaaaatacacaatcacacttaagaatgttgctggcaccaaggaaggaactatctccataaaggttgttggcaagcctggcatccccactggaccaatcaaatttgatgaagtcacagcagaagccatgaccttaaagtgggctcctccaaaggatgatggaggttctgaaatcaccaactatatcctagagaagagggattctgtgaacaacaagtgggtgacgtgcgcctcagctgtccagaaaaccacctttagagtaaccagacttcatgagggcatggaatataccttcagggtcagtgccgaaaataaatatggtgtaggggaaggcctgaaatcggagccaattgttgcgagacatccatttgatgtgcctgatgctcccccacctcccaatattgtggatgtcagacacgattcagtatctctaacttggactgaccccaagaaaactggtggttctccaattacagggtatcatctcgagttcaaggaaagaaacagccttttgtggaagagagctaacaagactccgataaggatgagagactttaaagtgacaggattaactgaaggtcttgaatatgaattccgagttatggcaatcaatttagcaggtgtgggcaagccaagcctaccatcagagcctgttgtggcactggacccaattgatcctcctggaaaacctgaggttattaacataacaaggaattcagtgactctcatttggactgaacctaaatatgacggtggtcataagttaactggatatatagtggagaagcgagatctaccttcgaagtcttggatgaaagccaaccatgttaatgtcccagaatgtgcctttactgtaactgaccttgttgagggtggaaaatatgaattcagaattagagcaaagaatacagcaggtgctatcagtgctccatcagaaagtacagaaaccattatttgcaaggatgaatacgaggcaccaacaattgtccttgatcccacaataaaagatgggctaacaattaaagcaggggataccattgttttgaatgccattagcattcttggcaaaccccttccaaaatcaagttggtccaaggcaggaaaagacattagaccatcagatatcactcagataacttcaaccccaacatcttccatgcttactatcaagtatgccactagaaaagatgcgggtgaatataccatcactgctaccaatccttttggcacgaaggtggaacatgtgaaggtaacagtccttgatgtacctggtcccccaggtcctgttgaaatcagtaatgtttctgctgaaaaagcaacacttacatggacacctcccttggaagatggcggctcaccaattaagtcctatatacttgaaaagagagaaaccagccgacttttgtggacagtggtttctgaagatattcagtcttgcaggcatgtggcaaccaaacttatccaaggaaatgagtacatcttccgggtctcagctgtaaaccactatggcaaaggagaacctgtacagtctgaacctgtcaaaatggtagacagatttggtccccctggccctcctgaaaaaccagaggtatcaaatgtcactaagaacactgccactgtcagctggaaaaggccagtggatgatggtggcagcgaaattacaggatatcatgtagaaaggagagaaaagaaaagcctgcgatgggtgagagcaataaaaacaccagtttccgatctcaggtgcaaagtaacaggactgcaagaaggaagcacctacgaattccgtgtcagtgcagaaaacagagcaggaattggtccacccagtgaggcttcagattctgttctgatgaaagatgcagcatatcctccaggaccaccttcaaatccgcatgtcactgatactaccaagaaatctgcttctttggcatggggcaagcctcattatgatggtggacttgaaatcactggctatgtcgtggagcatcaaaaagtaggagacgaggcctggataaaagataccacaggaaccgccctcagaatcactcagttcgttgttcctgatcttcagactaaagaaaaatacaacttcagaatcagtgccatcaacgatgcaggtgttggggagccagcggtgattccagatgttgaaatcgtagaacgggagatggctcctgattttgaactagatgccgagcttcgaagaacacttgttgttagagcaggactcagtattaggatatttgtgccaattaaaggtcgtcctgctcctgaagtgacatggaccaaagataacatcaacctgaaaaaccgagccaacattgaaaatacggaatcatttactcttctgattatcccagaatgtaacagatatgataccggtaaatttgtcatgaccattgaaaacccggctgggaagaaaagtggctttgtgaacgtcagagtcttggacacgccaggcccagtcctcaacctgcggcctacagacatcacaaaggacagtgtcaccctgcactgggacctccctctgatagatggaggctcacgtataacaaactacattgtagagaaacgtgaagcaacacggaaatcttattccacagccaccactaagtgccataaatgcacatataaagttaccggcttgtctgaagggtgtgaatatttcttcagagtgatggcagagaatgaatatggaattggtgagccaacagaaactacagagcccgtaaaagcctctgaagcaccatctccaccagacagccttaacatcatggacataactaagagcaccgtcagcctggcatggcctaagcccaaacacgatggtggcagcaagatcactggctatgtgattgaagcccaaagaaaaggctctgaccagtggacccacatcacaaccgtgaaagggttagaatgtgttgtgaggaatctaactgaaggagaggaatataccttccaagtgatggcagtgaacagcgcggggagaagtgcccctagagaaagcagacccgtcattgtcaaggagcagacaatgcttccagagctggatctccgtggcatctatcagaaactggtcattgccaaagctggtgacaacatcaaagttgaaattccagtgctcggtcgaccgaagcccacagtgacatggaaaaaaggagaccaaattcttaaacagacacagagagttaattttgaaaccacagcgacttcaaccattttaaatatcaatgagtgtgtcagaagtgatagtgggccctatccattaacagcaaggaacattgtaggagaggttggtgatgtcatcaccattcaagtccatgatatcccagggccacctactggaccaatcaaatttgatgaagtttcatctgattttgtaaccttctcttgggacccacctgagaacgatggtggtgtaccaataagcaactatgtagtggaaatgcggcagactgacagtactacctgggttgagttagcaaccaccgttatacgtactacctataaagccacccgccttactactggattagagtatcagttccgtgtaaaagctcagaatagatatggagttggaccaggcatcacatcagcatgcatagttgccaactatccatttaaggttcctggacctcctggtacccctcaggtaactgcagttaccaaggattcaatgacaattagctggcatgagccactttctgatggtggaagccccattttaggatatcatgttgaaagaaaagaacgaaatggtattctctggcagactgtgagcaaagctttagtaccaggcaacattttcaaatcaagtggacttacagatggtattgcttatgagttccgggtgattgcagaaaacatggcaggcaaaagtaagccaagcaagccatcagaacctatgttggctctggatcccattgacccacctggaaaaccagtacctctaaatattacaagacacacagtaacacttaaatgggctaagcctgaatatactgggggctttaaaattaccagttatatcgttgaaaagagagaccttcctaatggacggtggctgaaggccaacttcagcaacattttggagaatgaatttacagtcagtggcctaacagaagatgctgcatatgaattccgtgtgatcgccaaaaatgctgcaggtgccatcagtccaccatctgagccatctgatgctatcacttgcagggatgatgttgaggcaccaaagataaaggtggatgttaaatttaaggacacggttatattaaaagcaggtgaagcattcagactggaagctgatgtttcaggccgcccacctccaacaatggaatggagcaaagatggaaaagagctggaaggcacagcaaagttagaaataaaaattgcagatttctctactaatctggtaaacaaagattcaacaagaagggatagtggtgcctatacccttacagcgactaatcctggtggctttgctaaacacattttcaatgtcaaagttcttgacagaccaggcccacctgaaggacctttggctgtaactgaagtgacatcagaaaagtgtgtactatcatggttccctccactggatgatggaggtgccaaaattgatcattacatagtacagaaacgtgaaaccagcagattggcatggacaaatgtagcctcagaagtccaagtaacaaagctaaaggtcactaaactcttgaaaggcaatgaatacatattccgtgtcatggctgtaaataaatatggagtgggagagccactggaatcagagcctgtgcttgcagtgaatccttatggaccccctgatccgcccaaaaaccctgaagtgacaactattactaaagattcgatggttgtctgctggggacatcctgattctgatggtggaagtgaaatcatcaattatattgtggaacggcgtgataaagctggccaacgctggattaaatgcaacaaaaaaactcttactgatttaagatataaagtgtctggactgacagaaggacatgaatatgagttcaggattatggctgaaaatgctgctggaattagtgcaccaagtcctaccagtccattttacaaggcttgtgacactgtgtttaaacctggaccaccaggtaacccacgtgttctggatacaagcagatcatccatttcaatcgcttggaataaacctatctatgatggtggttcagaaatcactgggtatatggttgagattgccctgccagaggaagatgaatggcagattgtcactccaccagcaggactcaaggcaacttcgtatactatcactggcctcacagagaatcaggaatataagatccgcatctatgccatgaattccgaaggacttggggaacctgcccttgttcctggaactccaaaggctgaagacagaatgctgcctccagaaattgaactggatgctgacctgcgcaaagttgttactataagggcctgctgcaccctgagactttttgttcccatcaaaggaaggcctgcacctgaggtgaagtgggcccgggaccatggagaatctttagataaagctagcatcgaatccacaagctcttacaccctgcttattgttggaaatgtaaacagatttgacagtggcaaatatatactaactgtagaaaatagttcaggcagcaagtctgcatttgtcaatgttagagttctcgatacaccaggccccccacaggatctgaaggtaaaagaggtcactaagacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaagaactatattgttgaaaagcgggaatcaacaagaaaagcatattcaactgttgcaacaaactgccacaagacttcctggaaggtagaccagcttcaagaaggctgtagctactatttcagggttctcgcagaaaatgaatatggcattgggctgcctgctgaaaccgcagaatctgtgaaagcatcagaacgacctcttcctccaggaaaaataactttgatggatgtcacaagaaatagtgtgtcactctcttgggagaaaccagagcatgatggaggcagccgaattctaggctacattgtggagatgcagaccaaaggcagtgacaaatgggccacgtgtgccacagtcaaggtcactgaagccactatcactggattaattcagggtgaagaatactctttccgtgtttcagctcagaatgaaaagggcatcagtgatcctagacaactgagtgtgccagtgatcgccaaagatcttgtcattccaccagccttcaaactcctgttcaatactttcactgtactggcaggtgaagacctaaaagttgatgttccattcattggccgccctaccccagctgtaacctggcataaagataatgtaccactgaagcagacaactagagtaaatgcagagagcacagaaaataattcactactgacaataaaggacgcctgccgagaagatgttggccattatgtggttaaactgactaactcagctggtgaagctattgaaacccttaatgttatcgttcttgacaaaccagggcctccaactggaccagttaaaatggatgaagtgacagctgatagtattactctttcctggggcccacccaagtatgatggtggaagttctatcaataattacattgttgagaaacgggacacttccacaaccacctggcaaattgtatcagctacagttgcaaggacaacaataaaggcttgcagactgaagactggatgtgaatatcagtttagaattgcagctgaaaacagatatgggaagagtacctacctcaattcagagcctactgtagcccaatatccattcaaagttcctggtcctcctggcactccagttgtcacactgtcctccagggacagcatggaagtacaatggaatgagccaatcagtgatggaggaagtagagtcattggctatcatctagaacgcaaggaaagaaatagcatcctctgggttaagttgaataaaacacctattcctcaaaccaagtttaagacaactggccttgaagaaggtgttgaatatgaatttagagtctctgcagagaacatcgtgggcattggcaagccgagtaaagtatcagaatgttatgtggctcgtgacccatgtgatccaccaggacggccagaggcaatcattgtcacaaggaattctgtgactcttcagtggaagaaacccacctatgacggtggaagcaagatcactggttatattgttgagaagaaagaattacctgagggccgttggatgaaagccagttttacaaatattattgacactcattttgaagtaactggcctagttgaagatcacagatatgagttccgggttatagcccgaaatgccgcaggagtgtttagtgagccttcagaaagcacaggagcaataacagctagagatgaggtagatccaccacgaataagtatggatccaaaatacaaagacacaatcgtggttcatgctggtgaatcattcaaggttgatgcagatatttatggcaaaccaataccaaccattcagtggataaaaggtgatcaggagctttcaaacacagctcgattagaaataaagagcaccgactttgccaccagtctcagtgtaaaagatgcagtacgtgtcgacagtggaaattacatactgaaggccaaaaatgttgcaggagaaagatcagttactgtgaatgtcaaggttcttgacagaccagggccacctgaaggacctgttgttatctcaggagttacagcagaaaaatgcacactagcttggaaacccccacttcaggatggtgggagtgacatcataaattatattgtggaaaggagagaaaccagccgcttagtttggactgtggttgatgccaatgtgcagactctcagctgcaaggttactaagcttcttgaaggcaatgaatatactttccgtataatggcagtaaacaaatatggtgttggtgaacctcttgaatctgagccagtagttgccaagaatccatttgtagtaccagatgcaccaaaagctccagaagtcacaacagtgaccaaggactcaatgattgttgtatgggaaagaccagcatctgatggtggtagtgaaattcttggatatgttcttgagaaacgggataaagaaggcattagatggacaagatgccataagcgtctgattggagagttgcgcctgagagtaactggactcatagaaaatcacgattatgagttcagagtttctgctgagaatgctgctggacttagtgaaccaagccctccttctgcttaccaaaaggcttgtgatcctatttataaaccaggacccccaaacaaccccaaagtcatagacataaccagatcttcagtattcctttcttggagcaaaccaatatatgatggtggctgtgaaattcaaggatacattgttgaaaaatgtgatgtgagtgttggtgaatggacaatgtgcactccaccaacaggaattaataaaacaaacatagaagtagagaagctgttggaaaagcatgaatacaacttccgtatctgtgctattaataaagctggagttggagaacatgctgacgtccctggacctattatagttgaagaaaaattagaagcaccagacattgatcttgacctagaactaaggaaaatcataaatataagggcaggtggctccttaaggttatttgttcctataaaaggtcgtcctacaccagaagttaaatggggaaaggtggatggtgaaatccgagatgcagctataattgatgtcactagcagtttcacctctcttgttcttgacaatgtcaaccgatatgatagtggaaaatatacgcttacattagaaaacagcagtggaacaaagtctgcctttgttactgtgagagttctggacacgccaagtccacctgttaacctgaaagtcacagaaatcaccaaagactcagtatcaattacatgggaacctcctttgttggatgggggatccaaaataaaaaattacattgttgagaaacgtgaagccacaagaaaatcatatgctgctgttgtaactaactgccataagaattcttggaaaatcgatcagctccaagaaggttgcagttattactttagagtcacagctgagaatgagtatggtattggccttcctgcccagactgctgatccaattaaggttgcagaagtgccacaacctcctggaaaaataactgtggatgatgtcaccagaaacagtgtctctctgagttggacaaaacctgaacatgatggtggcagtaaaatcattcagtatattgtggaaatgcaagctaaacacagtgagaaatggtcagagtgtgctcgagtaaagtctcttcaggcagtaattaccaacctaactcaaggggaagaatatctttttagagttgttgctgtaaatgaaaaggggagaagtgatcctcggtcccttgcagttccaatagttgccaaagatctggtaattgagccagatgtaaaacctgcattcagtagttacagtgtacaggttggccaagatttgaaaatagaagtgccaatttctggacgtcctaagccaaccattacctggactaaagatggtctcccactgaagcagaccacaagaatcaatgttaccgattcactggatctcaccacactcagtattaaagaaactcataaggatgatggtggacaatatggaatcacagttgccaatgttgttggtcagaagacagcatccatcgaaattgtaactctagataaacctgatcctccaaaaggacctgttaaatttgatgacgtcagtgctgaaagtattacattatcttggaaccctccattatatacagggggctgccaaatcaccaactacattgttcagaaaagagatacaaccaccacagtatgggatgttgtttctgctactgttgctagaactacactcaaagtgaccaaactgaaaactggtacagaataccaatttagaatatttgccgaaaacagatatggacaaagctttgccttagagtctgatccaattgtagctcaatatccctacaaagaaccaggccctccaggtacaccatttgccacagccatttccaaagactccatggtcatacagtggcatgaaccagtcaacaatggtggaagccccgtcataggttaccacctggagagaaaagaaagaaacagtattttgtggacaaaggtcaacaaaactattattcatgacacccaattcaaagcacagaatcttgaagaaggcattgaatatgaattcagagtgtatgctgaaaatattgttggtgtaggcaaagcaagcaagaattctgaatgctatgtagccagagatccctgtgacccaccaggaaccccagaaccaataatggttaaaagaaatgaaatcactttacagtggaccaaacctgtgtatgatggtggaagtatgattacaggctacattgtagagaaacgtgatttgcctgatggtcgttggatgaaagctagctttacaaatgtcattgaaactcaatttactgtgtcaggtcttactgaagatcaaagatatgaattcagagtcattgcaaagaatgcagctggtgcaataagtaaaccctctgacagtactggaccaataactgccaaggatgaggttgaactcccaagaatttcaatggatccaaaattcagagacacaattgtggtaaatgctggagaaacattcagacttgaggctgatgtccatggaaagcccctacctaccattgagtggttaagaggagataaggaaattgaagaatctgctagatgtgaaataaagaacacagatttcaaggctttacttattgtaaaagatgcaattagaattgatggtgggcagtatattttaagagcttccaatgttgcaggttctaagtcattcccagtaaatgtaaaagtattagatagaccaggacctccagaagggccagtccaggttactggagtcacttctgaaaaatgctctttaacatggtctccaccacttcaagatggtggcagtgacatttctcactatgttgttgaaaagcgagaaaccagtcgacttgcctggactgttgttgcttcagaagttgtgaccaattctctgaaagttaccaaactcttagaaggtaatgaatatgttttccgtataatggctgtcaacaaatatggtgttggagagcctttggaatctgcaccagtactaatgaaaaatccatttgtgcttcctggaccaccaaaaagcttggaagtcacaaatattgccaaagactccatgaccgtctgttggaaccgtccagatagtgatggtggaagtgagattattggttacattgtagagaaaagagacagaagtggcattcgatggataaaatgtaataaacgccgcattacagatttgcgtctaagagtgacaggattaacagaagatcatgagtatgaattcagggtctctgcagaaaatgctgctggagttggggaaccaagtccagctacagtttattataaagcctgtgatcctgtgttcaaacctggcccacctaccaatgcacacattgtagacaccactaaaaattcaatcacacttgcctggggtaaacccatctatgatggcggcagtgagatcttgggatatgtagtagaaatctgtaaagcagatgaagaagaatggcaaatagttactccacagactggcctgagagtcactcgatttgaaatttcaaaactcactgaacaccaagagtataaaatacgagtctgtgccctcaacaaagttggtttaggtgaggctacatcagttcctggtactgtgaaaccagaagataaacttgaagcacctgaacttgaccttgactccgaattaagaaaaggaattgttgtaagagctggtggatctgccagaattcacattccattcaaaggtcgtccaacgcctgagatcacttggtctcgagaggaaggtgaattcacagataaggtccaaattgaaaagggagtaaactatacccaactatcaatagataactgtgatagaaatgatgctggaaaatacattcttaagttggaaaacagcagtggatcaaagtctgcttttgtaactgtgaaagttcttgacactccaggaccaccacagaatttggcagtcaaagaagtgagaaaagattctgccttcctggtatgggagccacccatcattgatggaggggcaaaggtcaagaactatgtgattgacaaacgtgagtcaaccagaaaagcgtatgctaatgtgagtagtaaatgcagcaaaacaagttttaaagtggaaaaccttacagaaggagccatttattacttcagagtcatggctgaaaatgaatttggagttggtgttccagtggaaactgttgatgccgtgaaagctgctgaacctccttccccaccaggaaaggttacactcactgatgtgtcccagaccagtgcatcacttatgtgggagaaacctgaacatgatggcggtagcagagtcctggggtacgttgttgaaatgcagcccaaaggaactgaaaaatggagcattgtggctgaatccaaagtctgtaatgcagttgttactggtttgagttctggacaagaatatcagttccgtgtcaaggcttataatgagaaaggaaaaagcgatccaagagtgttgggtgttcctgtcatagccaaggacttgactatacagcctagtttaaagttaccatttaacacatatagtatccaagctggagaagatcttaaaatagaaattccagttataggccgaccaagacctaacatttcttgggtcaaagatggtgagcctcttaaacagacaacaagagtaaacgttgaagaaacagctacctcaactgttttgcacattaaagaaggtaacaaagatgactttggaaaatacaccgtaacggcaacaaatagtgcaggcacagcaacagaaaatctcagtgttatcgttttagaaaagcctggacctccagttggcccagttcggtttgatgaagttagtgcagactttgtagtcatatcttgggaacctccagcctatactggtggctgccaaataagcaactacattgtagagaagcgagatacaaccaccaccacttggcacatggtatcagcaacagttgcaagaacaacaattaaaataaccaaactgaaaacaggcacggagtaccagtttagaatttttgctgaaaacaggtatggaaaaagtgccccactggattctaaggcagttattgtacaatatccatttaaagaacctggaccacctggaactccttttgtgacatcaatctcaaaagatcagatgcttgtgcaatggcatgagccagtgaatgatggaggcaccaaaattattggctaccatcttgaacagaaagaaaagaacagtattttatgggtcaagttaaataagacccccattcaggacaccaaattcaaaacaactgggcttgatgagggccttgagtatgagttcaaagtttctgctgaaaatattgttggcattggcaagcctagcaaagtgtcagaatgctttgttgctcgtgatccatgtgacccacctggtcgccctgaagccattgttattacaagaaacaatgtcacactgaaatggaagaaacctgcctatgatggtggtagcaaaataacaggttatattgtagaaaagaaagatctacctgatggccgctggatgaaagccagctttaccaacgtattagaaactgaatttacagtgagtggacttgtagaagaccaaagatatgaatttagagtaattgcaagaaatgcagctggaaactttagtgaaccatctgatagtagtggtgccattactgcaagagatgaaattgatgcaccaaatgcctctctggatccaaaatataaagatgtcatcgttgttcatgcaggagagacttttgttcttgaagccgacatccgtggcaaacctatacctgatgttgtttggtcaaaagatggaaaagaacttgaagaaacagctgctagaatggaaattaaatctactattcagaaaacaactcttgttgtcaaagactgtatacggactgatggaggacaatatattctgaaactcagcaatgttggtggtacaaagtctatacccatcactgtaaaggtacttgacaggccagggcctcctgaagggcctctgaaagttactggagttactgcggaaaaatgttacctggcatggaacccacctttgcaagatggtggtgctaatatttcacattacatcattgaaaagagggagacaagccgactctcttggacccaggtttcaactgaggtacaggcccttaactacaaagttactaaacttcttcctggtaatgagtacattttccgtgtcatggctgtgaataaatatggaattggagagcccttggaatctgggcctgttacggcctgtaatccttataagccaccaggtcctccctcaacacctgaagtctcagcaatcaccaaagattctatggtagtaacatgggcacgcccagtagacgacggaggtaccgaaattgagggctacattcttgaaaaacgagataaggaaggcgttagatggaccaagtgcaacaagaaaacattaacggatctgcggctcagggtaactggtcttaccgaaggccattcctatgaattcagagttgctgctgaaaatgcagctggtgtgggagaacctagtgagccatctgttttctaccgtgcgtgtgatgccttgtatccaccaggtcccccaagcaatccaaaagtgacggacacttccagatcttctgtctccctggcatggagtaagccaatttatgatggtggcgcacctgttaaaggctatgttgtagaggtcaaagaagctgctgcggatgaatggacaacctgcactccaccaacaggattacaaggaaagcagttcacagtgaccaagcttaaagaaaacactgaatataacttccgtatttgtgccatcaattctgaaggtgtaggtgaacctgcaactctacctggctcagtggttgctcaggagaggatagagccaccagaaatagaactcgatgctgatctcagaaaggtggtcgttctgcgtgcaagtgctactttacgcttatttgtcactatcaaaggtcgaccagaacccgaagttaaatgggaaaaggcagaaggcattctcactgacagggctcagatagaggtgaccagctcatttacaatgttggtgattgataatgttaccagatttgacagtggtcggtataatctgacattagaaaataatagtggctccaaaacagcttttgttaacgtcagagttcttgactcaccaagtgcccctgtgaatttgaccataagagaagtgaagaaagactcagtgacgttgtcctgggaaccaccacttattgatggtggagctaagattacaaactacattgtcgaaaaacgagaaactacaagaaaagcctatgctaccattacaaataattgcactaaaactactttcagaattgaaaatctacaagaaggatgttcttactacttccgagtcttggcttccaatgaatatgggattggtttgccagctgaaacaacagaacccgttaaagtgtctgaaccacccctcccacctggaagagtaactcttgttgatgtgacccgtaatacagctacaattaagtgggagaaaccagaaagtgatggtggcagcaaaattactggttatgtggttgaaatgcagactaaagggagtgaaaagtggagcacctgcacacaagttaagactctagaagcaactatatctggcttaactgcaggagaagagtatgtcttcagggtagctgcagttaacgaaaagggaagaagtgatccaagacaacttggagtgccagtaattgcaagggatattgaaataaagccttcagttgagcttcctttccatactttcaatgtaaaggctagagaacaacttaagattgatgtgccattcaaaggaagacctcaagctactgtgaactggagaaaagatggtcagactcttaaagagacaactagagtcaatgtttcttcttcaaagactgtaacatcactatctattaaggaagcttcaaaggaagatgttggaacttatgaattatgtgtttcaaacagtgctggatccataacagttcctattactataattgtccttgacagaccaggacctccaggtcctatacgtattgatgaggttagttgtgacagcataaccatttcttggaatcctccagaatatgatggtggctgccaaattagcaattacattgttgaaaagaaagaaaccacctctacaacatggcacatagtttcacaagcagttgcaagaacatccattaaaatagttcgcctgacaacaggaagtgagtatcagttccgtgtttgtgcagaaaaccgctatggaaagagctcctacagtgaatcttcagctgttgttgcagagtatccattcagtcccccaggtcctcctggtactcctaaagttgtgcatgccacaaaatctaccatgcttgtaacctggcaagtgccagttaatgatggaggaagtcgagtaattggctatcatcttgagtataaagaaagaagcagcattctttggtcaaaagcaaataaaatcctcattgctgatactcaaatgaaagtctccggccttgatgaaggactgatgtatgagtatcgtgtatatgctgaaaatattgctggaattggtaaatgcagtaaatcttgtgaaccagtccctgcaagagatccttgtgaccctcctggacaacctgaagtcacaaatatcacaagaaaatcagtgtcacttaaatggtctaaaccacattatgatggtggagctaagatcacaggatacattgttgaacgcagagaactaccagatggccggtggctgaagtgcaattatactaatatacaagaaacatactttgaagtaactgaacttactgaagatcagcgttatgaattccgggtttttgcaaggaatgctgctgactcagttagtgagccatctgaatccactgggcctattatagttaaagatgatgttgagcctccaagagttatgatggatgtcaagttccgagacgttattgttgtcaaagctggagaggtccttaagataaatgcagacattgcagggcgacctctgccagtaatttcctgggccaaggatggtatagaaattgaagaaagagcaagaacagaaatcatctcaacagacaatcatactttgttaacagttaaagactgtataagacgagacactgggcaatatgtactaacactgaagaatgttgccggcactcggtctgtggccgttaattgcaaagtacttgataagcctggtccaccagcaggaccacttgaaataaatggcctcactgctgagaaatgctctctttcctggggacgtccccaagaagatggtggtgcagatatcgactattacatcgtagaaaaacgtgaaacaagccaccttgcatggacaatatgtgaaggagagttacagatgacatcctgtaaagtaaccaagttactcaaaggcaatgaatatatatttagagtaactggtgttaataaatatggtgttggtgagcccctagagagtgtagctataaaggcactagatccatttacagttccaagtccacccacgtctttggaaattacttctgtgaccaaagaatctatgacactttgctggtcaagacccgagagtgatggaggtagtgaaatatctggatatataattgaaaggcgagagaaaaatagcctaagatgggtgcgtgtaaacaaaaaaccagtttatgatctaagagtgaaatcaacaggacttcgggaaggatgtgaatatgaatatcgtgtttatgcagaaaatgctgctggcctaagtcttccaagtgaaacctctcccttaattagggcagaagatccagtgttcctaccatctcctccatccaaacccaaaattgtggactcaggcaagacaactataactattgcctgggttaagccgctgtttgatggtggggccccgataactggatatactgtagaatacaaaaaatctgatgacactgactggaaaacttccattcagagcttacgagggacagaatatacaataagcggactaacaacaggagctgaatatgttttcagagtaaaatctgtcaataaggttggtgctagtgaccccagtgatagctctgaccctcagatagcaaaggaaagagaagaagaacctttatttgatattgacagtgaaatgaggaagaccttgattgtcaaggctggtgcctcatttaccatgactgtgcctttccgaggaagaccagtacccaatgtcttgtggagtaagccagacactgacctccgtactagagcttatgttgataccacagactctcgtacatcactgaccattgaaaatgccaacagaaatgactctggaaagtacacattaacaattcagaatgttttgagtgctgcttcactgaccttagttgtcaaagttttagataccccaggtcctccaaccaacattactgtgcaagatgtaaccaaagagtctgcagtgttatcctgggatgttcctgaaaacgatggtggagcaccagtgaagaattaccacatagaaaaacgtgaggccagcaagaaagcatgggtctctgtgaccaacaactgtaaccgcctctcctacaaagttaccaatttacaagaaggagctatctattacttcagagtctctggagaaaatgagtttggtgttggtataccagctgaaacaaaggaaggagtaaaaataacagaaaaaccaagcccacctgaaaaacttggagtaacaagtatatccaaagacagtgtttccctgacctggctgaagcctgaacatgatggcggaagcagaattgtacactatgtcgttgaagcactagaaaaaggacagaaaaactgggttaaatgtgcagtggcaaagtcaacccatcacgttgtttccggtctgagagagaattctgaatactttttccgagtgtttgctgaaaatcaagctggcctgagtgacccgagagagcttctgcttcctgttcttattaaggagcaactagaaccacctgaaattgatatgaagaatttcccaagtcacactgtatatgttagagctggttcaaaccttaaagttgacattccaatctctggaaaaccacttcccaaagtgaccttatcaagagatggtgtcccccttaaggcaaccatgagatttaataccgaaattactgctgagaacctgaccatcaatctcaaagaaagtgttacagctgacgctgggagatatgaaatcactgctgccaactccagtggtacaaccaaagctttcattaacattgttgtgctagacaggcctggtcctccaactggccctgttgttattagtgatataactgaagaaagtgtgactctcaaatgggagccacctaagtatgacggtggaagtcaagttaccaactacattctactcaaaagagaaacaagtactgcagtgtggactgaagtgtctgcaacagttgcaagaaccatgatgaaagtcatgaaactgaccacaggagaagaataccaattccgcatcaaggcagaaaaccgctttggcatcagtgatcatatagattcagcttgtgtgactgtcaaactaccatacacaacacctggaccaccatctacaccatgggtcactaatgttactcgagaaagcatcactgtgggctggcatgaaccagtgtcaaatggaggcagtgcagtcgtaggctatcacctggaaatgaaagacagaaacagtattttatggcaaaaagccaacaaactggtcatccgcacaactcacttcaaagtcacaacaatcagtgctggacttatttatgaattcagggtgtatgcagaaaatgctgctggagttggaaaacctagccatccttctgaaccagtcttggcaattgatgcttgtgaacccccaagaaatgttcgtatcactgatatttcaaagaactctgtcagcctttcatggcaacaaccagctttcgatggaggtagcaagattacaggctacattgttgagagacgtgaccttccagatggcagatggaccaaggccagcttcaccaatgttactgaaactcaattcatcatctctggcttgactcagaattcccagtatgaattccgtgtctttgctaggaatgctgttggttccattagcaatccatctgaggttgtagggcccattacttgcatcgattcttatggtggtcctgtaattgatttgcctctagaatatacagaagttgtcaaatacagagcaggtacatctgtgaagctcagagctggcatttctggcaaacctgcgcctactattgagtggtataaagatgataaagaattacaaaccaatgcactggtgtgtgttgaaaataccacggacctcgcatctatactcatcaaagatgccgatcgccttaatagtggatgctatgaattaaaactaaggaatgccatgggctcagcctcagccaccatcagagtacagatccttgacaaaccaggcccacctggtggaccaattgaatttaagactgtaactgctgagaagatcacccttctctggcggcctccagctgatgatggtggtgcaaaaatcactcactacattgtggaaaagcgtgagacaagccgcgttgtgtggtctatggtgtctgaacatttggaagagtgcatcattacaaccaccaaaattatcaaaggaaatgaatacatcttccgggtccgagccgtgaacaaatatggaattggcgagccactggaatctgattccgttgtagccaagaacgcatttgttacacctgggccaccaggcataccagaagtgacaaagattaccaagaattcgatgactgttgtatggagcaggccaattgcagatggcggtagtgatataagtggctatttccttgaaaaacgagacaagaagagcctaggatggtttaaagtactaaaagagactatccgtgacaccagacaaaaagtaacaggactcacagaaaacagtgactatcaatacagagtttgtgctgtaaacgctgctggacagggtccattttctgaaccatctgaattctacaaagctgctgatcctattgatcctccaggtccacctgctaagataagaatcgcagattcaaccaagtcatccatcacccttggctggagtaagcctgtctatgatgggggcagtgctgttactgggtatgttgtcgagataagacaaggagaggaagaggaatggactactgtctctaccaaaggagaggtcagaactacagaatatgtggtatccaacctgaaacctggagtcaattactacttccgggtatctgctgtaaactgtgctggacaaggagaacctatagaaatgaatgaacctgtacaagctaaagatatacttgaggcaccagagattgacctggatgtggctctcagaacttctgttattgccaaagctggtgaagatgtacaagtgttgattccctttaaaggcagacctccacctactgtcacatggagaaaagatgagaagaatcttggcagtgatgccagatacagcattgaaaacactgattcatcctcattactcaccattcctcaagttactcgcaatgatacaggaaaatatattctcacaatagaaaatggagttggtgaacctaagtcttcaactgtgagtgttaaagtgcttgacacaccagctgcctgccagaaactacaggttaaacatgtttctcgaggcacagtcactttgctctgggatcctcctctcattgatggaggatctccaataattaattatgtcattgaaaagagagatgccaccaagagaacatggtctgtcgtgtcacacaaatgttctagcacatccttcaagctaatagatttgtcggagaagactccattcttcttcagagttcttgcagaaaatgaaattggaattggggaaccctgtgaaactacagagccagtgaaggctgctgaagtaccagctcctatacgtgatctctcaatgaaagactcaacaaagacatctgtcatcctcagctggaccaaacctgactttgatggtggtagcgtcatcacagaatatgttgtagaaaggaaaggtaaaggtgaacagacgtggtcccacgctggcataagtaagacatgtgaaattgaggttagccaacttaaggagcagtcagtcctggagttcagagtgtttgccaaaaatgagaaaggactgagtgatcctgtcactattgggccaattacagtgaaagaacttattattacacctgaagttgacctgtcagatatccctggggcacaagtcactgtgagaattgggcacaatgtgcaccttgaattaccttataagggaaaacccaaaccatccatcagttggctgaaagatggcttgccactgaaagaaagtgaatttgttcgcttcagtaaaactgaaaacaaaattactttgagtattaagaatgccaagaaggagcatggaggaaaatacactgttattcttgataatgcagtgtgtagaattgcagtccccattacagtcatcacccttggcccaccatcaaagcccaaaggacccattcgatttgatgaaatcaaggctgatagtgtcatcctgtcatgggatgtacctgaagataatggaggaggagaaattacttgttacagcatcgagaagcgggaaacttcacaaactaactggaagatggtgtgttcaagtgttgccagaacgactttcaaagttcctaatctagtcaaagatgctgagtaccagtttagagtgagagcagaaaacagatacggagtcagccaaccacttgtctcaagcattattgtggcaaaacaccagttcaggattcctggtcccccaggaaagccagttatatacaatgtgacttctgatggcatgtcactaacttgggatgctccagtttatgatggtggttcagaagttactggattccatgttgaaaagaaagaaagaaatagcatcctctggcaaaaagttaatacatcaccaatctctggaagagaatatagagccactggactggtagaaggtctggattaccaattccgtgtatatgctgaaaattctgctggcctaagctcacctagtgacccaagcaaatttaccttagctgtttctccagtagacccacctggcactcctgactacattgatgtcacccgggaaaccatcacacttaaatggaacccaccattgcgtgatggaggcagtaagattgtgggctatagcattgagaaacggcaaggaaatgaacgctgggtgagatgcaactttactgacgtcagtgaatgtcagtacacagttacaggactcagtcctggggatcgctatgagttcagaataattgcaagaaatgctgttggaactataagcccgccctcacagtcttctggcattattatgacaagagatgaaaatgttccaccaatagtagagtttggccctgaatactttgatggtctcattattaagtccggagagagccttagaattaaagctttggtacaaggaagaccagtgcctcgagtaacttggttcaaagatggagtggaaatcgaaaagaggatgaatatggaaataaccgacgtacttggatccaccagcctatttgttagagatgctactcgggaccatcgtggtgtatacacagtggaagccaaaaatgcatctggttctgcaaaagcagaaattaaagtgaaagtacaagatacaccaggaaaagtagttgggccaataagattcaccaatattactggggagaagatgactctgtggtgggatgccccactcaatgacggttgtgctcccataacccactacatcattgaaaaacgggaaaccagcagacttgcctgggcactaattgaggataaatgtgaagcccaaagttacactgccattaaactaataaacggcaatgaataccaattccgtgtttctgcagttaacaagtttggtgttggcaggccacttgattctgatccagtggttgctcaaatacaatatactgttcctgatgcccctggcattccagaacctagcaacataacaggcaacagcattaccctgacatgggcaaggccagaatcagatggtggcagtgaaattcaacagtatatccttgaaagaagagaaaagaaaagcacaagatgggtaaaagtgatcagcaaacgaccaatctctgaaacaagattcaaagtcactggtctgacagaaggcaatgagtatgaattccatgtcatggctgaaaatgctgcaggagttggacctgcaagtggcatctcaagactcattaaatgtagagagcccgtcaacccaccaggtcctcccacagtggtcaaagtaacagacacatcaaagacaactgtgagcttagaatggtccaaaccagtgtttgatggtggcatggaaataattgggtatattattgaaatgtgtaaggccgacttaggagactggcacaaggtgaatgcagaggcatgtgtgaaaacaagatatacagtcactgatctacaagcaggtgaagaatacaaattccgagttagtgctatcaatggtgctggaaaaggcgacagctgtgaagtgactggcacaattaaagcagttgaccggttaacagctcctgagttagacatagatgcaaacttcaaacagactcatgttgttagagctggggccagtattcgcctcttcattgcctaccaaggtagacctactcctacagctgtgtggagcaaaccagactctaaccttagccttcgggctgatatccatacaacagattccttcagcaccctcactgtggaaaactgcaacagaaatgatgcagggaaatatacccttactgtggaaaacaacagtggtagtaagtcaatcacattcaccgtgaaagtgctagacactccaggcccacctggcccaattaccttcaaagatgtgacccggggatctgctacattgatgtgggatgcccctcttcttgacggtggtgcccgaatccatcattatgtggtagagaaacgagaggcaagtcgccgtagttggcaggttatcagtgaaaaatgcactcgtcagatcttcaaggtcaatgacctggccgaaggtgttccgtactatttccgtgtttctgcagtaaatgagtatggtgttggtgagccctatgaaatgccagaaccaattgtagccacagaacagcctgctccacctaggagacttgatgttgttgatactagcaaatcctccgcagtcttagcttggcttaaacctgaccacgatggaggcagccggatcactggctacctgcttgaaatgagacaaaagggatctgacttctgggttgaagctggtcacaccaaacagctaactttcacagtagagcgtcttgttgagaaaactgaatatgaattccgtgtgaaggccaagaatgatgctggctatagtgaacccagagaagccttctcttctgtcatcattaaggagcctcaaatcgagcccactgctgacctcactggaattaccaatcagcttataacttgcaaagcaggaagcccatttaccattgacgtaccaatcagtggtcgtcctgcccccaaagtaacatggaaactggaagaaatgagacttaaagagacagatcgagtgagcattacaacaacaaaagacagaaccacactgactgtaaaggacagcatgagaggtgactctggaagatacttcttgaccctggaaaatacagctggtgttaaaacatttagcgtcacagttgtggtcattggaaggccaggtccagtaaccggccccattgaggtctcatctgtctcagctgaatcgtgtgtcctgtcatggggagaacctaaagatggaggaggcactgaaattactaattacatagttgaaaagcgtgaatcgggtacaacagcttggcagcttgtcaattccagtgtcaagcgcactcaaattaaagtcactcatctcacaaaatacatggaatattctttccgtgtcagttcagagaacagatttggtgtcagcaaacctctagaatcagcaccaataattgctgaacatccatttgtcccaccaagcgctcctaccagacctgaggtctaccatgtgtctgccaatgccatgtctattcgttgggaagaaccctaccacgatggtggcagtaaaatcattggctactgggttgagaagaaagaacgtaatacaattctttgggtgaaagaaaacaaagtgccatgcttagagtgcaactacaaagtaactggtttagtagaaggactggaatatcagttcagaacttatgcactcaatgctgcaggtgttagcaaggccagcgaagcttcaagacctataatggctcaaaatccagttgatgcaccaggcagaccagaggtgacagatgtcacaagatcaacagtatcactgatttggtctgccccagcgtatgatggaggcagcaaggttgtgggctacatcatagagcgtaagccagtcagtgaggtaggagatggtcgctggctgaagtgcaactacaccattgtatctgacaatttcttcaccgtgactgctctcagtgaaggagacacttatgagttccgtgtgttagccaagaatgcagcaggcgtaattagcaaagggtctgaatctacaggccctgtcacttgccgagatgaatacgctccacccaaagccgaactggatgcccgattacacggtgatctggttaccatcagagcaggttctgatcttgttctggatgctgcagttggtggcaaacctgaacccaaaattatctggaccaaaggagacaaggagctagatctctgtgaaaaagtctctttgcagtatactggcaaacgagcaactgctgtgatcaagttctgtgacagaagtgacagtggaaaatacactttaacagtgaaaaatgccagcgggaccaaggccgtgtctgtcatggtcaaagtgcttgattcccctggcccatgtggaaagctcaccgtcagcagagtaacacaggagaagtgcactttagcctggagccttccgcaggaagacggaggagcagaaatcactcactacatcgtggaaagacgcgagactagcaggctcaactgggtgattgttgaaggcgaatgcccaaccctatcctatgtcgttaccaggctcatcaagaacaatgagtacatattccgagtgagggcagtaaacaaatatggccctggtgtgcctgttgaatcagagccaattgtagccagaaactcattcactattccatcaccacccggcatacctgaagaagttgggactggcaaagagcatatcatcattcagtggacaaaacctgaatctgatggtggcaatgaaatcagcaactacctagtagacaaacgtgagaagaagagcctgcgctggacacgtgtcaacaaagactatgtggtgtatgataccaggctgaaggtgaccagcctgatggagggttgtgattaccagttccgggtgaccgcagtgaatgcagctggtaacagtgagcccagcgaagcttccaacttcatctcatgcagagaaccatcatatacccctggaccaccttctgctccaagagttgtggataccaccaaacacagcattagtttggcatggaccaaacccatgtacgatggtggtactgacattgtaggatatgttctggaaatgcaagagaaggacactgatcagtggtaccgagtgcataccaatgccacaataagaaatactgaattcactgtgccagaccttaaaatgggccagaaatattccttcagagttgctgccgtgaacgtgaagggtatgagcgaatacagcgaatcaattgctgaaattgagcccgtggaaagaatagaaataccagatcttgagcttgcagatgatctaaagaagactgtgaccatcagggctggggcctccttgcgcttgatggtgtctgtatctggaagaccacctcctgtcataacgtggagcaagcagggcattgaccttgcaagccgggcaattattgacaccactgagagctactcattgctaatagtggacaaagttaatcggtacgatgctggaaaatacacaattgaagctgaaaaccaatctggcaagaaatcagcaacagtccttgttaaagtctatgatactcctggtccctgtccttcagtgaaagttaaggaagtatcaagagattctgtgactataacttgggaaattcccacgattgatggtggagctccagtcaacaattacatcgttgagaagcgtgaagctgctatgagagcattcaaaacagtaactaccaaatgcagcaagacactttacagaatttctggacttgtagaaggaaccatgtactatttcagagtgctgccagaaaatatttatggcattggagaaccttgtgaaacatctgatgcagtactggtctcagaagtgcctttggtgcctgcaaagctagaagtggtcgatgtcaccaaatccactgttacccttgcctgggaaaaaccactctacgatggtggtagccgactcactggatatgttctcgaggcctgcaaagctggcacagagagatggatgaaggttgtcaccttaaaacccacagtcctagagcacactgttacttccttaaatgaaggtgaacaatacttatttagaataagggcacaaaatgagaaaggtgtgtcagaaccaagagagactgtcacagccgtgactgtacaagacctcagagtgttgccaacaatcgatctttctacaatgcctcagaagaccatccatgtcccagctggcagaccagtagagctggtgatacctattgctggccgtccacctcctgctgcttcctggttctttgctggttctaaactgagagaatcagagcgtgtcacagttgaaactcacactaaagtagctaaattaaccatccgtgaaaccactatcagagatactggagaatacacacttgaattgaagaatgttaccggaactacttcagaaaccattaaagttatcattcttgacaagcctggtccaccaacaggacctattaagattgatgaaattgatgctacatcaattaccatttcctgggaaccacctgaattggacggtggtgctccactgagtggttatgtggtagaacaacgtgacgctcatcgtccaggatggctgcccgtttctgaatcagtgactaggtccacgtttaagtttaccagactcaccgaaggaaatgagtatgtgttccgtgtggctgcaacaaaccgcttcgggattggctcttacttgcagtctgaggtcatagagtgtcgcagcagcatccgtattcctggacccccagaaacattacagatatttgatgtttcccgtgatggcatgacacttacttggtacccaccagaggatgacggtggctcccaagtgactggatatattgtggagcgcaaagaagtgagagcagatcgatgggtccgtgtaaataaagtacctgtgacaatgacacggtaccgctccactggccttactgaaggcttagaatatgaacaccgtgtcacagccattaatgcaagagggtctgggaaaccaagtcgtccttccaaacccatcgttgccatggatccaattgctcctccaggaaagccacaaaacccaagagttactgatacaacaaggacatcagtctccctggcctggagtgttccagaagatgaaggaggatctaaagtcacaggctacttgattgaaatgcaaaaagtagatcaacatgaatggaccaagtgtaacaccactccaaccaagattcgagagtatactctaacacacctacctcagggtgcagaatacaggttccgcgtcctagcttgtaatgctggtggacctggtgagcctgctgaggtaccaggaacagtcaaagtcactgaaatgcttgaatatcctgattatgaacttgatgaaagataccaagaaggtatctttgtaaggcaaggtggcgtcatcagacttaccataccaatcaaaggaaaaccattcccaatatgtaaatggaccaaggaaggccaggatattagtaagcgtgccatgattgcaacatctgaaacacacactgagcttgtgatcaaagaagcagacaggggtgattctggcacttatgacctggttctggaaaataaatgtggcaagaaggctgtctacatcaaggtcagggtgataggaagtcccaacagtccagaagggccactggaatatgatgacatccaagtccgctctgtgagggtcagctggagacctcctgctgatgatggtggtgctgacatcttaggctacatcctcgagagacgagaagtgcctaaagccgcctggtataccattgattccagagtccgaggtacatctctggtggtaaaaggcctcaaagagaatgtagaataccatttccgtgtttcagcagaaaaccagtttggcataagcaaacccttgaaatctgaggaaccagtcacaccaaaaacaccattgaatcctccagaacctccaagcaatcctccagaagtactcgatgtaaccaagagttctgttagcttgtcctggtcccggcccaaagatgatggtggttctagagtcacaggctactacatcgaacgcaaagagacatccactgacaagtgggtcagacacaacaagactcagatcaccaccacaatgtacactgtcacagggcttgttcccgatgctgagtatcagttccgcatcatcgcacagaatgatgttggcctgagtgagaccagccctgcttctgaaccagttgtttgcaaagatccatttgataaaccaagccaaccaggagaacttgagattctttcaatatccaaagatagtgtcactctacagtgggagaaacctgaatgtgatggtggtaaagaaattcttggatactgggttgaatatagacagtctggagacagtgcctggaagaagagcaataaggaacgtattaaggacaagcaattcacaataggaggtttgctggaagctactgagtatgaattcagggtttttgctgagaatgagactgggctgagcagacctcgcagaactgctatgtctataaagactaaactcacatctggagaggccccaggaatacgcaaagaaatgaaggatgttaccacaaaattgggtgaagctgctcaactctcatgccagattgttggaaggcctcttcctgacattaaatggtacagatttggtaaagagctcatacaaagccggaaatacaaaatgtcttcagatggacgcacacacactcttacagtaatgacagaggaacaggaagatgaaggtgtttatacctgcatagccaccaatgaggttggagaagtagaaaccagtagtaagcttctcctgcaagcaacaccgcagttccatcctggttacccactgaaagagaaatattatggagctgtgggttccacacttcggcttcatgttatgtacattggtcgtccagtacctgccatgacttggttccatggtcagaaacttttgcaaaactcagaaaacattactattgaaaacactgagcactatactcatcttgtcatgaagaatgtccaacgtaagactcatgctgggaaatacaaagtccagctcagcaatgtttttggaacagttgatgccatccttgatgtggaaatacaagataaaccagacaaacctacaggaccaattgtgatcgaagctctattgaagaactccgcagtgatcagctggaaaccacccgcagatgacggaggctcctggatcaccaactatgtggtggaaaaatgtgaggccaaggagggggctgaatggcaattggtgtcttcagccatctcagtgacaacctgtagaattgtgaacctcacagaaaatgctggctattacttccgggtttcagctcagaacactttcggcatcagtgaccctctagaagtgtcctcagttgtgatcattaagagtccatttgaaaagccaggtgctcctggcaaaccaactattactgctgtcacaaaagattcttgtgttgtggcctggaagccacctgccagtgatggaggtgcaaagattagaaattactaccttgagaagcgtgagaagaagcagaataaatggatttctgtgacaacagaagaaattcgagaaactgtcttttcagtgaaaaaccttattgaaggtcttgaatacgagtttcgtgtgaaatgtgaaaatctaggtggggaaagtgaatggagtgaaatatcagaacccatcactcccaaatctgatgtcccaattcaggcaccacactttaaagaggaactgagaaatctaaatgtcagatatcagagcaatgctaccttggtctgcaaagtgactggtcatccaaaacctatcgtcaaatggtacagacaaggcaaagaaatcattgcagatggattaaaatataggattcaagaatttaagggtggctaccaccagctcatcattgcaagtgtcacagatgatgatgccacagtttaccaagtcagagctaccaaccaagggggatctgtgtctggcactgcctccttggaagtggaagttccagctaagatacacttacctaaaactcttgaaggcatgggagcagttcatgctctccgaggtgaagtggtcagcatcaagattcctttcagtggcaaaccagatcctgtgatcacctggcagaaaggacaagatctcattgacaataatggccactaccaagttattgtcacaagatccttcacatcacttgttttccccaatggggtagagagaaaagatgctggtttctatgtggtctgtgctaaaaacagatttggaattgatcagaagacagttgaactggatgtggctgatgttcctgacccacccagaggagtcaaagttagtgatgtctcacgagattctgtcaacttaacatggactgagccagcctctgatggtggcagcaaaatcaccaactacattgttgaaaaatgtgcaactactgcagaaagatggctccgtgtaggacaggcccgagaaacacgttataccgtgatcaacttatttggaaaaacaagttaccagttccgggtaatagctgaaaataaatttggtctgagcaagccttcagagccttcagaaccaaccataaccaaagaagataagaccagagctatgaactatgatgaagaggtagatgaaaccagggaagtctccatgactaaagcatctcactcttcaaccaaggaactctatgagaaatatatgattgctgaagatcttgggcgtggtgagtttggaattgtccatcgttgtgttgaaacatcctcaaagaagacatacatggccaaatttgttaaagtcaaagggactgatcaggttttggtaaagaaggaaatttccattctgaatattgctaggcatagaaacatcttacacctccatgaatcatttgaaagcatggaagaattagttatgatctttgagtttatatcaggacttgacatatttgagcgcattaacacaagtgcttttgaacttaatgaaagagaaattgtaagttatgttcaccaggtctgtgaagcacttcagtttttacacagtcataatattggacactttgacattagaccagaaaatatcatttaccaaaccagaagaagctctaccattaaaatcatagaatttggtcaagcccgtcagctgaaaccaggggacaacttcaggcttctattcactgccccagaatactatgcacctgaagtccaccagcatgatgttgtcagcacagccacagacatgtggtcacttggaacactggtatatgtgctattgagtggtatcaacccattcctggctgaaactaaccaacagatcattgagaatatcatgaatgctgaatatactttcgatgaggaagcattcaaagagattagcattgaagccatggattttgttgaccggttgttagtgaaagagaggaaatctcgcatgacagcatcggaggctctccagcacccatggttgaagcagaagatagaaagagtcagtactaaagttatcagaacattaaaacaccggcgttattaccacaccctgatcaagaaagacctcaacatggttgtgtcagcagcccggatctcctgtggtggtgcaattcgatctcagaagggagtgagtgttgctaaagttaaagtggcatccattgaaattggcccagtttctgggcagataatgcatgcagttggtgaagaaggaggacatgtcaaatatgtatgcaaaattgaaaattatgatcagtctacccaagtgacttggtactttggcgtccgacagctggagaacagtgagaaatacgaaatcacctacgaagatggagtggccatcctctatgtcaaagacattaccaaattagatgatggtacctacagatgcaaagtagtcaatgactatggtgaagacagttcttatgcagagctatttgttaaaggtgtgagagaagtctatgactattactgccgtagaaccatgaagaaaattaagcgcagaacagacacaatgagactcctggaaaggccaccagaatttaccctgcctctctataataagacagcttatgtaggtgaaaatgtccggtttggagtaactataactgtccacccagagcctcatgtaacatggtataaatcaggtcagaaaatcaaaccaggtgacaatgacaagaagtacacatttgagtcagacaagggtctttaccaattaacaatcaacagtgtcactacagatgatgacgctgaatatactgttgtggcaaggaacaaatatggtgaagacagctgtaaagcaaagctgacagtaaccctacacccacctccaacagatagtaccttaagacccatgttcaaaaggttactggcaaatgcagaatgccaagaaggccaaagtgtctgctttgagatcagagtgtctggcatccccccaccaacattaaaatgggagaaagatggtcagccactgtccctcgggcctaacattgaaattatccatgaaggcttggattattatgctctgcacatcagggacactttgcctgaagacacgggttattatagagtcacagccactaacacagctgggtccaccagctgccaggctcacctacaagtggaacgcctgaggtacaagaaacaggaattcaagagtaaggaggagcatgagcgacacgtacaaaaacaaattgacaaaaccctcagaatggctgaaattctttctggaactgaaagtgtaccactgacacaggtagctaaagaggctctgagagaagctgctgtcctttataaaccggctgtaagcaccaagactgtaaaaggggaattcagacttgagatagaagaaaagaaggaggagagaaaactccggatgccttatgatgtaccagagccacgcaagtataagcagactaccatagaagaagaccaacgcatcaagcagttcgtgcccatgtctgacatgaagtggtataaaaagatacgtgatcagtatgaaatgcctgggaaacttgacagagttgtacagaaacgacccaagcgcatccgcctttcaagatgggaacagttctatgtgatgcctcttccacgcattacagatcaatacagacctaaatggcgtattcctaaactgtcccaagatgatcttgagatagtgagaccagcccgccggcgtacaccttctcctgattatgacttttactaccgacctagaagacgttctcttggggacatctctgatgaagaattactcctccccattgatgactacttagcaatgaaaagaacagaggaagagaggctgcgtcttgaagaagagcttgagttaggtttttcagcttcacccccaagtcgaagccctccacactttgagctttctagcctacgttactcttcaccacaagctcatgtcaaggtggaggaaacaagaaaagacttcaggtattcaacctatcacatcccaacgaaggctgaagctagtacaagttatgcagaactgagggaacggcatgcccaggctgcgtacagacagccaaagcaacggcaaagaatcatggctgagagggaggatgaagagttgcttcgcccagttacgaccacccagcatctctcagaatacaaaagcgaacttgacttcatgtcaaaggaggaaaagtctagaaagaaatcaaggcgacaaagagaagtgacagaaataacagaaattgaggaagaatacgaaatctcaaaacatgctcaaagagaatcatcctcatctgcgtctagactactgagacgacggcgctccctgtctccaacttatattgagttaatgaggccagtgtctgagctgatccggtcacgtccacaaccggctgaggaatacgaagatgacacagaaagaaggtcacctactccagagagaactcgcccacgatcccccagccctgtgtctagtgagagatcactctcgagatttgagaggtctgcaagatttgatatcttttccaggtatgagtccatgaaagctgctttaaaaactcagaagacatcagaaaggaagtatgaagttttgagtcagcagcctttcacactggaccatgcccctcgaatcacactgagaatgcgctcgcacagggtaccatgtggccaaaatacacgttttattttaaatgttcagtctaagccaactgccgaggttaaatggtaccacaatggtgtggaactccaagaaagcagtaagattcattacaccaacacgagtggagtcctcaccctggaaattctggactgtcatactgatgacagtggaacctaccgtgctgtgtgcaccaactacaagggcgaagcttctgactatgcaacgttggacgtgacaggaggggattataccacctatgcttcccaacgcagagatgaagaggtccccagatctgttttccctgagctgacaagaacagaggcgtatgctgtttcatcatttaagaaaacatctgagatggaagcttcgtcttctgtcagggaagtgaaatcacagatgacggagacaagggaaagtctctcctcatatgaacactctgcatctgcagaaatgaaaagtgctgcattagaagaaaagtcactggaagaaaaatccacaaccagaaagatcaagacgactttggcagcaagaattctaacaaagccacggtccatgaccgtctacgagggcgagtctgcaaggttttcttgtgacaccgatggtgagccggtaccaactgtgacctggctgcgtaaaggacaagtgctaagtacttctgcccgccaccaagtgaccaccacaaagtacaaatcaacctttgagatctcttcagtccaggcttccgatgagggcaattacagcgtggtggtagaaaacagtgaagggaaacaagaagcagagttcactctgactattcaaaaggccagggtaactgaaaaggctgtgacatcaccaccaagagtcaaatccccagagcctcgggtgaaatccccagaagcagttaagtctccaaaacgagtgaaatctccagaaccttctcacccgaaagccgtatcacccacagagacaaaaccaacaccaacagagaaagttcagcacctcccagtctctgccccaccaaagattactcagttcctgaaagcagaagcttctaaagagattgcaaaactgacctgtgtggttgaaagcagtgtattaagggcaaaagaggtcacctggtataaagatggcaagaaactgaaggaaaatgggcatttccagtttcattattcagcagatggtacctatgagctcaaaatcaataacctcactgaatctgatcaaggagaatatgtttgtgagatttctggtgaaggtggaacgtctaaaaccaacttacaatttatggggcaagcctttaagagtatccatgagaaggtatcaaaaatatcagaaactaagaaatcagatcagaaaaccactgagtcaacagtaaccagaaaaactgaaccaaaagctcctgaaccaatttcctcaaaaccagtaattgttactgggttgcaggatacaactgtttcttcagacagtgttgctaaatttgcagttaaggctactggagaaccccggccaactgccatctggacaaaagatggaaaggccattacacaaggaggtaaatataaactctctgaagacaagggagggttcttcttagaaattcataagactgatacttctgacagtggactttatacttgtacagtaaaaaattcagctggatctgtgtcctctagctgcaaattaacaataaaagctataaaagatactgaggcacagaaagtctctacacaaaagacttctgaaattacacctcagaagaaagctgttgtccaagaggaaatttcccaaaaagccctaaggtctgaagaaattaagatgtcagaggcaaaatctcaagaaaagttagccctcaaagaggaagcttcaaaggttctgatttctgaagaagtcaagaaatcagcagcaacctccctggaaaaatccattgtccatgaggaaatcactaaaacatcacaggcatcagaagaagtcagaactcatgctgagattaaagcattttctactcagatgagcataaacgaaggtcaaagactggttttaaaagccaacattgctggtgccactgatgtgaaatgggtactgaatggcgtagagcttaccaactctgaggagtaccgatatggtgtctcaggcagcgatcagaccctaaccatcaagcaagccagtcacagagatgaaggaatcctcacctgcataagcaaaaccaaggaaggaatcgtcaagtgtcagtatgatttgacactgagcaaagaactctcagatgctccagccttcatctcacagcctagatctcaaaatattaatgaaggacaaaatgttctctttacttgtgaaatcagtggcgagccatcccctgaaatcgaatggtttaaaaacaacctgccaatttctatttcttcaaatgtcagcataagccgctccagaaatgtatactcccttgaaatccgaaatgcatcagtcagcgacagtggaaagtacacaattaaggccaaaaatttccgtggccagtgttcagctacagcttccttaatggtccttcctctagttgaagaaccttccagagaggtagtattgagaacaagtggtgacacaagcttgcaaggaagcttctcgtctcagtcagtccaaatgtctgcctccaagcaggaggcctccttcagcagtttcagcagcagcagtgctagcagcatgactgagatgaaatttgcaagcatgtctgcccaaagcatgtcctccatgcaagagtcctttgtagaaatgagttccagcagctttatgggaatatctaatatgacacaactggaaagctcaactagtaaaatgcttaaagcaggcataagaggaattccgcctaaaattgaagctcttccatctgatatcagcattgatgaaggcaaagttctaacagtagcctgtgctttcacgggtgagcctaccccagaagtaacatggtcctgtggtggaagaaaaatccacagtcaagaacaggggaggttccacattgaaaacacagatgacctgacaaccctgatcatcatggacgtacagaaacaagatggtggactttataccctgagtttagggaatgaatttggatctgactctgccactgtgaatatacatattcgatccatttaagagggcctgtgcccttatactctacactcattcttaacttttcgcaaacgtttcacacggactaatctttctgaactgtaaatatttaaagaaaaaaaagtagttttgtatcaacctaaatgagtcaaagttcaaaaatattcatttcaatcttttcataattgttgacctaagaatataatacatttgctagtgacatgtacatactgtatatagccggattaacggttataaagttttgtaccatttattttatgacattttacaatgtaagttttgaaactaactgttggtaggagaaagtttcttatggaacgaataccctgctcaacatttaatcaatctttgtgcctcaacatactgttgatgtctaagtatgcctcagtgggttgagaaaatccccattgaagatgtcctgtccacctaaaagagaatgatgctgtgcatatcacttgatatgtgcaccaatacctactgaatcagaaatgtaaggcattggtgatgtttgcatttaccctcctgtaagcaacactttaacgtcttacattttctctgatgatgtcacacaaaattatcatgacaaatattaccagagcaaagtgtaacggccaacactttgttcgctcattttacgctgtctctgacataaggagtgcctgaatagcttggaaaagtaacatctcctggccatcccttcatttaaccaagctattcaagtattcctatgccagagcagtgccaactcttggaggtcccagagtgcagccaatgcctttgtgtggtagttctaaattttaattgcacctgaaaaacctgggcacctaagcaatgagccacagcaaaaagtaaagaacaacaacaaaataaagctgttgttaaattttaaacaatattactaattgcccaaaatgtcaatttgatgtagttcttttcatgcaagtataaattcaattgttagttataattgttggacctccttgagatagtaacaacaaaataaagcaagctatctgcacctcaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:7273 -> Molecular function: GO:0002020 [protease binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0003676 [nucleic acid binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IMP
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: ISS
            GeneID:7273 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0043621 [protein self-association] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051015 [actin filament binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051371 [muscle alpha-actinin binding] evidence: IPI
            GeneID:7273 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0002576 [platelet degranulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0003300 [cardiac muscle hypertrophy] evidence: IMP
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: NAS
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0006941 [striated muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0007076 [mitotic chromosome condensation] evidence: IEP
            GeneID:7273 -> Biological process: GO:0007512 [adult heart development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030168 [platelet activation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030240 [skeletal muscle thin filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0030241 [skeletal muscle myosin thick filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0035995 [detection of muscle stretch] evidence: TAS
            GeneID:7273 -> Biological process: GO:0043056 [forward locomotion] evidence: IEA
            GeneID:7273 -> Biological process: GO:0045214 [sarcomere organization] evidence: IMP
            GeneID:7273 -> Biological process: GO:0045859 [regulation of protein kinase activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048739 [cardiac muscle fiber development] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048769 [sarcomerogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0050790 [regulation of catalytic activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0051592 [response to calcium ion] evidence: IDA
            GeneID:7273 -> Biological process: GO:0055003 [cardiac myofibril assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0055008 [cardiac muscle tissue morphogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
            GeneID:7273 -> Cellular component: GO:0000794 [condensed nuclear chromosome] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005865 [striated muscle thin filament] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0030018 [Z disc] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IEA
            GeneID:7273 -> Cellular component: GO:0031674 [I band] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_597681 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.