GGRNA Home | Help | Advanced search

2020-10-26 19:42:48, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_133432              82404 bp    mRNA    linear   PRI 29-APR-2013
DEFINITION  Homo sapiens titin (TTN), transcript variant novex-1, mRNA.
ACCESSION   NM_133432
VERSION     NM_133432.3  GI:291045227
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 82404)
  AUTHORS   LeWinter,M.M. and Granzier,H.L.
  TITLE     Titin is a major human disease gene
  JOURNAL   Circulation 127 (8), 938-944 (2013)
   PUBMED   23439446
  REMARK    GeneRIF: [review] Signal pathways of titin isoforms are described
            in a major human cardiovascular disease.
            Review article
REFERENCE   2  (bases 1 to 82404)
  AUTHORS   Hamdani,N., Krysiak,J., Kreusser,M.M., Neef,S., Dos Remedios,C.G.,
            Maier,L.S., Kruger,M., Backs,J. and Linke,W.A.
  TITLE     Crucial role for Ca2(+)/calmodulin-dependent protein kinase-II in
            regulating diastolic stress of normal and failing hearts via titin
            phosphorylation
  JOURNAL   Circ. Res. 112 (4), 664-674 (2013)
   PUBMED   23283722
  REMARK    GeneRIF: Human end-stage failing hearts revealed higher CaMKII
            expression/activity & phosphorylation at PEVK/titin N2B-unique
            sequence sites than donor hearts. Deranged CaMKII-dependent titin
            phosphorylation contributes to altered diastolic stress.
REFERENCE   3  (bases 1 to 82404)
  AUTHORS   Somkuti,J., Martonfalvi,Z., Kellermayer,M.S. and Smeller,L.
  TITLE     Different pressure-temperature behavior of the structured and
            unstructured regions of titin
  JOURNAL   Biochim. Biophys. Acta 1834 (1), 112-118 (2013)
   PUBMED   23063534
  REMARK    GeneRIF: Different pressure-temperature behavior of the structured
            and unstructured regions of titin.
REFERENCE   4  (bases 1 to 82404)
  AUTHORS   Tskhovrebova,L. and Trinick,J.
  TITLE     Roles of titin in the structure and elasticity of the sarcomere
  JOURNAL   J. Biomed. Biotechnol. 2010, 612482 (2010)
   PUBMED   20625501
  REMARK    GeneRIF: Recent titin data is reviewed and its implications for
            sarcomere architecture and elasticity, are discussed.
            Review article
REFERENCE   5  (bases 1 to 82404)
  AUTHORS   Labeit,S., Lahmers,S., Burkart,C., Fong,C., McNabb,M., Witt,S.,
            Witt,C., Labeit,D. and Granzier,H.
  TITLE     Expression of distinct classes of titin isoforms in striated and
            smooth muscles by alternative splicing, and their conserved
            interaction with filamins
  JOURNAL   J. Mol. Biol. 362 (4), 664-681 (2006)
   PUBMED   16949617
  REMARK    GeneRIF: This suggests that the titin Z2-Zis1 domain can link
            filamins and alpha-actinin together in the periphery of the
            Z-line/dense bodies in a fashion that is conserved in smooth and
            striated muscles.
REFERENCE   6  (bases 1 to 82404)
  AUTHORS   Bang,M.L., Centner,T., Fornoff,F., Geach,A.J., Gotthardt,M.,
            McNabb,M., Witt,C.C., Labeit,D., Gregorio,C.C., Granzier,H. and
            Labeit,S.
  TITLE     The complete gene sequence of titin, expression of an unusual
            approximately 700-kDa titin isoform, and its interaction with
            obscurin identify a novel Z-line to I-band linking system
  JOURNAL   Circ. Res. 89 (11), 1065-1072 (2001)
   PUBMED   11717165
REFERENCE   7  (bases 1 to 82404)
  AUTHORS   Freiburg,A., Trombitas,K., Hell,W., Cazorla,O., Fougerousse,F.,
            Centner,T., Kolmerer,B., Witt,C., Beckmann,J.S., Gregorio,C.C.,
            Granzier,H. and Labeit,S.
  TITLE     Series of exon-skipping events in the elastic spring region of
            titin as the structural basis for myofibrillar elastic diversity
  JOURNAL   Circ. Res. 86 (11), 1114-1121 (2000)
   PUBMED   10850961
REFERENCE   8  (bases 1 to 82404)
  AUTHORS   Labeit,S. and Kolmerer,B.
  TITLE     Titins: giant proteins in charge of muscle ultrastructure and
            elasticity
  JOURNAL   Science 270 (5234), 293-296 (1995)
   PUBMED   7569978
REFERENCE   9  (bases 1 to 82404)
  AUTHORS   Furst,D.O., Vinkemeier,U. and Weber,K.
  TITLE     Mammalian skeletal muscle C-protein: purification from bovine
            muscle, binding to titin and the characterization of a full-length
            human cDNA
  JOURNAL   J. Cell. Sci. 102 (PT 4), 769-778 (1992)
   PUBMED   1429890
REFERENCE   10 (bases 1 to 82404)
  AUTHORS   Labeit,S., Gautel,M., Lakey,A. and Trinick,J.
  TITLE     Towards a molecular understanding of titin
  JOURNAL   EMBO J. 11 (5), 1711-1716 (1992)
   PUBMED   1582406
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC023270.7, AC010680.10,
            FJ695199.1 and AC009948.3.
            On Mar 13, 2010 this sequence version replaced gi:110349712.
            
            Summary: This gene encodes a large abundant protein of striated
            muscle. The product of this gene is divided into two regions, a
            N-terminal I-band and a C-terminal A-band. The I-band, which is the
            elastic part of the molecule, contains two regions of tandem
            immunoglobulin domains on either side of a PEVK region that is rich
            in proline, glutamate, valine and lysine. The A-band, which is
            thought to act as a protein-ruler, contains a mixture of
            immunoglobulin and fibronectin repeats, and possesses kinase
            activity. An N-terminal Z-disc region and a C-terminal M-line
            region bind to the Z-line and M-line of the sarcomere,
            respectively, so that a single titin molecule spans half the length
            of a sarcomere. Titin also contains binding sites for muscle
            associated proteins so it serves as an adhesion template for the
            assembly of contractile machinery in muscle cells. It has also been
            identified as a structural protein for chromosomes. Alternative
            splicing of this gene results in multiple transcript variants.
            Considerable variability exists in the I-band, the M-line and the
            Z-disc regions of titin. Variability in the I-band region
            contributes to the differences in elasticity of different titin
            isoforms and, therefore, to the differences in elasticity of
            different muscle types. Mutations in this gene are associated with
            familial hypertrophic cardiomyopathy 9, and autoantibodies to titin
            are produced in patients with the autoimmune disease scleroderma.
            [provided by RefSeq, Feb 2012].
            
            Transcript Variant: This variant (novex-1) encodes the minor
            cardiac muscle isoform (novex-1 or novex-1/N2B), which is nearly
            identical to the major cardiac isoform N2-B but contains a unique
            stretch of 125 aa in the I-band region. This variant is supported
            by data in PMID:11717165.
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data to make the sequence consistent with the reference genome
            assembly. The genomic coordinates used for the transcript record
            were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-212               AC023270.7         65697-65908         c
            213-316             AC023270.7         63037-63140         c
            317-520             AC023270.7         60623-60826         c
            521-808             AC023270.7         58880-59167         c
            809-894             AC023270.7         58310-58395         c
            895-1139            AC023270.7         57972-58216         c
            1140-1470           AC023270.7         53407-53737         c
            1471-1623           AC023270.7         52884-53036         c
            1624-1761           AC023270.7         51889-52026         c
            1762-1887           AC023270.7         50557-50682         c
            1888-2025           AC023270.7         48463-48600         c
            2026-2163           AC023270.7         47845-47982         c
            2164-2457           AC023270.7         44333-44626         c
            2458-2580           AC023270.7         44105-44227         c
            2581-2862           AC023270.7         42555-42836         c
            2863-2928           AC023270.7         42205-42270         c
            2929-3187           AC023270.7         41291-41549         c
            3188-3251           AC023270.7         41024-41087         c
            3252-3467           AC023270.7         40697-40912         c
            3468-3610           AC023270.7         39606-39748         c
            3611-3816           AC023270.7         38485-38690         c
            3817-4050           AC023270.7         37714-37947         c
            4051-4295           AC023270.7         37359-37603         c
            4296-4567           AC023270.7         36189-36460         c
            4568-4732           AC023270.7         35905-36069         c
            4733-4901           AC023270.7         35634-35802         c
            4902-6595           AC023270.7         33841-35534         c
            6596-6877           AC023270.7         33406-33687         c
            6878-7144           AC023270.7         32692-32958         c
            7145-7417           AC023270.7         32323-32595         c
            7418-7681           AC023270.7         31947-32210         c
            7682-7942           AC023270.7         31594-31854         c
            7943-8203           AC023270.7         29696-29956         c
            8204-8467           AC023270.7         28897-29160         c
            8468-8728           AC023270.7         28545-28805         c
            8729-8989           AC023270.7         28164-28424         c
            8990-9250           AC023270.7         27158-27418         c
            9251-9392           AC023270.7         26499-26640         c
            9393-9558           AC023270.7         26244-26409         c
            9559-9790           AC023270.7         24866-25097         c
            9791-10075          AC023270.7         23012-23296         c
            10076-10201         AC023270.7         22662-22787         c
            10202-10390         AC023270.7         17469-17657         c
            10391-10765         AC023270.7         16027-16401         c
            10766-10822         AC023270.7         11609-11665         c
            10823-11228         AC023270.7         1-406               c
            11229-13603         AC010680.10        173102-175476       c
            13604-13882         AC010680.10        172043-172321       c
            13883-13963         AC010680.10        76198-76278         c
            13964-14038         AC010680.10        75202-75276         c
            14039-14128         AC010680.10        74502-74591         c
            14129-14191         AC010680.10        74009-74071         c
            14192-14281         AC010680.10        73660-73749         c
            14282-14332         AC010680.10        71330-71380         c
            14333-14734         AC010680.10        70359-70760         c
            14735-15013         AC010680.10        69924-70202         c
            15014-15289         AC010680.10        69401-69676         c
            15290-15429         AC010680.10        69126-69265         c
            15430-15556         AC010680.10        68684-68810         c
            15557-15820         AC010680.10        68327-68590         c
            15821-16087         AC010680.10        67778-68044         c
            16088-16351         AC010680.10        67374-67637         c
            16352-16491         AC010680.10        67148-67287         c
            16492-16618         AC010680.10        66879-67005         c
            16619-16885         AC010680.10        66487-66753         c
            16886-17152         AC010680.10        66108-66374         c
            17153-17419         AC010680.10        64995-65261         c
            17420-17559         AC010680.10        64765-64904         c
            17560-17686         AC010680.10        64202-64328         c
            17687-17829         AC010680.10        63262-63404         c
            17830-17953         AC010680.10        59234-59357         c
            17954-18220         AC010680.10        58426-58692         c
            18221-18318         AC010680.10        56631-56728         c
            18319-18487         AC010680.10        55801-55969         c
            18488-18754         AC010680.10        55436-55702         c
            18755-19021         AC010680.10        55063-55329         c
            19022-19300         AC010680.10        54676-54954         c
            19301-19709         AC010680.10        54178-54586         c
            19710-19834         AC010680.10        53949-54073         c
            19835-20101         AC010680.10        53582-53848         c
            20102-20371         AC010680.10        52545-52814         c
            20372-20674         AC010680.10        52150-52452         c
            20675-20977         AC010680.10        51740-52042         c
            20978-21165         AC010680.10        51286-51473         c
            21166-21280         AC010680.10        51081-51195         c
            21281-21565         AC010680.10        50690-50974         c
            21566-21717         AC010680.10        50440-50591         c
            21718-21865         AC010680.10        49602-49749         c
            21866-22043         AC010680.10        49268-49445         c
            22044-22165         AC010680.10        48808-48929         c
            22166-22453         AC010680.10        48427-48714         c
            22454-22750         AC010680.10        48013-48309         c
            22751-22937         AC010680.10        47712-47898         c
            22938-23053         AC010680.10        47122-47237         c
            23054-23353         AC010680.10        46734-47033         c
            23354-23653         AC010680.10        46238-46537         c
            23654-23759         AC010680.10        46018-46123         c
            23760-23956         AC010680.10        45719-45915         c
            23957-24262         AC010680.10        45333-45638         c
            24263-24541         AC010680.10        44954-45232         c
            24542-24841         AC010680.10        44051-44350         c
            24842-25144         AC010680.10        43645-43947         c
            25145-25507         AC010680.10        43169-43531         c
            25508-25810         AC010680.10        42567-42869         c
            25811-26110         AC010680.10        42139-42438         c
            26111-26407         AC010680.10        41746-42042         c
            26408-26692         AC010680.10        41362-41646         c
            26693-26986         AC010680.10        40982-41275         c
            26987-27286         AC010680.10        39375-39674         c
            27287-27595         AC010680.10        38948-39256         c
            27596-27786         AC010680.10        38669-38859         c
            27787-28216         AC010680.10        37837-38266         c
            28217-28525         AC010680.10        36243-36551         c
            28526-28674         AC010680.10        35963-36111         c
            28675-28707         AC010680.10        35843-35875         c
            28708-28837         AC010680.10        35619-35748         c
            28838-29137         AC010680.10        35226-35525         c
            29138-29455         AC010680.10        34815-35132         c
            29456-29752         AC010680.10        33515-33811         c
            29753-30052         AC010680.10        33107-33406         c
            30053-30367         AC010680.10        32709-33023         c
            30368-30516         AC010680.10        32467-32615         c
            30517-30667         AC010680.10        31869-32019         c
            30668-30819         AC010680.10        31629-31780         c
            30820-30949         FJ695199.1         64-193              c
            30950-31252         AC010680.10        29469-29771         c
            31253-31555         AC010680.10        28306-28608         c
            31556-31837         AC010680.10        27923-28204         c
            31838-32137         AC010680.10        27530-27829         c
            32138-32440         AC010680.10        27135-27437         c
            32441-32749         AC010680.10        26737-27045         c
            32750-33031         AC010680.10        26341-26622         c
            33032-33331         AC010680.10        25940-26239         c
            33332-33625         AC010680.10        25561-25854         c
            33626-36592         AC010680.10        22500-25466         c
            36593-36913         AC010680.10        21861-22181         c
            36914-37198         AC010680.10        21478-21762         c
            37199-37498         AC010680.10        21080-21379         c
            37499-37801         AC010680.10        20467-20769         c
            37802-38077         AC010680.10        19034-19309         c
            38078-38377         AC010680.10        18631-18930         c
            38378-38680         AC010680.10        18238-18540         c
            38681-38980         AC010680.10        17569-17868         c
            38981-39268         AC010680.10        16902-17189         c
            39269-39565         AC010680.10        16258-16554         c
            39566-39868         AC010680.10        15868-16170         c
            39869-40174         AC010680.10        15461-15766         c
            40175-40462         AC010680.10        14284-14571         c
            40463-40753         AC010680.10        13901-14191         c
            40754-41041         AC010680.10        13523-13810         c
            41042-41629         AC010680.10        12768-13355         c
            41630-41734         AC010680.10        12573-12677         c
            41735-41932         AC010680.10        11950-12147         c
            41933-42229         AC010680.10        11564-11860         c
            42230-42817         AC010680.10        10885-11472         c
            42818-43120         AC010680.10        10491-10793         c
            43121-53498         AC010680.10        1-10378             c
            53499-60226         AC009948.3         165901-172628       c
            60227-60523         AC009948.3         164931-165227       c
            60524-61111         AC009948.3         164238-164825       c
            61112-61414         AC009948.3         163843-164145       c
            61415-61711         AC009948.3         163438-163734       c
            61712-61999         AC009948.3         161455-161742       c
            62000-62299         AC009948.3         161043-161342       c
            62300-62602         AC009948.3         160504-160806       c
            62603-62908         AC009948.3         160092-160397       c
            62909-64675         AC009948.3         158220-159986       c
            64676-64969         AC009948.3         157557-157850       c
            64970-65257         AC009948.3         156576-156863       c
            65258-65557         AC009948.3         156160-156459       c
            65558-67624         AC009948.3         153997-156063       c
            67625-67927         AC009948.3         153593-153895       c
            67928-68233         AC009948.3         153190-153495       c
            68234-68524         AC009948.3         152802-153092       c
            68525-68821         AC009948.3         152410-152706       c
            68822-69127         AC009948.3         151978-152283       c
            69128-69433         AC009948.3         150791-151096       c
            69434-69715         AC009948.3         150424-150705       c
            69716-70309         AC009948.3         149659-150252       c
            70310-70597         AC009948.3         149252-149539       c
            70598-70897         AC009948.3         148854-149153       c
            70898-71200         AC009948.3         147872-148174       c
            71201-71503         AC009948.3         146658-146960       c
            71504-72088         AC009948.3         145972-146556       c
            72089-72394         AC009948.3         145536-145841       c
            72395-72694         AC009948.3         145130-145429       c
            72695-73270         AC009948.3         143932-144507       c
            73271-73576         AC009948.3         143528-143833       c
            73577-74170         AC009948.3         142572-143165       c
            74171-79779         AC009948.3         136831-142439       c
            79780-79936         AC009948.3         136550-136706       c
            79937-80628         AC009948.3         135118-135809       c
            80629-80782         AC009948.3         134864-135017       c
            80783-81085         AC009948.3         134036-134338       c
            81086-82404         AC009948.3         132579-133897       c
FEATURES             Location/Qualifiers
     source          1..82404
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q31"
     gene            1..82404
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="titin"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
     exon            1..212
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       85
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647840"
     misc_feature    202..204
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="upstream in-frame stop codon"
     exon            213..316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     CDS             226..81381
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /EC_number="2.7.11.1"
                     /note="isoform novex-1 is encoded by transcript variant
                     novex-1; connectin; rhabdomyosarcoma antigen MU-RMS-40.14"
                     /codon_start=1
                     /product="titin isoform novex-1"
                     /protein_id="NP_597676.3"
                     /db_xref="GI:291045228"
                     /db_xref="CCDS:CCDS54423.1"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
                     /translation="
MTTQAPTFTQPLQSVVVLEGSTATFEAHISGFPVPEVSWFRDGQVISTSTLPGVQISFSDGRAKLTIPAVTKANSGRYSLKATNGSGQATSTAELLVKAETAPPNFVQRLQSMTVRQGSQVRLQVRVTGIPTPVVKFYRDGAEIQSSLDFQISQEGDLYSLLIAEAYPEDSGTYSVNATNSVGRATSTAELLVQGEEEVPAKKTKTIVSTAQISESRQTRIEKKIEAHFDARSIATVEMVIDGAAGQQLPHKTPPRIPPKPKSRSPTPPSIAAKAQLARQQSPSPIRHSPSPVRHVRAPTPSPVRSVSPAARISTSPIRSVRSPLLMRKTQASTVATGPEVPPPWKQEGYVASSSEAEMRETTLTTSTQIRTEERWEGRYGVQEQVTISGAAGAAASVSASASYAAEAVATGAKEVKQDADKSAAVATVVAAVDMARVREPVISAVEQTAQRTTTTAVHIQPAQEQVRKEAEKTAVTKVVVAADKAKEQELKSRTKEVITTKQEQMHVTHEQIRKETEKTFVPKVVISAAKAKEQETRISEEITKKQKQVTQEAIMKETRKTVVPKVIVATPKVKEQDLVSRGREGITTKREQVQITQEKMRKEAEKTALSTIAVATAKAKEQETILRTRETMATRQEQIQVTHGKVDVGKKAEAVATVVAAVDQARVREPREPGHLEESYAQQTTLEYGYKERISAAKVAEPPQRPASEPHVVPKAVKPRVIQAPSETHIKTTDQKGMHISSQIKKTTDLTTERLVHVDKRPRTASPHFTVSKISVPKTEHGYEASIAGSAIATLQKELSATSSAQKITKSVKAPTVKPSETRVRAEPTPLPQFPFADTPDTYKSEAGVEVKKEVGVSITGTTVREERFEVLHGREAKVTETARVPAPVEIPVTPPTLVSGLKNVTVIEGESVTLECHISGYPSPTVTWYREDYQIESSIDFQITFQSGIARLMIREAFAEDSGRFTCSAVNEAGTVSTSCYLAVQVSEEFEKETTAVTEKFTTEEKRFVESRDVVMTDTSLTEEQAGPGEPAAPYFITKPVVQKLVEGGSVVFGCQVGGNPKPHVYWKKSGVPLTTGYRYKVSYNKQTGECKLVISMTFADDAGEYTIVVRNKHGETSASASLLEEADYELLMKSQQEMLYQTQVTAFVQEPKVGETAPGFVYSEYEKEYEKEQALIRKKMAKDTVVVRTYVEDQEFHISSFEERLIKEIEYRIIKTTLEELLEEDGEEKMAVDISESEAVESGFDSRIKNYRILEGMGVTFHCKMSGYPLPKIAWYKDGKRIKHGERYQMDFLQDGRASLRIPVVLPEDEGIYTAFASNIKGNAICSGKLYVEPAAPLGAPTYIPTLEPVSRIRSLSPRSVSRSPIRMSPARMSPARMSPARMSPARMSPGRRLEETDESQLERLYKPVFVLKPVSFKCLEGQTARFDLKVVGRPMPETFWFHDGQQIVNDYTHKVVIKEDGTQSLIIVPATPSDSGEWTVVAQNRAGRSSISVILTVEAVEHQVKPMFVEKLKNVNIKEGSRLEMKVRATGNPNPDIVWLKNSDIIVPHKYPKIRIEGTKGEAALKIDSTVSQDSAWYTATAINKAGRDTTRCKVNVEVEFAEPEPERKLIIPRGTYRAKEIAAPELEPLHLRYGQEQWEEGDLYDKEKQQKPFFKKKLTSLRLKRFGPAHFECRLTPIGDPTMVVEWLHDGKPLEAANRLRMINEFGYCSLDYGVAYSRDSGIITCRATNKYGTDHTSATLIVKDEKSLVEESQLPEGRKGLQRIEELERMAHEGALTGVTTDQKEKQKPDIVLYPEPVRVLEGETARFRCRVTGYPQPKVNWYLNGQLIRKSKRFRVRYDGIHYLDIVDCKSYDTGEVKVTAENPEGVIEHKVKLEIQQREDFRSVLRRAPEPRPEFHVHEPGKLQFEVQKVDRPVDTTETKEVVKLKRAERITHEKVPEESEELRSKFKRRTEEGYYEAITAVELKSRKKDESYEELLRKTKDELLHWTKELTEEEKKALAEEGKITIPTFKPDKIELSPSMEAPKIFERIQSQTVGQGSDAHFRVRVVGKPDPECEWYKNGVKIERSDRIYWYWPEDNVCELVIRDVTAEDSASIMVKAINIAGETSSHAFLLVQAKQLITFTQELQDVVAKEKDTMATFECETSEPFVKVKWYKDGMEVHEGDKYRMHSDRKVHFLSILTIDTSDAEDYSCVLVEDENVKTTAKLIVEGAVVEFVKELQDIEVPESYSGELECIVSPENIEGKWYHNDVELKSNGKYTITSRRGRQNLTVKDVTKEDQGEYSFVIDGKKTTCKLKMKPRPIAILQGLSDQKVCEGDIVQLEVKVSLESVEGVWMKDGQEVQPSDRVHIVIDKQSHMLLIEDMTKEDAGNYSFTIPALGLSTSGRVSVYSVDVITPLKDVNVIEGTKAVLECKVSVPDVTSVKWYLNDEQIKPDDRVQAIVKGTKQRLVINRTHASDEGPYKLIVGRVETNCNLSVEKIKIIRGLRDLTCTETQNVVFEVELSHSGIDVLWNFKDKEIKPSSKYKIEAHGKIYKLTVLNMMKDDEGKYTFYAGENMTSGKLTVAGGAISKPLTDQTVAESQEAVFECEVANPDSKGEWLRDGKHLPLTNNIRSESDGHKRRLIIAATKLDDIGEYTYKVATSKTSAKLKVEAVKIKKTLKNLTVTETQDAVFTVELTHPNVKGVQWIKNGVVLESNEKYAISVKGTIYSLRIKNCAIVDESVYGFRLGRLGASARLHVETVKIIKKPKDVTALENATVAFEVSVSHDTVPVKWFHKSVEIKPSDKHRLVSERKVHKLMLQNISPSDAGEYTAVVGQLECKAKLFVETLHITKTMKNIEVPETKTASFECEVSHFNVPSMWLKNGVEIEMSEKFKIVVQGKLHQLIIMNTSTEDSAEYTFVCGNDQVSATLTVTPIMITSMLKDINAEEKDTITFEVTVNYEGISYKWLKNGVEIKSTDKCQMRTKKLTHSLNIRNVHFGDAADYTFVAGKATSTATLYVEARHIEFRKHIKDIKVLEKKRAMFECEVSEPDITVQWMKDDQELQITDRIKIQKEKYVHRLLIPSTRMSDAGKYTVVAGGNVSTAKLFVEGRDVRIRSIKKEVQVIEKQRAVVEFEVNEDDVDAHWYKDGIEINFQVQERHKYVVERRIHRMFISETRQSDAGEYTFVAGRNRSSVTLYVNAPEPPQVLQELQPVTVQSGKPARFCAVISGRPQPKISWYKEEQLLSTGFKCKFLHDGQEYTLLLIEAFPEDAAVYTCEAKNDYGVATTSASLSVEVPEVVSPDQEMPVYPPAIITPLQDTVTSEGQPARFQCRVSGTDLKVSWYSKDKKIKPSRFFRMTQFEDTYQLEIAEAYPEDEGTYTFVASNAVGQVSSTANLSLEGFSKFEENTSNSQWHVSLSVSFKKEPLGQKPSFIQPLSSLRVHNGETVRFHARVSGIPKPEIQWFHNQQLILPTKDVVFHFEESTGMALMLIVDAYSEHAGQYSCKAANSAGEATCAATLTVTPKAPESILHERIEQEIEMEMKEFSSSFLSAEEEGLHSAELQLSKINETLELLSESPVYPTKFDSEKEGTGPIFIKEVSNADISMGDVATLSVTVIGIPKPKIQWFFNGVLLTPSADYKFVFDGDDHSLIILFTKLEDEGEYTCMASNDYGKTICSAYLKINSKGEGHKDTETESAVAKSLEKLGGPCPPHFLKELKPIRCAQGLPAIFEYTVVGEPAPTVTWFKENKQLCTSVYYTIIHNPNGSGTFIVNDPQREDSGLYICKAENMLGESTCAAELLVLLEDTDMTDTPCKAKSTPEAPEDFPQTPLKGPAVEALDSEQEIATFVKDTILKAALITEENQQLSYEHIAKANELSSQLPLGAQELQSILEQDKLTPESTREFLCINGSIHFQPLKEPSPNLQLQIVQSQKTFSKEGILMPEEPETQAVLSDTEKIFPSAMSIEQINSLTVEPLKTLLAEPEGNYPQSSIEPPMHSYLTSVAEEVLSPKEKTVSDTNREQRVTLQKQEAQSALILSQSLAEGHVESLQSPDVMISQVNYEPLVPSEHSCTEGGKILIESANPLENAGQDSAVRIEEGKSLRFPLALEEKQVLLKEEHSDNVVMPPDQIIESKREPVAIKKVQEVQGRDLLSKESLLSGIPEEQRLNLKIQICRALQAAVASEQPGLFSEWLRNIEKVEVEAVNITQEPRHIMCMYLVTSAKSVTEEVTIIIEDVDPQMANLKMELRDALCAIIYEEIDILTAEGPRIQQGAKTSLQEEMDSFSGSQKVEPITEPEVESKYLISTEEVSYFNVQSRVKYLDATPVTKGVASAVVSDEKQDESLKPSEEKEESSSESGTEEVATVKIQEAEGGLIKEDGPMIHTPLVDTVSEEGDIVHLTTSITNAKEVNWYFENKLVPSDEKFKCLQDQNTYTLVIDKVNTEDHQGEYVCEALNDSGKTATSAKLTVVKRAAPVIKRKIEPLEVALGHLAKFTCEIQSAPNVRFQWFKAGREIYESDKCSIRSSKYISSLEILRTQVVDCGEYTCKASNEYGSVSCTATLTVTVPGGEKKVRKLLPERKPEPKEEVVLKSVLRKRPEEEEPKVEPKKLEKVKKPAVPEPPPPKPVEEVEVPTVTKRERKIPEPTKVPEIKPAIPLPAPEPKPKPEAEVKTIKPPPVEPEPTPIAAPVTVPVVGKKAEAKAPKEEAAKPKGPIKGVPKKTPSPIEAERRKLRPGSGGEKPPDEAPFTYQLKAVPLKFVKEIKDIILTESEFVGSSAIFECLVSPSTAITTWMKDGSNIRESPKHRFIADGKDRKLHIIDVQLSDAGEYTCVLRLGNKEKTSTAKLVVEELPVRFVKTLEEEVTVVKGQPLYLSCELNKERDVVWRKDGKIVVEKPGRIVPGVIGLMRALTINDADDTDAGTYTVTVENANNLECSSCVKVVEVIRDWLVKPIRDQHVKPKGTAIFACDIAKDTPNIKWFKGYDEIPAEPNDKTEILRDGNHLYLKIKNAMPEDIAEYAVEIEGKRYPAKLTLGEREVELLKPIEDVTIYEKESASFDAEISEADIPGQWKLKGELLRPSPTCEIKAEGGKRFLTLHKVKLDQAGEVLYQALNAITTAILTVKEIELDFAVPLKDVTVPERRQARFECVLTREANVIWSKGPDIIKSSDKFDIIADGKKHILVINDSQFDDEGVYTAEVEGKKTSARLFVTGIRLKFMSPLEDQTVKEGETATFVCELSHEKMHVVWFKNDAKLHTSRTVLISSEGKTHKLEMKEVTLDDISQIKAQVKELSSTAQLKVLEADPYFTVKLHDKTAVEKDEITLKCEVSKDVPVKWFKDGEEIVPSPKYSIKADGLRRILKIKKADLKDKGEYVCDCGTDKTKANVTVEARLIKVEKPLYGVEVFVGETAHFEIELSEPDVHGQWKLKGQPLTASPDCEIIEDGKKHILILHNCQLGMTGEVSFQAANAKSAANLKVKELPLIFITPLSDVKVFEKDEAKFECEVSREPKTFRWLKGTQEITGDDRFELIKDGTKHSMVIKSAAFEDEAKYMFEAEDKHTSGKLIIEGIRLKFLTPLKDVTAKEKESAVFTVELSHDNIRVKWFKNDQRLHTTRSVSMQDEGKTHSITFKDLSIDDTSQIRVEAMGMSSEAKLTVLEGDPYFTGKLQDYTGVEKDEVILQCEISKADAPVKWFKDGKEIKPSKNAVIKADGKKRMLILKKALKSDIGQYTCDCGTDKTSGKLDIEDREIKLVRPLHSVEVMETETARFETEISEDDIHANWKLKGEALLQTPDCEIKEEGKIHSLVLHNCRLDQTGGVDFQAANVKSSAHLRVKPRVIGLLRPLKDVTVTAGETATFDCELSYEDIPVEWYLKGKKLEPSDKVVPRSEGKVHTLTLRDVKLEDAGEVQLTAKDFKTHANLFVKEPPVEFTKPLEDQTVEEGATAVLECEVSRENAKVKWFKNGTEILKSKKYEIVADGRVRKLVIHDCTPEDIKTYTCDAKDFKTSCNLNVVPPHVEFLRPLTDLQVREKEMARFECELSRENAKVKWFKDGAEIKKGKKYDIISKGAVRILVINKCLLDDEAEYSCEVRTARTSGMLTVLEEEAVFTKNLANIEVSETDTIKLVCEVSKPGAEVIWYKGDEEIIETGRYEILTEGRKRILVIQNAHLEDAGNYNCRLPSSRTDGKVKVHELAAEFISKPQNLEILEGEKAEFVCSISKESFPVQWKRDDKTLESGDKYDVIADGKKRVLVVKDATLQDMGTYVVMVGAARAAAHLTVIEKLRIVVPLKDTRVKEQQEVVFNCEVNTEGAKAKWFRNEEAIFDSSKYIILQKDLVYTLRIRDAHLDDQANYNVSLTNHRGENVKSAANLIVEEEDLRIVEPLKDIETMEKKSVTFWCKVNRLNVTLKWTKNGEEVPFDNRVSYRVDKYKHMLTIKDCGFPDEGEYIVTAGQDKSVAELLIIEAPTEFVEHLEDQTVTEFDDAVFSCQLSREKANVKWYRNGREIKEGKKYKFEKDGSIHRLIIKDCRLDDECEYACGVEDRKSRARLFVEEIPVEIIRPPQDILEAPGADVVFLAELNKDKVEVQWLRNNMVVVQGDKHQMMSEGKIHRLQICDIKPRDQGEYRFIAKDKEARAKLELAAAPKIKTADQDLVVDVGKPLTMVVPYDAYPKAEAEWFKENEPLSTKTIDTTAEQTSFRILEAKKGDKGRYKIVLQNKHGKAEGFINLKVIDVPGPVRNLEVTETFDGEVSLAWEEPLTDGGSKIIGYVVERRDIKRKTWVLATDRAESCEFTVTGLQKGGVEYLFRVSARNRVGTGEPVETDNPVEARSKYDVPGPPLNVTITDVNRFGVSLTWEPPEYDGGAEITNYVIELRDKTSIRWDTAMTVRAEDLSATVTDVVEGQEYSFRVRAQNRIGVGKPSAATPFVKVADPIERPSPPVNLTSSDQTQSSVQLKWEPPLKDGGSPILGYIIERCEEGKDNWIRCNMKLVPELTYKVTGLEKGNKYLYRVSAENKAGVSDPSEILGPLTADDAFVEPTMDLSAFKDGLEVIVPNPITILVPSTGYPRPTATWCFGDKVLETGDRVKMKTLSAYAELVISPSERSDKGIYTLKLENRVKTISGEIDVNVIARPSAPKELKFGDITKDSVHLTWEPPDDDGGSPLTGYVVEKREVSRKTWTKVMDFVTDLEFTVPDLVQGKEYLFKVCARNKCGPGEPAYVDEPVNMSTPATVPDPPENVKWRDRTANSIFLTWDPPKNDGGSRIKGYIVERCPRGSDKWVACGEPVAETKMEVTGLEEGKWYAYRVKALNRQGASKPSRPTEEIQAVDTQEAPEIFLDVKLLAGLTVKAGTKIELPATVTGKPEPKITWTKADMILKQDKRITIENVPKKSTVTIVDSKRSDTGTYIIEAVNVCGRATAVVEVNVLDKPGPPAAFDITDVTNESCLLTWNPPRDDGGSKITNYVVERRATDSEVWHKLSSTVKDTNFKATKLIPNKEYIFRVAAENMYGVGEPVQASPITAKYQFDPPGPPTRLEPSDITKDAVTLTWCEPDDDGGSPITGYWVERLDPDTDKWVRCNKMPVKDTTYRVKGLTNKKKYRFRVLAENLAGPGKPSKSTEPILIKDPIDPPWPPGKPTVKDVGKTSVRLNWTKPEHDGGAKIESYVIEMLKTGTDEWVRVAEGVPTTQHLLPGLMEGQEYSFRVRAVNKAGESEPSEPSDPVLCREKLYPPSPPRWLEVINITKNTADLKWTVPEKDGGSPITNYIVEKRDVRRKGWQTVDTTVKDTKCTVTPLTEGSLYVFRVAAENAIGQSDYTEIEDSVLAKDTFTTPGPPYALAVVDVTKRHVDLKWEPPKNDGGRPIQRYVIEKKERLGTRWVKAGKTAGPDCNFRVTDVIEGTEVQFQVRAENEAGVGHPSEPTEILSIEDPTSPPSPPLDLHVTDAGRKHIAIAWKPPEKNGGSPIIGYHVEMCPVGTEKWMRVNSRPIKDLKFKVEEGVVPDKEYVLRVRAVNAIGVSEPSEISENVVAKDPDCKPTIDLETHDIIVIEGEKLSIPVPFRAVPVPTVSWHKDGKEVKASDRLTMKNDHISAHLEVPKSVRADAGIYTITLENKLGSATASINVKVIGLPGPCKDIKASDITKSSCKLTWEPPEFDGGTPILHYVLERREAGRRTYIPVMSGENKLSWTVKDLIPNGEYFFRVKAVNKVGGGEYIELKNPVIAQDPKQPPDPPVDVEVHNPTAEAMTITWKPPLYDGGSKIMGYIIEKIAKGEERWKRCNEHLVPILTYTAKGLEEGKEYQFRVRAENAAGISEPSRATPPTKAVDPIDAPKVILRTSLEVKRGDEIALDASISGSPYPTITWIKDENVIVPEEIKKRAAPLVRRRKGEVQEEEPFVLPLTQRLSIDNSKKGESQLRVRDSLRPDHGLYMIKVENDHGIAKAPCTVSVLDTPGPPINFVFEDIRKTSVLCKWEPPLDDGGSEIINYTLEKKDKTKPDSEWIVVTSTLRHCKYSVTKLIEGKEYLFRVRAENRFGPGPPCVSKPLVAKDPFGPPDAPDKPIVEDVTSNSMLVKWNEPKDNGSPILGYWLEKREVNSTHWSRVNKSLLNALKANVDGLLEGLTYVFRVCAENAAGPGKFSPPSDPKTAHDPISPPGPPIPRVTDTSSTTIELEWEPPAFNGGGEIVGYFVDKQLVGTNEWSRCTEKMIKVRQYTVKEIREGADYKLRVSAVNAAGEGPPGETQPVTVAEPQEPPAVELDVSVKGGIQIMAGKTLRIPAVVTGRPVPTKVWTKEEGELDKDRVVIDNVGTKSELIIKDALRKDHGRYVITATNSCGSKFAAARVEVFDVPGPVLDLKPVVTNRKMCLLNWSDPEDDGGSEITGFIIERKDAKMHTWRQPIETERSKCDITGLLEGQEYKFRVIAKNKFGCGPPVEIGPILAVDPLGPPTSPERLTYTERTKSTITLDWKEPRSNGGSPIQGYIIEKRRHDKPDFERVNKRLCPTTSFLVENLDEHQMYEFRVKAVNEIGESEPSLPLNVVIQDDEVPPTIKLRLSVRGDTIKVKAGEPVHIPADVTGLPMPKIEWSKNETVIEKPTDALQITKEEVSRSEAKTELSIPKAVREDKGTYTVTASNRLGSVFRNVHVEVYDRPSPPRNLAVTDIKAESCYLTWDAPLDNGGSEITHYVIDKRDASRKKAEWEEVTNTAVEKRYGIWKLIPNGQYEFRVRAVNKYGISDECKSDKVVIQDPYRLPGPPGKPKVLARTKGSMLVSWTPPLDNGGSPITGYWLEKREEGSPYWSRVSRAPITKVGLKGVEFNVPRLLEGVKYQFRAMAINAAGIGPPSEPSDPEVAGDPIFPPGPPSCPEVKDKTKSSISLGWKPPAKDGGSPIKGYIVEMQEEGTTDWKRVNEPDKLITTCECVVPNLKELRKYRFRVKAVNEAGESEPSDTTGEIPATDIQEEPEVFIDIGAQDCLVCKAGSQIRIPAVIKGRPTPKSSWEFDGKAKKAMKDGVHDIPEDAQLETAENSSVIIIPECKRSHTGKYSITAKNKAGQKTANCRVKVMDVPGPPKDLKVSDITRGSCRLSWKMPDDDGGDRIKGYVIEKRTIDGKAWTKVNPDCGSTTFVVPDLLSEQQYFFRVRAENRFGIGPPVETIQRTTARDPIYPPDPPIKLKIGLITKNTVHLSWKPPKNDGGSPVTHYIVECLAWDPTGTKKEAWRQCNKRDVEELQFTVEDLVEGGEYEFRVKAVNAAGVSKPSATVGPVTVKDQTCPPSIDLKEFMEVEEGTNVNIVAKIKGVPFPTLTWFKAPPKKPDNKEPVLYDTHVNKLVVDDTCTLVIPQSRRSDTGLYTITAVNNLGTASKEMRLNVLGRPGPPVGPIKFESVSADQMTLSWFPPKDDGGSKITNYVIEKREANRKTWVHVSSEPKECTYTIPKLLEGHEYVFRIMAQNKYGIGEPLDSEPETARNLFSVPGAPDKPTVSSVTRNSMTVNWEEPEYDGGSPVTGYWLEMKDTTSKRWKRVNRDPIKAMTLGVSYKVTGLIEGSDYQFRVYAINAAGVGPASLPSDPATARDPIAPPGPPFPKVTDWTKSSADLEWSPPLKDGGSKVTGYIVEYKEEGKEEWEKGKDKEVRGTKLVVTGLKEGAFYKFRVRAVNIAGIGEPGEVTDVIEMKDRLVSPDLQLDASVRDRIVVHAGGVIRIIAYVSGKPPPTVTWNMNERTLPQEATIETTAISSSMVIKNCQRSHQGVYSLLAKNEAGERKKTIIVDVLDVPGPVGTPFLAHNLTNESCKLTWFSPEDDGGSPITNYVIEKRESDRRAWTPVTYTVTRQNATVQGLIQGKAYFFRIAAENSIGMGPFVETSEALVIREPITVPERPEDLEVKEVTKNTVTLTWNPPKYDGGSEIINYVLESRLIGTEKFHKVTNDNLLSRKYTVKGLKEGDTYEYRVSAVNIVGQGKPSFCTKPITCKDELAPPTLHLDFRDKLTIRVGEAFALTGRYSGKPKPKVSWFKDEADVLEDDRTHIKTTPATLALEKIKAKRSDSGKYCVVVENSTGSRKGFCQVNVVDRPGPPVGPVSFDEVTKDYMVISWKPPLDDGGSKITNYIIEKKEVGKDVWMPVTSASAKTTCKVSKLLEGKDYIFRIHAENLYGISDPLVSDSMKAKDRFRVPDAPDQPIVTEVTKDSALVTWNKPHDGGKPITNYILEKRETMSKRWARVTKDPIHPYTKFRVPDLLEGCQYEFRVSAENEIGIGDPSPPSKPVFAKDPIAKPSPPVNPEAIDTTCNSVDLTWQPPRHDGGSKILGYIVEYQKVGDEEWRRANHTPESCPETKYKVTGLRDGQTYKFRVLAVNAAGESDPAHVPEPVLVKDRLEPPELILDANMAREQHIKVGDTLRLSAIIKGVPFPKVTWKKEDRDAPTKARIDVTPVGSKLEIRNAAHEDGGIYSLTVENPAGSKTVSVKVLVLDKPGPPRDLEVSEIRKDSCYLTWKEPLDDGGSVITNYVVERRDVASAQWSPLSATSKKKSHFAKHLNEGNQYLFRVAAENQYGRGPFVETPKPIKALDPLHPPGPPKDLHHVDVDKTEVSLVWNKPDRDGGSPITGYLVEYQEEGTQDWIKFKTVTNLECVVTGLQQGKTYRFRVKAENIVGLGLPDTTIPIECQEKLVPPSVELDVKLIEGLVVKAGTTVRFPAIIRGVPVPTAKWTTDGSEIKTDEHYTVETDNFSSVLTIKNCLRRDTGEYQITVSNAAGSKTVAVHLTVLDVPGPPTGPINILDVTPEHMTISWQPPKDDGGSPVINYIVEKQDTRKDTWGVVSSGSSKTKLKIPHLQKGCEYVFRVRAENKIGVGPPLDSTPTVAKHKFSPPSPPGKPVVTDITENAATVSWTLPKSDGGSPITGYYMERREVTGKWVRVNKTPIADLKFRVTGLYEGNTYEFRVFAENLAGLSKPSPSSDPIKACRPIKPPGPPINPKLKDKSRETADLVWTKPLSDGGSPILGYVVECQKPGTAQWNRINKDELIRQCAFRVPGLIEGNEYRFRIKAANIVGEGEPRELAESVIAKDILHPPEVELDVTCRDVITVRVGQTIRILARVKGRPEPDITWTKEGKVLVREKRVDLIQDLPRVELQIKEAVRADHGKYIISAKNSSGHAQGSAIVNVLDRPGPCQNLKVTNVTKENCTISWENPLDNGGSEITNFIVEYRKPNQKGWSIVASDVTKRLIKANLLANNEYYFRVCAENKVGVGPTIETKTPILAINPIDRPGEPENLHIADKGKTFVYLKWRRPDYDGGSPNLSYHVERRLKGSDDWERVHKGSIKETHYMVDRCVENQIYEFRVQTKNEGGESDWVKTEEVVVKEDLQKPVLDLKLSGVLTVKAGDTIRLEAGVRGKPFPEVAWTKDKDATDLTRSPRVKIDTRADSSKFSLTKAKRSDGGKYVVTATNTAGSFVAYATVNVLDKPGPVRNLKIVDVSSDRCTVCWDPPEDDGGCEIQNYILEKCETKRMVWSTYSATVLTPGTTVTRLIEGNEYIFRVRAENKIGTGPPTESKPVIAKTKYDKPGRPDPPEVTKVSKEEMTVVWNPPEYDGGKSITGYFLEKKEKHSTRWVPVNKSAIPERRMKVQNLLPDHEYQFRVKAENEIGIGEPSLPSRPVVAKDPIEPPGPPTNFRVVDTTKHSITLGWGKPVYDGGAPIIGYVVEMRPKIADASPDEGWKRCNAAAQLVRKEFTVTSLDENQEYEFRVCAQNQVGIGRPAELKEAIKPKEILEPPEIDLDASMRKLVIVRAGCPIRLFAIVRGRPAPKVTWRKVGIDNVVRKGQVDLVDTMAFLVIPNSTRDDSGKYSLTLVNPAGEKAVFVNVRVLDTPGPVSDLKVSDVTKTSCHVSWAPPENDGGSQVTHYIVEKREADRKTWSTVTPEVKKTSFHVTNLVPGNEYYFRVTAVNEYGPGVPTDVPKPVLASDPLSEPDPPRKLEVTEMTKNSATLAWLPPLRDGGAKIDGYITSYREEEQPADRWTEYSVVKDLSLVVTGLKEGKKYKFRVAARNAVGVSLPREAEGVYEAKEQLLPPKILMPEQITIKAGKKLRIEAHVYGKPHPTCKWKKGEDEVVTSSHLAVHKADSSSILIIKDVTRKDSGYYSLTAENSSGTDTQKIKVVVMDAPGPPQPPFDISDIDADACSLSWHIPLEDGGSNITNYIVEKCDVSRGDWVTALASVTKTSCRVGKLIPGQEYIFRVRAENRFGISEPLTSPKMVAQFPFGVPSEPKNARVTKVNKDCIFVAWDRPDSDGGSPIIGYLIERKERNSLLWVKANDTLVRSTEYPCAGLVEGLEYSFRIYALNKAGSSPPSKPTEYVTARMPVDPPGKPEVIDVTKSTVSLIWARPKHDGGSKIIGYFVEACKLPGDKWVRCNTAPHQIPQEEYTATGLEEKAQYQFRAIARTAVNISPPSEPSDPVTILAENVPPRIDLSVAMKSLLTVKAGTNVCLDATVFGKPMPTVSWKKDGTLLKPAEGIKMAMQRNLCTLELFSVNRKDSGDYTITAENSSGSKSATIKLKVLDKPGPPASVKINKMYSDRAMLSWEPPLEDGGSEITNYIVDKRETSRPNWAQVSATVPITSCSVEKLIEGHEYQFRICAENKYGVGDPVFTEPAIAKNPYDPPGRCDPPVISNITKDHMTVSWKPPADDGGSPITGYLLEKRETQAVNWTKVNRKPIIERTLKATGLQEGTEYEFRVTAINKAGPGKPSDASKAAYARDPQYPPGPPAFPKVYDTTRSSVSLSWGKPAYDGGSPIIGYLVEVKRADSDNWVRCNLPQNLQKTRFEVTGLMEDTQYQFRVYAVNKIGYSDPSDVPDKHYPKDILIPPEGELDADLRKTLILRAGVTMRLYVPVKGRPPPKITWSKPNVNLRDRIGLDIKSTDFDTFLRCENVNKYDAGKYILTLENSCGKKEYTIVVKVLDTPGPPVNVTVKEISKDSAYVTWEPPIIDGGSPIINYVVQKRDAERKSWSTVTTECSKTSFRVANLEEGKSYFFRVFAENEYGIGDPGETRDAVKASQTPGPVVDLKVRSVSKSSCSIGWKKPHSDGGSRIIGYVVDFLTEENKWQRVMKSLSLQYSAKDLTEGKEYTFRVSAENENGEGTPSEITVVARDDVVAPDLDLKGLPDLCYLAKENSNFRLKIPIKGKPAPSVSWKKGEDPLATDTRVSVESSAVNTTLIVYDCQKSDAGKYTITLKNVAGTKEGTISIKVVGKPGIPTGPIKFDEVTAEAMTLKWAPPKDDGGSEITNYILEKRDSVNNKWVTCASAVQKTTFRVTRLHEGMEYTFRVSAENKYGVGEGLKSEPIVARHPFDVPDAPPPPNIVDVRHDSVSLTWTDPKKTGGSPITGYHLEFKERNSLLWKRANKTPIRMRDFKVTGLTEGLEYEFRVMAINLAGVGKPSLPSEPVVALDPIDPPGKPEVINITRNSVTLIWTEPKYDGGHKLTGYIVEKRDLPSKSWMKANHVNVPECAFTVTDLVEGGKYEFRIRAKNTAGAISAPSESTETIICKDEYEAPTIVLDPTIKDGLTIKAGDTIVLNAISILGKPLPKSSWSKAGKDIRPSDITQITSTPTSSMLTIKYATRKDAGEYTITATNPFGTKVEHVKVTVLDVPGPPGPVEISNVSAEKATLTWTPPLEDGGSPIKSYILEKRETSRLLWTVVSEDIQSCRHVATKLIQGNEYIFRVSAVNHYGKGEPVQSEPVKMVDRFGPPGPPEKPEVSNVTKNTATVSWKRPVDDGGSEITGYHVERREKKSLRWVRAIKTPVSDLRCKVTGLQEGSTYEFRVSAENRAGIGPPSEASDSVLMKDAAYPPGPPSNPHVTDTTKKSASLAWGKPHYDGGLEITGYVVEHQKVGDEAWIKDTTGTALRITQFVVPDLQTKEKYNFRISAINDAGVGEPAVIPDVEIVEREMAPDFELDAELRRTLVVRAGLSIRIFVPIKGRPAPEVTWTKDNINLKNRANIENTESFTLLIIPECNRYDTGKFVMTIENPAGKKSGFVNVRVLDTPGPVLNLRPTDITKDSVTLHWDLPLIDGGSRITNYIVEKREATRKSYSTATTKCHKCTYKVTGLSEGCEYFFRVMAENEYGIGEPTETTEPVKASEAPSPPDSLNIMDITKSTVSLAWPKPKHDGGSKITGYVIEAQRKGSDQWTHITTVKGLECVVRNLTEGEEYTFQVMAVNSAGRSAPRESRPVIVKEQTMLPELDLRGIYQKLVIAKAGDNIKVEIPVLGRPKPTVTWKKGDQILKQTQRVNFETTATSTILNINECVRSDSGPYPLTARNIVGEVGDVITIQVHDIPGPPTGPIKFDEVSSDFVTFSWDPPENDGGVPISNYVVEMRQTDSTTWVELATTVIRTTYKATRLTTGLEYQFRVKAQNRYGVGPGITSACIVANYPFKVPGPPGTPQVTAVTKDSMTISWHEPLSDGGSPILGYHVERKERNGILWQTVSKALVPGNIFKSSGLTDGIAYEFRVIAENMAGKSKPSKPSEPMLALDPIDPPGKPVPLNITRHTVTLKWAKPEYTGGFKITSYIVEKRDLPNGRWLKANFSNILENEFTVSGLTEDAAYEFRVIAKNAAGAISPPSEPSDAITCRDDVEAPKIKVDVKFKDTVILKAGEAFRLEADVSGRPPPTMEWSKDGKELEGTAKLEIKIADFSTNLVNKDSTRRDSGAYTLTATNPGGFAKHIFNVKVLDRPGPPEGPLAVTEVTSEKCVLSWFPPLDDGGAKIDHYIVQKRETSRLAWTNVASEVQVTKLKVTKLLKGNEYIFRVMAVNKYGVGEPLESEPVLAVNPYGPPDPPKNPEVTTITKDSMVVCWGHPDSDGGSEIINYIVERRDKAGQRWIKCNKKTLTDLRYKVSGLTEGHEYEFRIMAENAAGISAPSPTSPFYKACDTVFKPGPPGNPRVLDTSRSSISIAWNKPIYDGGSEITGYMVEIALPEEDEWQIVTPPAGLKATSYTITGLTENQEYKIRIYAMNSEGLGEPALVPGTPKAEDRMLPPEIELDADLRKVVTIRACCTLRLFVPIKGRPAPEVKWARDHGESLDKASIESTSSYTLLIVGNVNRFDSGKYILTVENSSGSKSAFVNVRVLDTPGPPQDLKVKEVTKTSVTLTWDPPLLDGGSKIKNYIVEKRESTRKAYSTVATNCHKTSWKVDQLQEGCSYYFRVLAENEYGIGLPAETAESVKASERPLPPGKITLMDVTRNSVSLSWEKPEHDGGSRILGYIVEMQTKGSDKWATCATVKVTEATITGLIQGEEYSFRVSAQNEKGISDPRQLSVPVIAKDLVIPPAFKLLFNTFTVLAGEDLKVDVPFIGRPTPAVTWHKDNVPLKQTTRVNAESTENNSLLTIKDACREDVGHYVVKLTNSAGEAIETLNVIVLDKPGPPTGPVKMDEVTADSITLSWGPPKYDGGSSINNYIVEKRDTSTTTWQIVSATVARTTIKACRLKTGCEYQFRIAAENRYGKSTYLNSEPTVAQYPFKVPGPPGTPVVTLSSRDSMEVQWNEPISDGGSRVIGYHLERKERNSILWVKLNKTPIPQTKFKTTGLEEGVEYEFRVSAENIVGIGKPSKVSECYVARDPCDPPGRPEAIIVTRNSVTLQWKKPTYDGGSKITGYIVEKKELPEGRWMKASFTNIIDTHFEVTGLVEDHRYEFRVIARNAAGVFSEPSESTGAITARDEVDPPRISMDPKYKDTIVVHAGESFKVDADIYGKPIPTIQWIKGDQELSNTARLEIKSTDFATSLSVKDAVRVDSGNYILKAKNVAGERSVTVNVKVLDRPGPPEGPVVISGVTAEKCTLAWKPPLQDGGSDIINYIVERRETSRLVWTVVDANVQTLSCKVTKLLEGNEYTFRIMAVNKYGVGEPLESEPVVAKNPFVVPDAPKAPEVTTVTKDSMIVVWERPASDGGSEILGYVLEKRDKEGIRWTRCHKRLIGELRLRVTGLIENHDYEFRVSAENAAGLSEPSPPSAYQKACDPIYKPGPPNNPKVIDITRSSVFLSWSKPIYDGGCEIQGYIVEKCDVSVGEWTMCTPPTGINKTNIEVEKLLEKHEYNFRICAINKAGVGEHADVPGPIIVEEKLEAPDIDLDLELRKIINIRAGGSLRLFVPIKGRPTPEVKWGKVDGEIRDAAIIDVTSSFTSLVLDNVNRYDSGKYTLTLENSSGTKSAFVTVRVLDTPSPPVNLKVTEITKDSVSITWEPPLLDGGSKIKNYIVEKREATRKSYAAVVTNCHKNSWKIDQLQEGCSYYFRVTAENEYGIGLPAQTADPIKVAEVPQPPGKITVDDVTRNSVSLSWTKPEHDGGSKIIQYIVEMQAKHSEKWSECARVKSLQAVITNLTQGEEYLFRVVAVNEKGRSDPRSLAVPIVAKDLVIEPDVKPAFSSYSVQVGQDLKIEVPISGRPKPTITWTKDGLPLKQTTRINVTDSLDLTTLSIKETHKDDGGQYGITVANVVGQKTASIEIVTLDKPDPPKGPVKFDDVSAESITLSWNPPLYTGGCQITNYIVQKRDTTTTVWDVVSATVARTTLKVTKLKTGTEYQFRIFAENRYGQSFALESDPIVAQYPYKEPGPPGTPFATAISKDSMVIQWHEPVNNGGSPVIGYHLERKERNSILWTKVNKTIIHDTQFKAQNLEEGIEYEFRVYAENIVGVGKASKNSECYVARDPCDPPGTPEPIMVKRNEITLQWTKPVYDGGSMITGYIVEKRDLPDGRWMKASFTNVIETQFTVSGLTEDQRYEFRVIAKNAAGAISKPSDSTGPITAKDEVELPRISMDPKFRDTIVVNAGETFRLEADVHGKPLPTIEWLRGDKEIEESARCEIKNTDFKALLIVKDAIRIDGGQYILRASNVAGSKSFPVNVKVLDRPGPPEGPVQVTGVTSEKCSLTWSPPLQDGGSDISHYVVEKRETSRLAWTVVASEVVTNSLKVTKLLEGNEYVFRIMAVNKYGVGEPLESAPVLMKNPFVLPGPPKSLEVTNIAKDSMTVCWNRPDSDGGSEIIGYIVEKRDRSGIRWIKCNKRRITDLRLRVTGLTEDHEYEFRVSAENAAGVGEPSPATVYYKACDPVFKPGPPTNAHIVDTTKNSITLAWGKPIYDGGSEILGYVVEICKADEEEWQIVTPQTGLRVTRFEISKLTEHQEYKIRVCALNKVGLGEATSVPGTVKPEDKLEAPELDLDSELRKGIVVRAGGSARIHIPFKGRPTPEITWSREEGEFTDKVQIEKGVNYTQLSIDNCDRNDAGKYILKLENSSGSKSAFVTVKVLDTPGPPQNLAVKEVRKDSAFLVWEPPIIDGGAKVKNYVIDKRESTRKAYANVSSKCSKTSFKVENLTEGAIYYFRVMAENEFGVGVPVETVDAVKAAEPPSPPGKVTLTDVSQTSASLMWEKPEHDGGSRVLGYVVEMQPKGTEKWSIVAESKVCNAVVTGLSSGQEYQFRVKAYNEKGKSDPRVLGVPVIAKDLTIQPSLKLPFNTYSIQAGEDLKIEIPVIGRPRPNISWVKDGEPLKQTTRVNVEETATSTVLHIKEGNKDDFGKYTVTATNSAGTATENLSVIVLEKPGPPVGPVRFDEVSADFVVISWEPPAYTGGCQISNYIVEKRDTTTTTWHMVSATVARTTIKITKLKTGTEYQFRIFAENRYGKSAPLDSKAVIVQYPFKEPGPPGTPFVTSISKDQMLVQWHEPVNDGGTKIIGYHLEQKEKNSILWVKLNKTPIQDTKFKTTGLDEGLEYEFKVSAENIVGIGKPSKVSECFVARDPCDPPGRPEAIVITRNNVTLKWKKPAYDGGSKITGYIVEKKDLPDGRWMKASFTNVLETEFTVSGLVEDQRYEFRVIARNAAGNFSEPSDSSGAITARDEIDAPNASLDPKYKDVIVVHAGETFVLEADIRGKPIPDVVWSKDGKELEETAARMEIKSTIQKTTLVVKDCIRTDGGQYILKLSNVGGTKSIPITVKVLDRPGPPEGPLKVTGVTAEKCYLAWNPPLQDGGANISHYIIEKRETSRLSWTQVSTEVQALNYKVTKLLPGNEYIFRVMAVNKYGIGEPLESGPVTACNPYKPPGPPSTPEVSAITKDSMVVTWARPVDDGGTEIEGYILEKRDKEGVRWTKCNKKTLTDLRLRVTGLTEGHSYEFRVAAENAAGVGEPSEPSVFYRACDALYPPGPPSNPKVTDTSRSSVSLAWSKPIYDGGAPVKGYVVEVKEAAADEWTTCTPPTGLQGKQFTVTKLKENTEYNFRICAINSEGVGEPATLPGSVVAQERIEPPEIELDADLRKVVVLRASATLRLFVTIKGRPEPEVKWEKAEGILTDRAQIEVTSSFTMLVIDNVTRFDSGRYNLTLENNSGSKTAFVNVRVLDSPSAPVNLTIREVKKDSVTLSWEPPLIDGGAKITNYIVEKRETTRKAYATITNNCTKTTFRIENLQEGCSYYFRVLASNEYGIGLPAETTEPVKVSEPPLPPGRVTLVDVTRNTATIKWEKPESDGGSKITGYVVEMQTKGSEKWSTCTQVKTLEATISGLTAGEEYVFRVAAVNEKGRSDPRQLGVPVIARDIEIKPSVELPFHTFNVKAREQLKIDVPFKGRPQATVNWRKDGQTLKETTRVNVSSSKTVTSLSIKEASKEDVGTYELCVSNSAGSITVPITIIVLDRPGPPGPIRIDEVSCDSITISWNPPEYDGGCQISNYIVEKKETTSTTWHIVSQAVARTSIKIVRLTTGSEYQFRVCAENRYGKSSYSESSAVVAEYPFSPPGPPGTPKVVHATKSTMLVTWQVPVNDGGSRVIGYHLEYKERSSILWSKANKILIADTQMKVSGLDEGLMYEYRVYAENIAGIGKCSKSCEPVPARDPCDPPGQPEVTNITRKSVSLKWSKPHYDGGAKITGYIVERRELPDGRWLKCNYTNIQETYFEVTELTEDQRYEFRVFARNAADSVSEPSESTGPIIVKDDVEPPRVMMDVKFRDVIVVKAGEVLKINADIAGRPLPVISWAKDGIEIEERARTEIISTDNHTLLTVKDCIRRDTGQYVLTLKNVAGTRSVAVNCKVLDKPGPPAGPLEINGLTAEKCSLSWGRPQEDGGADIDYYIVEKRETSHLAWTICEGELQMTSCKVTKLLKGNEYIFRVTGVNKYGVGEPLESVAIKALDPFTVPSPPTSLEITSVTKESMTLCWSRPESDGGSEISGYIIERREKNSLRWVRVNKKPVYDLRVKSTGLREGCEYEYRVYAENAAGLSLPSETSPLIRAEDPVFLPSPPSKPKIVDSGKTTITIAWVKPLFDGGAPITGYTVEYKKSDDTDWKTSIQSLRGTEYTISGLTTGAEYVFRVKSVNKVGASDPSDSSDPQIAKEREEEPLFDIDSEMRKTLIVKAGASFTMTVPFRGRPVPNVLWSKPDTDLRTRAYVDTTDSRTSLTIENANRNDSGKYTLTIQNVLSAASLTLVVKVLDTPGPPTNITVQDVTKESAVLSWDVPENDGGAPVKNYHIEKREASKKAWVSVTNNCNRLSYKVTNLQEGAIYYFRVSGENEFGVGIPAETKEGVKITEKPSPPEKLGVTSISKDSVSLTWLKPEHDGGSRIVHYVVEALEKGQKNWVKCAVAKSTHHVVSGLRENSEYFFRVFAENQAGLSDPRELLLPVLIKEQLEPPEIDMKNFPSHTVYVRAGSNLKVDIPISGKPLPKVTLSRDGVPLKATMRFNTEITAENLTINLKESVTADAGRYEITAANSSGTTKAFINIVVLDRPGPPTGPVVISDITEESVTLKWEPPKYDGGSQVTNYILLKRETSTAVWTEVSATVARTMMKVMKLTTGEEYQFRIKAENRFGISDHIDSACVTVKLPYTTPGPPSTPWVTNVTRESITVGWHEPVSNGGSAVVGYHLEMKDRNSILWQKANKLVIRTTHFKVTTISAGLIYEFRVYAENAAGVGKPSHPSEPVLAIDACEPPRNVRITDISKNSVSLSWQQPAFDGGSKITGYIVERRDLPDGRWTKASFTNVTETQFIISGLTQNSQYEFRVFARNAVGSISNPSEVVGPITCIDSYGGPVIDLPLEYTEVVKYRAGTSVKLRAGISGKPAPTIEWYKDDKELQTNALVCVENTTDLASILIKDADRLNSGCYELKLRNAMGSASATIRVQILDKPGPPGGPIEFKTVTAEKITLLWRPPADDGGAKITHYIVEKRETSRVVWSMVSEHLEECIITTTKIIKGNEYIFRVRAVNKYGIGEPLESDSVVAKNAFVTPGPPGIPEVTKITKNSMTVVWSRPIADGGSDISGYFLEKRDKKSLGWFKVLKETIRDTRQKVTGLTENSDYQYRVCAVNAAGQGPFSEPSEFYKAADPIDPPGPPAKIRIADSTKSSITLGWSKPVYDGGSAVTGYVVEIRQGEEEEWTTVSTKGEVRTTEYVVSNLKPGVNYYFRVSAVNCAGQGEPIEMNEPVQAKDILEAPEIDLDVALRTSVIAKAGEDVQVLIPFKGRPPPTVTWRKDEKNLGSDARYSIENTDSSSLLTIPQVTRNDTGKYILTIENGVGEPKSSTVSVKVLDTPAACQKLQVKHVSRGTVTLLWDPPLIDGGSPIINYVIEKRDATKRTWSVVSHKCSSTSFKLIDLSEKTPFFFRVLAENEIGIGEPCETTEPVKAAEVPAPIRDLSMKDSTKTSVILSWTKPDFDGGSVITEYVVERKGKGEQTWSHAGISKTCEIEVSQLKEQSVLEFRVFAKNEKGLSDPVTIGPITVKELIITPEVDLSDIPGAQVTVRIGHNVHLELPYKGKPKPSISWLKDGLPLKESEFVRFSKTENKITLSIKNAKKEHGGKYTVILDNAVCRIAVPITVITLGPPSKPKGPIRFDEIKADSVILSWDVPEDNGGGEITCYSIEKRETSQTNWKMVCSSVARTTFKVPNLVKDAEYQFRVRAENRYGVSQPLVSSIIVAKHQFRIPGPPGKPVIYNVTSDGMSLTWDAPVYDGGSEVTGFHVEKKERNSILWQKVNTSPISGREYRATGLVEGLDYQFRVYAENSAGLSSPSDPSKFTLAVSPVDPPGTPDYIDVTRETITLKWNPPLRDGGSKIVGYSIEKRQGNERWVRCNFTDVSECQYTVTGLSPGDRYEFRIIARNAVGTISPPSQSSGIIMTRDENVPPIVEFGPEYFDGLIIKSGESLRIKALVQGRPVPRVTWFKDGVEIEKRMNMEITDVLGSTSLFVRDATRDHRGVYTVEAKNASGSAKAEIKVKVQDTPGKVVGPIRFTNITGEKMTLWWDAPLNDGCAPITHYIIEKRETSRLAWALIEDKCEAQSYTAIKLINGNEYQFRVSAVNKFGVGRPLDSDPVVAQIQYTVPDAPGIPEPSNITGNSITLTWARPESDGGSEIQQYILERREKKSTRWVKVISKRPISETRFKVTGLTEGNEYEFHVMAENAAGVGPASGISRLIKCREPVNPPGPPTVVKVTDTSKTTVSLEWSKPVFDGGMEIIGYIIEMCKADLGDWHKVNAEACVKTRYTVTDLQAGEEYKFRVSAINGAGKGDSCEVTGTIKAVDRLTAPELDIDANFKQTHVVRAGASIRLFIAYQGRPTPTAVWSKPDSNLSLRADIHTTDSFSTLTVENCNRNDAGKYTLTVENNSGSKSITFTVKVLDTPGPPGPITFKDVTRGSATLMWDAPLLDGGARIHHYVVEKREASRRSWQVISEKCTRQIFKVNDLAEGVPYYFRVSAVNEYGVGEPYEMPEPIVATEQPAPPRRLDVVDTSKSSAVLAWLKPDHDGGSRITGYLLEMRQKGSDFWVEAGHTKQLTFTVERLVEKTEYEFRVKAKNDAGYSEPREAFSSVIIKEPQIEPTADLTGITNQLITCKAGSPFTIDVPISGRPAPKVTWKLEEMRLKETDRVSITTTKDRTTLTVKDSMRGDSGRYFLTLENTAGVKTFSVTVVVIGRPGPVTGPIEVSSVSAESCVLSWGEPKDGGGTEITNYIVEKRESGTTAWQLVNSSVKRTQIKVTHLTKYMEYSFRVSSENRFGVSKPLESAPIIAEHPFVPPSAPTRPEVYHVSANAMSIRWEEPYHDGGSKIIGYWVEKKERNTILWVKENKVPCLECNYKVTGLVEGLEYQFRTYALNAAGVSKASEASRPIMAQNPVDAPGRPEVTDVTRSTVSLIWSAPAYDGGSKVVGYIIERKPVSEVGDGRWLKCNYTIVSDNFFTVTALSEGDTYEFRVLAKNAAGVISKGSESTGPVTCRDEYAPPKAELDARLHGDLVTIRAGSDLVLDAAVGGKPEPKIIWTKGDKELDLCEKVSLQYTGKRATAVIKFCDRSDSGKYTLTVKNASGTKAVSVMVKVLDSPGPCGKLTVSRVTQEKCTLAWSLPQEDGGAEITHYIVERRETSRLNWVIVEGECPTLSYVVTRLIKNNEYIFRVRAVNKYGPGVPVESEPIVARNSFTIPSPPGIPEEVGTGKEHIIIQWTKPESDGGNEISNYLVDKREKKSLRWTRVNKDYVVYDTRLKVTSLMEGCDYQFRVTAVNAAGNSEPSEASNFISCREPSYTPGPPSAPRVVDTTKHSISLAWTKPMYDGGTDIVGYVLEMQEKDTDQWYRVHTNATIRNTEFTVPDLKMGQKYSFRVAAVNVKGMSEYSESIAEIEPVERIEIPDLELADDLKKTVTIRAGASLRLMVSVSGRPPPVITWSKQGIDLASRAIIDTTESYSLLIVDKVNRYDAGKYTIEAENQSGKKSATVLVKVYDTPGPCPSVKVKEVSRDSVTITWEIPTIDGGAPVNNYIVEKREAAMRAFKTVTTKCSKTLYRISGLVEGTMYYFRVLPENIYGIGEPCETSDAVLVSEVPLVPAKLEVVDVTKSTVTLAWEKPLYDGGSRLTGYVLEACKAGTERWMKVVTLKPTVLEHTVTSLNEGEQYLFRIRAQNEKGVSEPRETVTAVTVQDLRVLPTIDLSTMPQKTIHVPAGRPVELVIPIAGRPPPAASWFFAGSKLRESERVTVETHTKVAKLTIRETTIRDTGEYTLELKNVTGTTSETIKVIILDKPGPPTGPIKIDEIDATSITISWEPPELDGGAPLSGYVVEQRDAHRPGWLPVSESVTRSTFKFTRLTEGNEYVFRVAATNRFGIGSYLQSEVIECRSSIRIPGPPETLQIFDVSRDGMTLTWYPPEDDGGSQVTGYIVERKEVRADRWVRVNKVPVTMTRYRSTGLTEGLEYEHRVTAINARGSGKPSRPSKPIVAMDPIAPPGKPQNPRVTDTTRTSVSLAWSVPEDEGGSKVTGYLIEMQKVDQHEWTKCNTTPTKIREYTLTHLPQGAEYRFRVLACNAGGPGEPAEVPGTVKVTEMLEYPDYELDERYQEGIFVRQGGVIRLTIPIKGKPFPICKWTKEGQDISKRAMIATSETHTELVIKEADRGDSGTYDLVLENKCGKKAVYIKVRVIGSPNSPEGPLEYDDIQVRSVRVSWRPPADDGGADILGYILERREVPKAAWYTIDSRVRGTSLVVKGLKENVEYHFRVSAENQFGISKPLKSEEPVTPKTPLNPPEPPSNPPEVLDVTKSSVSLSWSRPKDDGGSRVTGYYIERKETSTDKWVRHNKTQITTTMYTVTGLVPDAEYQFRIIAQNDVGLSETSPASEPVVCKDPFDKPSQPGELEILSISKDSVTLQWEKPECDGGKEILGYWVEYRQSGDSAWKKSNKERIKDKQFTIGGLLEATEYEFRVFAENETGLSRPRRTAMSIKTKLTSGEAPGIRKEMKDVTTKLGEAAQLSCQIVGRPLPDIKWYRFGKELIQSRKYKMSSDGRTHTLTVMTEEQEDEGVYTCIATNEVGEVETSSKLLLQATPQFHPGYPLKEKYYGAVGSTLRLHVMYIGRPVPAMTWFHGQKLLQNSENITIENTEHYTHLVMKNVQRKTHAGKYKVQLSNVFGTVDAILDVEIQDKPDKPTGPIVIEALLKNSAVISWKPPADDGGSWITNYVVEKCEAKEGAEWQLVSSAISVTTCRIVNLTENAGYYFRVSAQNTFGISDPLEVSSVVIIKSPFEKPGAPGKPTITAVTKDSCVVAWKPPASDGGAKIRNYYLEKREKKQNKWISVTTEEIRETVFSVKNLIEGLEYEFRVKCENLGGESEWSEISEPITPKSDVPIQAPHFKEELRNLNVRYQSNATLVCKVTGHPKPIVKWYRQGKEIIADGLKYRIQEFKGGYHQLIIASVTDDDATVYQVRATNQGGSVSGTASLEVEVPAKIHLPKTLEGMGAVHALRGEVVSIKIPFSGKPDPVITWQKGQDLIDNNGHYQVIVTRSFTSLVFPNGVERKDAGFYVVCAKNRFGIDQKTVELDVADVPDPPRGVKVSDVSRDSVNLTWTEPASDGGSKITNYIVEKCATTAERWLRVGQARETRYTVINLFGKTSYQFRVIAENKFGLSKPSEPSEPTITKEDKTRAMNYDEEVDETREVSMTKASHSSTKELYEKYMIAEDLGRGEFGIVHRCVETSSKKTYMAKFVKVKGTDQVLVKKEISILNIARHRNILHLHESFESMEELVMIFEFISGLDIFERINTSAFELNEREIVSYVHQVCEALQFLHSHNIGHFDIRPENIIYQTRRSSTIKIIEFGQARQLKPGDNFRLLFTAPEYYAPEVHQHDVVSTATDMWSLGTLVYVLLSGINPFLAETNQQIIENIMNAEYTFDEEAFKEISIEAMDFVDRLLVKERKSRMTASEALQHPWLKQKIERVSTKVIRTLKHRRYYHTLIKKDLNMVVSAARISCGGAIRSQKGVSVAKVKVASIEIGPVSGQIMHAVGEEGGHVKYVCKIENYDQSTQVTWYFGVRQLENSEKYEITYEDGVAILYVKDITKLDDGTYRCKVVNDYGEDSSYAELFVKGVREVYDYYCRRTMKKIKRRTDTMRLLERPPEFTLPLYNKTAYVGENVRFGVTITVHPEPHVTWYKSGQKIKPGDNDKKYTFESDKGLYQLTINSVTTDDDAEYTVVARNKYGEDSCKAKLTVTLHPPPTDSTLRPMFKRLLANAECQEGQSVCFEIRVSGIPPPTLKWEKDGQPLSLGPNIEIIHEGLDYYALHIRDTLPEDTGYYRVTATNTAGSTSCQAHLQVERLRYKKQEFKSKEEHERHVQKQIDKTLRMAEILSGTESVPLTQVAKEALREAAVLYKPAVSTKTVKGEFRLEIEEKKEERKLRMPYDVPEPRKYKQTTIEEDQRIKQFVPMSDMKWYKKIRDQYEMPGKLDRVVQKRPKRIRLSRWEQFYVMPLPRITDQYRPKWRIPKLSQDDLEIVRPARRRTPSPDYDFYYRPRRRSLGDISDEELLLPIDDYLAMKRTEEERLRLEEELELGFSASPPSRSPPHFELSSLRYSSPQAHVKVEETRKDFRYSTYHIPTKAEASTSYAELRERHAQAAYRQPKQRQRIMAEREDEELLRPVTTTQHLSEYKSELDFMSKEEKSRKKSRRQREVTEITEIEEEYEISKHAQRESSSSASRLLRRRRSLSPTYIELMRPVSELIRSRPQPAEEYEDDTERRSPTPERTRPRSPSPVSSERSLSRFERSARFDIFSRYESMKAALKTQKTSERKYEVLSQQPFTLDHAPRITLRMRSHRVPCGQNTRFILNVQSKPTAEVKWYHNGVELQESSKIHYTNTSGVLTLEILDCHTDDSGTYRAVCTNYKGEASDYATLDVTGGDYTTYASQRRDEEVPRSVFPELTRTEAYAVSSFKKTSEMEASSSVREVKSQMTETRESLSSYEHSASAEMKSAALEEKSLEEKSTTRKIKTTLAARILTKPRSMTVYEGESARFSCDTDGEPVPTVTWLRKGQVLSTSARHQVTTTKYKSTFEISSVQASDEGNYSVVVENSEGKQEAEFTLTIQKARVTEKAVTSPPRVKSPEPRVKSPEAVKSPKRVKSPEPSHPKAVSPTETKPTPTEKVQHLPVSAPPKITQFLKAEASKEIAKLTCVVESSVLRAKEVTWYKDGKKLKENGHFQFHYSADGTYELKINNLTESDQGEYVCEISGEGGTSKTNLQFMGQAFKSIHEKVSKISETKKSDQKTTESTVTRKTEPKAPEPISSKPVIVTGLQDTTVSSDSVAKFAVKATGEPRPTAIWTKDGKAITQGGKYKLSEDKGGFFLEIHKTDTSDSGLYTCTVKNSAGSVSSSCKLTIKAIKDTEAQKVSTQKTSEITPQKKAVVQEEISQKALRSEEIKMSEAKSQEKLALKEEASKVLISEEVKKSAATSLEKSIVHEEITKTSQASEEVRTHAEIKAFSTQMSINEGQRLVLKANIAGATDVKWVLNGVELTNSEEYRYGVSGSDQTLTIKQASHRDEGILTCISKTKEGIVKCQYDLTLSKELSDAPAFISQPRSQNINEGQNVLFTCEISGEPSPEIEWFKNNLPISISSNVSISRSRNVYSLEIRNASVSDSGKYTIKAKNFRGQCSATASLMVLPLVEEPSREVVLRTSGDTSLQGSFSSQSVQMSASKQEASFSSFSSSSASSMTEMKFASMSAQSMSSMQESFVEMSSSSFMGISNMTQLESSTSKMLKAGIRGIPPKIEALPSDISIDEGKVLTVACAFTGEPTPEVTWSCGGRKIHSQEQGRFHIENTDDLTTLIIMDVQKQDGGLYTLSLGNEFGSDSATVNIHIRSI
"
     misc_feature    241..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    262..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    535..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    556..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    1753..1872
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    1879..2004
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2017..2142
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2914..3183
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    2965..3168
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    3331..3600
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    3382..3597
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    3964..4230
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4009..4215
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    4456..4728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4495..4728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    4753..5028
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4774..5028
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    <5251..5469
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    5608..5874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    5626..5874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    6319..6591
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6370..6579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    6610..6873
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6628..6873
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    6889..7143
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6907..>7095
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    <7249..>7374
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    7426..7677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7441..7677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    7687..7938
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7951..8199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7969..8199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    8209..8463
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8473..8724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8488..8724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    8734..8985
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8752..8988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    8998..9246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9013..9246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    9262..9513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9280..9513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    <9622..9786
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9844..10065
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9871..10062
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    10120..10380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10141..10383
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    10480..10755
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10501..10755
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    10969..11238
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    11020..11229
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    11323..11595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    11389..11586
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    13327..13593
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    <13411..13593
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    13609..13878
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    13660..13869
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14455..14730
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    14515..14721
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14788..14979
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    15046..>15240
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    15307..15552
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15571..15819
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15832..16083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15850..16083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    16096..16347
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16126..16347
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    16363..16614
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16387..16614
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    16648..16872
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    16897..17148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17182..>17376
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    17431..17682
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17704..17949
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17716..17949
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    17965..18216
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17989..18225
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of semaphorin;
                     Region: Ig_Semaphorin_C; cd04979"
                     /db_xref="CDD:143180"
     misc_feature    order(18010..18012,18139..18141)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:143180"
     misc_feature    18292..18450
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    18520..18714
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    18766..19017
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18781..19017
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    19030..19296
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19048..19296
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    19312..19563
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19330..19563
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    19579..19830
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19597..19830
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    19846..>20055
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20128..20367
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20155..20367
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    20377..20643
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(20377..20379,20572..20574,20620..20622)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(20623..20628,20632..20637)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    20680..20958
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(20680..20682,20878..20880,20923..20925)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(20926..20931,20935..20940)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    20983..21264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(20983..20985,21181..21183,21226..21228)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(21229..21234,21238..21243)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    21325..21561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21340..21561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    21571..21828
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(21571..21573,21766..21768,21811..21813)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(21814..21819,21823..21828)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    21871..22140
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(21871..21873,22066..22068,22111..22113)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(22114..22119,22123..22128)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    22207..22449
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    22228..22449
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    22459..22737
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(22459..22461,22654..22656,22699..22701)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(22702..22707,22711..22716)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    22756..23028
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(22756..22758,22954..22956,22999..23001)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23002..23007,23011..23016)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23080..23328
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(23254..23256,23299..23301)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23302..23307,23311..23316)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23359..23628
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(23359..23361,23554..23556,23599..23601)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23602..23607,23611..23616)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23659..23934
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(23659..23661,23857..23859,23902..23904)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(23905..23910,23914..23919)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    23983..24237
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(24163..24165,24208..24210)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(24211..24216,24220..24225)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    24268..24537
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24316..24537
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    24547..24807
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(24547..24549,24742..24744,24787..24789)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(24790..24795,24799..24804)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    24883..25125
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(25045..25047,25090..25092)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(25093..25098,25102..25107)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    25168..25503
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    25204..25503
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    25513..25797
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(25513..25515,25714..25716,25759..25761)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(25762..25767,25771..25776)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    25816..26094
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(25816..25818,26011..26013,26056..26058)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(26059..26064,26068..26073)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    26134..26394
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(26311..26313,26356..26358)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(26359..26364,26368..26373)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    26470..26688
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    26698..26967
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(26698..26700,26890..26892,26935..26937)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(26938..26943,26947..26952)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    26992..27270
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(26992..26994,27190..27192,27235..27237)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(27238..27243,27247..27252)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    27352..27591
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    27601..27882
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(27601..27603,27802..27804,27847..27849)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(27850..27855,27859..27864)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    27904..28191
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(27904..27906,28117..28119,28162..28164)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(28165..28170,28174..28179)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    28222..28497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(28222..28224,28426..28428,28471..28473)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(28474..28479,28483..28488)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    28588..28833
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    28843..29121
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(28843..28845,29038..29040,29083..29085)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(29086..29091,29095..29100)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    29143..29439
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(29143..29145,29356..29358,29401..29403)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(29404..29409,29413..29418)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    29485..29748
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    29758..30039
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(29758..29760,29956..29958,30001..30003)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(30004..30009,30013..30018)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    30058..30351
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(30058..30060,30268..30270,30313..30315)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(30316..30321,30325..30330)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    30370..30648
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(30370..30372,30568..30570,30613..30615)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(30616..30621,30625..30630)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    30730..30945
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    30955..31230
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(30955..30957,31153..31155,31198..31200)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(31201..31206,31210..31215)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    31258..31539
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(31258..31260,31456..31458,31501..31503)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(31504..31509,31513..31518)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    31633..31821
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    31867..32124
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(32041..32043,32086..32088)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(32089..32094,32098..32103)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    32143..32412
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(32143..32145,32341..32343,32386..32388)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(32389..32394,32398..32403)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    32446..32712
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(32446..32448,32650..32652,32695..32697)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(32698..32703,32707..32712)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    32812..33027
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    33037..33300
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(33037..33039,33232..33234,33277..33279)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(33280..33285,33289..33294)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    33337..33606
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(33337..33339,33529..33531,33574..33576)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(33577..33582,33586..33591)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    33667..33909
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    33688..33909
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    33919..34200
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(33919..33921,34117..34119,34162..34164)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(34165..34170,34174..34179)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    34219..34494
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(34219..34221,34414..34416,34459..34461)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(34462..34467,34471..34476)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    34543..34794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(34720..34722,34765..34767)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(34768..34773,34777..34782)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    34882..35103
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    35113..35385
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(35113..35115,35305..35307,35350..35352)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(35353..35358,35362..35367)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    35410..35691
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(35410..35412,35608..35610,35653..35655)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(35656..35661,35665..35670)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    35710..35988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    35761..35988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    35998..36276
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(35998..36000,36193..36195,36238..36240)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(36241..36246,36250..36255)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    36295..36576
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(36295..36297,36493..36495,36538..36540)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(36541..36546,36550..36555)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    36598..36894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(36598..36600,36814..36816,36859..36861)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(36862..36867,36871..36876)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    36976..37194
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    37204..37464
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(37204..37206,37399..37401,37444..37446)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(37447..37452,37456..37461)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    37504..37782
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(37504..37506,37702..37704,37747..37749)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(37750..37755,37759..37764)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    37822..38073
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    37852..38073
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    38083..38349
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(38083..38085,38281..38283,38326..38328)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(38329..38334,38338..38343)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    38383..38664
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(38383..38385,38581..38583,38626..38628)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(38629..38634,38638..38643)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    38680..38964
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(38881..38883,38926..38928)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(38929..38934,38938..38943)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    39022..39264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    39043..39264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    39274..39552
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39274..39276,39469..39471,39514..39516)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(39517..39522,39526..39531)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    39571..39840
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39571..39573,39769..39771,39814..39816)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(39817..39822,39826..39831)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    39874..40140
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39874..39876,40075..40077,40120..40122)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40123..40128,40132..40137)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40210..40458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    40237..40458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    40468..40743
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40468..40470,40663..40665,40708..40710)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40711..40716,40720..40725)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40759..41025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40759..40761,40948..40950,40993..40995)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40996..41001,41005..41010)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41104..41325
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    41335..41616
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(41335..41337,41533..41535,41578..41580)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(41581..41586,41590..41595)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41677..41916
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(41833..41835,41878..41880)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(41881..41886,41890..41895)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41932..42210
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42127..42129,42172..42174)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42178..42183,42187..42192)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42310..42516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    42526..42801
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42526..42528,42721..42723,42766..42768)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42769..42774,42778..42783)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42823..43095
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42823..42825,43021..43023,43066..43068)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43069..43074,43078..43083)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43126..43389
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43126..43128,43327..43329,43372..43374)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43375..43380,43384..43389)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43459..43701
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    43486..43701
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    43711..43980
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43711..43713,43906..43908,43951..43953)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43954..43959,43963..43968)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44002..44277
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44002..44004,44194..44196,44239..44241)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44242..44247,44251..44256)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44353..44577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    44584..44865
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44584..44586,44782..44784,44827..44829)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44830..44835,44839..44844)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44884..45156
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44884..44886,45082..45084,45127..45129)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45130..45135,45139..45144)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45181..45462
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45376..45378,45421..45423)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45427..45432,45436..45441)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45493..45762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    45544..45762
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    45772..46047
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45772..45774,45970..45972,46015..46017)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46018..46023,46027..46032)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46093..46350
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46270..46272,46315..46317)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46318..46323,46327..46332)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46375..46638
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46375..46377,46576..46578,46621..46623)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46624..46629,46633..46638)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46711..46953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    46738..46953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    46963..47232
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46963..46965,47158..47160,47203..47205)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47206..47211,47215..47220)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47254..47505
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47254..47256,47446..47448,47491..47493)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47494..47499,47503..47505)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47551..47820
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    47599..47820
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    47830..48111
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47830..47832,48028..48030,48073..48075)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48076..48081,48085..48090)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48166..48411
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48328..48330,48373..48375)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48376..48381,48385..48390)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48427..48708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48622..48624,48667..48669)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48670..48672,48676..48678,48682..48687)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48766..49008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    48787..49008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    49018..49299
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49018..49020,49216..49218,49261..49263)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49264..49269,49273..49278)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49318..49587
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49318..49320,49516..49518,49561..49563)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49564..49569,49573..49578)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49621..49887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49621..49623,49822..49824,49867..49869)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49870..49875,49879..49884)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49984..50199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    50209..50484
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50209..50211,50404..50406,50449..50451)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50452..50457,50461..50466)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50500..50751
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50500..50502,50692..50694,50737..50739)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50740..50745,50749..50751)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50830..51057
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    50845..51060
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    51076..51357
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51076..51078,51274..51276,51319..51321)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51322..51327,51331..51336)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51376..51657
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51376..51378,51574..51576,51619..51621)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51622..51627,51631..51636)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51673..51954
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51868..51870,51913..51915)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51919..51924,51928..51933)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51994..52254
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    52033..52254
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    52264..52539
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52264..52266,52462..52464,52507..52509)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52510..52515,52519..52524)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52564..52842
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52564..52566,52762..52764,52807..52809)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52810..52815,52819..52824)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52867..53133
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52867..52869,53068..53070,53113..53115)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53116..53121,53125..53130)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53203..53445
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    53236..53445
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    53455..53730
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53455..53457,53650..53652,53695..53697)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53698..53703,53707..53712)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53746..53997
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53746..53748,53938..53940,53983..53985)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53986..53991,53995..53997)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54076..54312
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    54091..54312
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    54322..54603
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54322..54324,54520..54522,54565..54567)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54568..54573,54577..54582)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54622..54897
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54622..54624,54820..54822,54865..54867)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54868..54873,54877..54882)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54919..55200
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55114..55116,55159..55161)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55162..55164,55168..55170,55174..55179)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55279..55503
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    55513..55794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55513..55515,55711..55713,55756..55758)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55759..55764,55768..55773)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55813..56091
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55813..55815,56011..56013,56056..56058)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56059..56064,56068..56073)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56116..56382
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56116..56118,56317..56319,56362..56364)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56365..56370,56374..56379)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56452..56694
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    56479..56694
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    56704..56973
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56704..56706,56899..56901,56944..56946)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56947..56952,56956..56961)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56995..57246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56995..56997,57187..57189,57232..57234)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(57235..57240,57244..57246)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    57292..57561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    57340..57561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    57571..57816
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57571..57573,57766..57768,57811..57813)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    57889..58140
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58066..58068,58111..58113)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58114..58119,58123..58128)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58165..58434
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58360..58362,58408..58410)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58411..58416,58420..58425)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58525..58746
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    58756..59037
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58756..58758,58954..58956,58999..59001)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59002..59007,59011..59016)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59056..59334
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59056..59058,59254..59256,59299..59301)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59302..59307,59311..59316)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59359..59634
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59359..59361,59554..59556,59599..59601)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59602..59607,59611..59616)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59689..59931
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    59716..59931
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    59941..60216
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59941..59943,60136..60138,60181..60183)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60184..60189,60193..60198)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60232..60483
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60232..60234,60424..60426,60469..60471)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60472..60477,60481..60483)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60553..60807
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    60586..60807
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    60817..61098
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60817..60819,61015..61017,61060..61062)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61063..61068,61072..61077)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61117..61389
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61117..61119,61315..61317,61360..61362)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61363..61368,61372..61377)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61414..61695
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61609..61611,61654..61656)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61660..61665,61669..61674)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61717..61995
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    61774..61995
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    62005..62286
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62005..62007,62203..62205,62248..62250)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62251..62256,62260..62265)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62305..62583
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62305..62307,62503..62505,62548..62550)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62551..62556,62560..62565)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62629..62874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62809..62811,62854..62856)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62857..62862,62866..62871)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62944..63195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    62971..63195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    63205..63474
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63205..63207,63400..63402,63445..63447)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63448..63453,63457..63462)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63496..63771
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63496..63498,63688..63690,63733..63735)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63736..63741,63745..63750)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63847..64029
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    64078..64359
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64078..64080,64276..64278,64321..64323)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64324..64329,64333..64338)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64378..64656
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64378..64380,64576..64578,64621..64623)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64624..64629,64633..64638)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64675..64950
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64867..64869,64912..64914)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64915..64917,64921..64923,64927..64932)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65032..65253
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    65284..65544
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65461..65463,65506..65508)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65509..65514,65518..65523)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65563..65826
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65563..65565,65764..65766,65809..65811)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65812..65817,65821..65826)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65869..66138
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65869..65871,66067..66069,66112..66114)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66115..66120,66124..66129)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66229..66444
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    66454..66708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66454..66456,66649..66651,66694..66696)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66697..66702,66706..66708)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66745..67011
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66745..66747,66937..66939,66982..66984)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66985..66990,66994..66999)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67099..67320
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    67330..67611
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67330..67332,67528..67530,67573..67575)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67576..67581,67585..67590)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67630..67908
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67630..67632,67828..67830,67873..67875)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67876..67881,67885..67890)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67927..68217
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68131..68133,68176..68178)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68179..68181,68185..68187,68191..68196)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68299..68520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    68530..68808
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68530..68532,68725..68727,68770..68772)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68773..68778,68782..68787)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68827..69111
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68827..68829,69028..69030,69073..69075)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69076..69081,69085..69090)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69133..69405
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69133..69135,69334..69336,69379..69381)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69382..69387,69391..69396)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69469..69711
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    69496..69711
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    69721..69996
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69721..69723,69916..69918,69961..69963)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69964..69969,69973..69978)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70012..70293
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70012..70014,70210..70212,70255..70257)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70258..70263,70267..70272)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70345..70593
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    70372..70593
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    70603..70878
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70603..70605,70801..70803,70846..70848)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70849..70854,70858..70863)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70903..71172
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70903..70905,71101..71103,71146..71148)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71149..71154,71158..71163)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71206..71442
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71206..71208,71404..71406)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    71566..71781
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    71791..72063
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71791..71793,71989..71991,72034..72036)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72037..72042,72046..72051)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72127..72378
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72295..72297,72340..72342)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72343..72348,72352..72357)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72400..72657
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72400..72402,72598..72600,72643..72645)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72646..72651,72655..72657)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72706..72969
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    72757..72960
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    73042..73260
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    73276..73557
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(73276..73278,73477..73479,73522..73524)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73525..73530,73534..73539)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73582..73863
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(73582..73584,73780..73782,73825..73827)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73828..73833,73837..73842)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73891..74166
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    73942..74157
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    74239..74463
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    74473..74745
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(74473..74475,74665..74667,74710..74712)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(74713..74718,74722..74727)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    74860..75624
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    74878..75618
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Catalytic domain of Protein Kinases; Region: PKc;
                     cd00180"
                     /db_xref="CDD:173623"
     misc_feature    order(74878..74892,74902..74904,74941..74943,74947..74949,
                     75031..75033,75079..75090,75100..75102,75106..75108,
                     75220..75222,75226..75228,75232..75237,75241..75243,
                     75280..75282,75289..75291,75334..75345)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="active site"
                     /db_xref="CDD:173623"
     misc_feature    order(74878..74892,74902..74904,74941..74943,74947..74949,
                     75031..75033,75079..75090,75100..75102,75220..75222,
                     75226..75228,75232..75237,75241..75243,75280..75282)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173623"
     misc_feature    order(74890..74892,75100..75102,75106..75108,75220..75222,
                     75226..75228,75232..75234,75289..75291,75334..75345)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173623"
     misc_feature    order(75277..75297,75334..75345)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173623"
     misc_feature    75862..76074
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    76177..76455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    76201..76455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    76492..76764
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    76528..76764
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    78229..78498
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    78250..78498
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    78781..79056
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="M5, fifth immunoglobulin (Ig)-like domain of human
                     titin C terminus and similar proteins; Region:
                     Ig5_Titin_like; cd05747"
                     /db_xref="CDD:143224"
     misc_feature    78793..79059
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    79261..79515
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    79306..79524
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    79663..79932
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    79684..79932
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    80242..80484
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    80509..80778
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    80527..80778
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    81094..81369
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    81163..81369
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     exon            317..520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       381
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647842"
     exon            521..808
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       767
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647843"
     exon            809..894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647844"
     exon            895..1139
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1140..1470
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647845"
     variation       1228
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647846"
     exon            1471..1623
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1624..1761
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1672
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34337578"
     variation       1717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647851"
     exon            1762..1887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1888..2025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2026..2163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2160
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72647860"
     exon            2164..2457
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2458..2580
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2519
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35813871"
     exon            2581..2862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2698
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647861"
     variation       2851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647862"
     exon            2863..2928
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2929..3187
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2945
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647865"
     exon            3188..3251
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647867"
     variation       3220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647868"
     exon            3252..3467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             3399..3542
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1574E"
                     /db_xref="UniSTS:150658"
     exon            3468..3610
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3496
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647870"
     exon            3611..3816
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            3817..4050
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3846
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2291308"
     variation       3971
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1552280"
     exon            4051..4295
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4071
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72647872"
     exon            4296..4567
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647875"
     variation       4409
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647876"
     exon            4568..4732
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             4622..4728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="A008T22"
                     /db_xref="UniSTS:24210"
     variation       4717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647877"
     exon            4733..4901
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            4902..6595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       5475
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647878"
     STS             6193..6321
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1524E"
                     /db_xref="UniSTS:45880"
     variation       6335
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:72647879"
     exon            6596..6877
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       6747
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647880"
     variation       6860
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647881"
     exon            6878..7144
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7145..7417
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7418..7681
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7682..7942
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7943..8203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8204..8467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8468..8728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8676
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647883"
     exon            8729..8989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8774
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647884"
     exon            8990..9250
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647885"
     variation       9237
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647886"
     exon            9251..9392
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9393..9558
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9446
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647894"
     exon            9559..9790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9791..10075
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10076..10201
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10202..10390
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10391..10765
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10766..10822
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10823..13603
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       10881
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648918"
     variation       11486
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648919"
     variation       11766
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742357"
     variation       11927
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648920"
     variation       12069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648921"
     variation       12291
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:746578"
     variation       12729
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1883084"
     variation       12773
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648922"
     variation       13311
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:1883085"
     exon            13604..13882
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13883..13963
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13964..14038
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14039..14128
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14129..14191
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14192..14281
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14282..14332
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14333..14734
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       14508
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650077"
     variation       14509
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650078"
     exon            14735..15013
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       14817
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650079"
     exon            15014..15289
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            15290..15429
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            15430..15556
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            15557..15820
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15709
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650080"
     exon            15821..16087
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15952
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650081"
     exon            16088..16351
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            16352..16491
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             16353..16461
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1881"
                     /db_xref="UniSTS:153573"
     exon            16492..16618
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16589
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650084"
     exon            16619..16885
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            16886..17152
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17153..17419
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17323
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650088"
     exon            17420..17559
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17560..17686
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17687..17829
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17755
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677216"
     exon            17830..17953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            17954..18220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            18221..18318
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            18319..18487
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677221"
     exon            18488..18754
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18678
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677223"
     exon            18755..19021
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18813
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677225"
     exon            19022..19300
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19143
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303829"
     variation       19165
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677226"
     exon            19301..19709
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19572
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72677227"
     exon            19710..19834
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            19835..20101
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19856
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677229"
     exon            20102..20371
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            20372..20674
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20596
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677231"
     variation       20653
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677232"
     exon            20675..20977
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20720
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677233"
     exon            20978..21165
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21128
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677237"
     exon            21166..21280
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            21281..21565
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            21566..21717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21569
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677238"
     exon            21718..21865
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21799
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303830"
     exon            21866..22043
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22029
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677240"
     exon            22044..22165
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22132
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677242"
     exon            22166..22453
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22358
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677243"
     variation       22401
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677244"
     exon            22454..22750
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            22751..22937
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22811
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677245"
     exon            22938..23053
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23054..23353
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23136
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2115558"
     variation       23163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677247"
     exon            23354..23653
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23654..23759
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23760..23956
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23763
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677249"
     exon            23957..24262
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24217
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677250"
     exon            24263..24541
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24514
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78462639"
     exon            24542..24841
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24662
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632860"
     exon            24842..25144
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25089
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288566"
     exon            25145..25507
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25290
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632861"
     exon            25508..25810
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            25811..26110
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26111..26407
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       26226
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303831"
     exon            26408..26692
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       26501
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646808"
     variation       26528
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2303832"
     variation       26597
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646809"
     exon            26693..26986
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26987..27286
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27287..27595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       27405
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646813"
     variation       27594
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303834"
     exon            27596..27786
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27787..28216
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28217..28525
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28526..28674
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28544
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646819"
     exon            28675..28707
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28708..28837
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28822
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646822"
     exon            28838..29137
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28958
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646823"
     exon            29138..29455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29456..29752
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29506
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001238"
     STS             29653..29758
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1532E"
                     /db_xref="UniSTS:150620"
     exon            29753..30052
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29934
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646827"
     exon            30053..30367
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             30157..30295
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65766"
                     /db_xref="UniSTS:17479"
     variation       30211
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646828"
     STS             30302..30400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1570E"
                     /db_xref="UniSTS:150654"
     exon            30368..30516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30517..30667
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30668..30949
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       30736
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646831"
     variation       30867
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646832"
     variation       30869
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646833"
     exon            30950..31252
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31253..31555
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31556..31837
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31675
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646837"
     exon            31838..32137
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31841
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288569"
     variation       31955
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646838"
     exon            32138..32440
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32338
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303836"
     exon            32441..32749
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32518
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646839"
     variation       32720
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646840"
     exon            32750..33031
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33032..33331
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33240
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646842"
     exon            33332..33625
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33593
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1560220"
     exon            33626..36592
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33895
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646843"
     variation       34223
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646844"
     variation       34226
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646845"
     variation       34650
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2163009"
     variation       35281
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646846"
     variation       35463
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1560221"
     variation       35583
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646847"
     variation       35790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646848"
     variation       35837
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646849"
     variation       36428
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646850"
     variation       36431
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646851"
     variation       36570
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646852"
     exon            36593..36913
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       36844
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646853"
     exon            36914..37198
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       36932
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646854"
     variation       36994
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646855"
     exon            37199..37498
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37437
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646857"
     exon            37499..37801
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646859"
     variation       37613
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2042996"
     exon            37802..38077
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            38078..38377
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38092
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646860"
     exon            38378..38680
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646861"
     exon            38681..38980
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            38981..39268
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39034
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646866"
     variation       39180
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646867"
     exon            39269..39565
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39491
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646868"
     exon            39566..39868
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            39869..40174
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40019
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646869"
     variation       40078
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646870"
     exon            40175..40462
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40297
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646871"
     variation       40444
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303837"
     exon            40463..40753
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40480
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303838"
     variation       40504
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646873"
     STS             40692..41092
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_23497-23498:1027358865:1"
                     /db_xref="UniSTS:268713"
     exon            40754..41041
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40947
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646876"
     variation       41040
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288570"
     exon            41042..41629
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41364
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646877"
     exon            41630..41734
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            41735..41932
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41863
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646880"
     exon            41933..42229
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            42230..42817
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42550
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646881"
     variation       42788
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646882"
     exon            42818..43120
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42830
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288572"
     variation       42990
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:67041405"
     variation       43055
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646884"
     variation       43081
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646885"
     exon            43121..60226
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43665
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646887"
     variation       43885
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646888"
     variation       44056
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646889"
     variation       44082
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646890"
     variation       44237
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646891"
     variation       44269
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646892"
     variation       45345
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646893"
     variation       45438
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646894"
     STS             45614..45739
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1571E"
                     /db_xref="UniSTS:150655"
     variation       46432
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646895"
     variation       46625
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646896"
     variation       46951
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646897"
     variation       48007
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646898"
     variation       48244
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744426"
     variation       48296
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646899"
     variation       48377
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744427"
     variation       48442
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744428"
     variation       48479
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731743"
     variation       49025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646900"
     variation       49042
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646901"
     STS             49148..49349
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1580E"
                     /db_xref="UniSTS:150664"
     STS             49471..49571
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1593E"
                     /db_xref="UniSTS:150677"
     variation       49748
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813243"
     variation       49818
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646902"
     variation       50104
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3813244"
     variation       50125
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3813245"
     STS             50310..50650
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="TTN-1"
                     /db_xref="UniSTS:254009"
     variation       50684
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813246"
     variation       51318
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648203"
     variation       51468
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648204"
     variation       52151
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010407"
     variation       52297
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648205"
     variation       52631
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648206"
     variation       52670
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731745"
     variation       53031
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648207"
     variation       53267
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731746"
     variation       53346
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648208"
     variation       53349
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648209"
     variation       53878
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648210"
     variation       54204
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3813247"
     variation       54427
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648211"
     variation       54510
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648212"
     STS             55171..55297
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1550E"
                     /db_xref="UniSTS:150635"
     variation       55890
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648213"
     variation       56092
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648214"
     variation       56159
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648215"
     variation       56202
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648216"
     variation       56521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648217"
     variation       56618
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648218"
     variation       56728
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829746"
     variation       57608
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648219"
     variation       57758
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648220"
     variation       58045
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648221"
     variation       58224
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648222"
     variation       58608
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648223"
     STS             58804..59019
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1560E"
                     /db_xref="UniSTS:150645"
     STS             59348..59526
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH48674"
                     /db_xref="UniSTS:32026"
     variation       59374
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648224"
     variation       59407
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648225"
     STS             59447..59558
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1572E"
                     /db_xref="UniSTS:150656"
     variation       59931
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648226"
     exon            60227..60523
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             60271..60352
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1553E"
                     /db_xref="UniSTS:150638"
     exon            60524..61111
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       60817
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648227"
     variation       61016
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648228"
     variation       61074
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648229"
     exon            61112..61414
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61176
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648230"
     variation       61312
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648231"
     STS             61342..61479
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_21540-21541:1033053987:1"
                     /db_xref="UniSTS:268573"
     exon            61415..61711
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            61712..61999
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61901
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648234"
     exon            62000..62299
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       62090
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648235"
     variation       62173
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648236"
     exon            62300..62602
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            62603..62908
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             62642..62755
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1519E"
                     /db_xref="UniSTS:22697"
     variation       62791
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648237"
     variation       62831
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648238"
     exon            62909..64675
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       63113
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648240"
     variation       63312
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648241"
     variation       63846
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648242"
     STS             64194..64336
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65575"
                     /db_xref="UniSTS:58532"
     variation       64478
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648243"
     exon            64676..64969
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            64970..65257
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       64978
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648244"
     exon            65258..65557
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             65312..65450
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH98821"
                     /db_xref="UniSTS:85869"
     variation       65342
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648245"
     variation       65404
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648246"
     exon            65558..67624
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       65581
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648247"
     variation       66266
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648248"
     variation       66281
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648249"
     STS             66516..66607
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1540E"
                     /db_xref="UniSTS:150626"
     variation       66571
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648250"
     variation       66648
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731748"
     variation       66929
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648251"
     variation       66998
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648252"
     STS             67047..67148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1546E"
                     /db_xref="UniSTS:150631"
     exon            67625..67927
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            67928..68233
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68103
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648253"
     exon            68234..68524
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68247
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370821616"
     variation       68248
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648254"
     variation       68251
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648255"
     variation       68256
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648256"
     variation       68452
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648257"
     exon            68525..68821
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68594..68595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857280"
     variation       68664
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648258"
     variation       68675
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648259"
     exon            68822..69127
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       68953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857267"
     variation       68958
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648260"
     variation       68971
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648261"
     variation       69052
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648262"
     variation       69058
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648263"
     variation       69094..69095
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857270"
     exon            69128..69433
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       69371
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:72648265"
     exon            69434..69715
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            69716..70309
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       69814
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857279"
     variation       70280
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200676850"
     exon            70310..70597
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       70323
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648266"
     exon            70598..70897
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       70699
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648267"
     exon            70898..71200
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       71018
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3731749"
     exon            71201..71503
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            71504..72088
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       71523
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648269"
     variation       71569
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648270"
     variation       71577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648271"
     variation       71647
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648272"
     variation       71699
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648273"
     variation       71772
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648274"
     exon            72089..72394
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            72395..72694
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       72560
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648276"
     exon            72695..73270
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            73271..73576
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       73306
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648278"
     variation       73360
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648279"
     exon            73577..74170
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       73649
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648282"
     variation       73778
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648283"
     variation       73811
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857264"
     variation       73864
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629779"
     exon            74171..79779
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       74507
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962659"
     variation       74844
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629781"
     variation       75113
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629782"
     variation       75924
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857265"
     variation       76238
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3731752"
     variation       76282
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629783"
     variation       76379
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857266"
     variation       76458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731753"
     variation       76637
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72629784"
     variation       76768
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629785"
     variation       77186
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829747"
     variation       77363
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629786"
     variation       77578
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857268"
     variation       77782
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72629787"
     STS             77861..77985
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65621"
                     /db_xref="UniSTS:70042"
     variation       77981
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:68080670"
     variation       77996
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629788"
     STS             78392..78600
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1568E"
                     /db_xref="UniSTS:150652"
     variation       78393
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829748"
     variation       78495
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629789"
     variation       78598
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857269"
     variation       78617
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3813249"
     variation       78789
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813250"
     variation       78987
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829749"
     variation       79192
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:67254537"
     variation       79226
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2857271"
     exon            79780..79936
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            79937..80628
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             80141..80319
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1564E"
                     /db_xref="UniSTS:150649"
     exon            80629..80782
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            80783..81085
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       80981
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629793"
     exon            81086..82404
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       81424
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629794"
     variation       81440
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629795"
     STS             81999..82113
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S2648"
                     /db_xref="UniSTS:75793"
     variation       82045
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629796"
     variation       82123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629797"
     polyA_signal    82377..82382
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
     variation       82396
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629798"
     polyA_site      82404
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
ORIGIN      
gagcagtcgtgcattcccagcctcgcctcgggtgtagggattgcatagaaaagcaaaactacacagtcttgactgtgtagttttgtttttaggattagaggctcaccgattcatgtcggagatggtcagaaaaaccaactctccataggacgtcgtttcagaagcaaccttgggcttagtcccaccctttttaggcactcttgagaaatcagagtgcctagaaagatgacaactcaagcaccgacgtttacgcagccgttacaaagcgttgtggtactggagggtagtaccgcaacctttgaggctcacattagtggttttccagttcctgaggtgagctggtttagggatggccaggtgatttccacttccactctgcccggcgtgcagatctcctttagcgatggccgcgctaaactgacgatccccgccgtgactaaagccaacagtggacgatattccctgaaagccaccaatggatctggacaagcgactagtactgctgagcttctcgtgaaagctgagacagcaccacccaacttcgttcaacgactgcagagcatgaccgtgagacaaggaagccaagtgagactccaagtgagagtgactggaatccctacacctgtggtgaagttctaccgggatggagccgaaatccagagctcccttgatttccaaatttcacaagaaggcgacctctacagcttactgattgcagaagcataccctgaggactcagggacctattcagtaaatgccaccaatagcgttggaagagctacttcgactgctgaattactggttcaaggtgaagaagaagtacctgctaaaaagacaaagacaattgtttcgactgctcagatctcagaatcaagacaaacccgaattgaaaagaagattgaagcccactttgatgccagatcaattgcaacagttgagatggtcatagatggtgccgctgggcaacagctgccacataaaacacctcccaggattcctccgaagccaaagtcaagatccccaacaccaccgtctattgctgccaaagcacagctggctcggcagcagtccccatcgcccataagacactccccttccccggtcagacacgtgcgggcaccgaccccatctccggtcaggtccgtgtctccagcagcaagaatctccacatcccccatcaggtctgttaggtctccattgctcatgcgtaagactcaggcatccaccgtggccacaggtcctgaagtgcctcccccttggaagcaagagggctacgtggcctcctcatctgaggctgagatgagagagacaacgctgacaacctctactcagatcaggacagaagagagatgggaagggagatacggtgtccaggagcaagtgaccatcagtggtgctgcgggtgctgccgccagtgtgtcggccagtgctagctacgcagcagaggctgttgccactggtgctaaagaggtgaaacaagatgctgacaaaagtgcagctgttgcgactgttgttgctgccgttgatatggccagagtgagagaaccagtgatcagcgctgtagagcagactgctcagaggacaaccacgactgctgtgcacatccaacctgctcaagaacaggtaagaaaggaagcggagaagactgctgtaactaaggtagtagtggccgccgataaagccaaggaacaagaattaaaatcaagaaccaaagaagtaattaccacaaagcaagagcagatgcacgtaactcatgagcagataagaaaagaaactgaaaaaacatttgtaccaaaggtagtaatttccgcagctaaagccaaagaacaagaaactagaatttctgaagaaattactaagaaacagaaacaagtaactcaagaagcaataatgaaggaaactaggaaaacagttgtacctaaagtcatagttgccacacccaaagtcaaagaacaagatttagtatcaagaggtagagaaggcattactaccaaaagagaacaagtgcaaataactcaggagaagatgagaaaggaagccgagaaaactgccttgtctacaatagcagttgctactgctaaagccaaagaacaagaaacaatactgagaactagagaaactatggctactagacaagaacaaatccaagttacccatggaaaggtggacgttggaaaaaaggctgaagctgtagcaacagttgttgctgcagtagaccaggcccgagtcagagagcccagagagcctgggcatcttgaagaatcctatgctcagcagaccactttggagtacggatataaggaacgcatttccgccgcaaaggtagctgagcctccccaacgtccagcctcagaaccccacgttgtccctaaagcagtcaagcctagagtaatccaggctccttctgagactcatatcaaaactactgatcaaaagggaatgcacatatcatcacagatcaagaaaactacagatctaacaacggaaagattagtccatgtggataaacgcccccgcacagctagccctcactttactgtttcaaaaatttctgttcctaagacagaacatggatatgaggcatcaatagccggtagtgctattgccacattacaaaaagagttgtcagccacatcttctgctcagaagatcaccaaatcggtgaaggctcctactgtgaagcccagtgagactagagtaagggcagagcccacacccttgccacagttccccttcgctgacacaccagatacttacaagagtgaagctggcgttgaggtgaaaaaggaagtaggggtgagcatcactggcaccaccgtccgtgaagagcgctttgaagtactgcacggacgcgaagccaaggtaacagaaacagcaagagtaccagcacctgttgaaattcctgttactccaccaactttggtctcgggcttaaaaaatgtgactgtcatagaaggtgaatctgtcaccttggagtgccacatctctggatacccatccccgacagtgacatggtacagggaagactaccaaatcgaaagttccattgacttccagataaccttccagagtggaattgctcgtcttatgattcgcgaagcatttgcggaagacagcgggcgatttacttgcagtgctgtaaatgaggctggaaccgtcagcacatcctgctatctggctgtgcaggtgtcagaagaatttgaaaaggaaaccacagccgtgactgagaaatttactacagaagagaaacgctttgttgagtcaagagatgtggttatgactgatactagcctcacagaggaacaagcagggcctggagaacctgccgcgccttactttattacaaaaccagtggtccagaaactggtggaaggtgggagcgtggtgtttggatgccaagttggcggcaacccaaagccccatgtatactggaaaaaatctggtgttcctctaaccactggatacagatacaaagtgagttacaacaaacaaaccggtgaatgcaagctggtgatttctatgacttttgctgatgatgctggagaatacactattgttgttcgcaataagcatggagaaacttctgcatctgcttccttgcttgaagaagctgattatgagttactgatgaagtcccagcaagaaatgctttatcagacacaagtgactgcatttgttcaagaacctaaagttggagaaacagcacctggatttgtatactctgagtatgaaaaagagtatgaaaaagaacaagccttaattaggaagaaaatggccaaagatactgtagtggtcagaacttatgtagaagatcaggaattccatatttcttcctttgaagagagacttattaaagaaattgaatatagaataataaagactacattagaagaacttcttgaagaagatggagaagaaaagatggcagttgacatttctgaatctgaagctgttgaatcaggatttgattcaagaatcaagaattatagaattcttgaggggatgggtgtcacttttcattgcaagatgtctggatatccattaccaaagattgcttggtacaaagatggcaagcgcatcaaacatggagaaagataccaaatggactttctacaagatggcagagctagtctgcgtatacctgttgttcttccagaagatgaaggaatctacactgcatttgccagcaatattaaaggaaatgcaatttgctcagggaaattgtatgtggagcctgctgcaccacttggagctccgacttacattcccacactagagccagtgagcagaatcagatctctctctccacgttcagtgagcaggtctcctatacgcatgtctcctgcacggatgtcacctgcaaggatgtctcctgcacggatgtcccctgcaagaatgtcccctggacgtaggctggaggagacagatgagtcacaacttgagagactatataaaccagtctttgtgttaaaacctgtttctttcaaatgtttagaagggcaaactgccagatttgacttaaaggttgttggtagacctatgccagagacgttctggtttcatgatggccagcaaattgtcaatgactatacccataaagtagtcattaaagaagatggtactcaatcactaattattgtccctgccacacccagtgattctggggaatggactgtggttgcccaaaacagggcaggcagatcttcaatttcagtgattttaactgtggaagctgtggaacatcaggtaaaaccgatgtttgtagaaaaactgaaaaatgtcaatataaaggaaggttcccgacttgaaatgaaagtcagagctacgggtaaccccaaccctgacattgtatggttgaaaaacagtgacatcattgtgcctcataaatatcccaaaatcagaattgaaggaaccaagggagaagctgcccttaaaatcgattccactgtcagccaagattctgcctggtatactgcgactgctattaataaagctggcagagacactacaagatgcaaagtaaatgttgaagttgagtttgcagagcctgagccagagagaaagttaatcatcccacgggggacatatagagcaaaggagattgcagccccagaactggagcccctccatttgcgatatggccaagagcaatgggaagaaggtgatctctatgacaaagagaaacaacagaaaccatttttcaagaaaaaactcacttccttaagacttaagcgctttgggcctgcccactttgaatgcaggctaacacccattggtgacccaacgatggtggtggagtggctccatgatggaaagccacttgaagcagccaacaggctccgtatgatcaatgaatttgggtactgcagccttgattatggcgttgcatattctagagacagtggtatcattacttgcagagccactaacaaatatggaacagatcacacatctgctacccttattgttaaagatgagaaaagtcttgtggaagaatcccaattgcctgaggggaggaaaggcttacagagaattgaagaattagagagaatggctcatgaaggtgcacttacaggtgtaacaacagatcagaaagaaaagcaaaagccagacattgtcttgtacccagagccagttagagtacttgaaggggagactgcaaggttccgctgcagggtaacaggctaccctcagcccaaagtcaactggtacctcaatggacagctcatccgcaaaagcaaaaggttcagagttcgctatgatggtatccattacctggacatcgtggactgcaaatcatatgacacaggtgaagtgaaggtcaccgcggaaaatcctgaaggtgtgatagagcataaagtgaagcttgagattcaacagagggaagattttaggtctgtccttaggagagctcctgaaccaaggcctgagtttcacgtacatgaaccaggaaagcttcagtttgaagtacaaaaagtggatagacctgttgacaccactgaaaccaaagaagttgtgaagttgaaaagggctgaaagaattacccatgaaaaagtgcctgaagagtcggaagagctgcgcagtaaattcaagcgcagaacagaagagggctattatgaagccattaccgctgtggagctcaagtctcgaaagaaggatgaatcctatgaggaactcctcaggaagacaaaagatgaacttctccactggaccaaagagttaactgaagaggaaaagaaagctcttgccgaagaaggcaaaatcacgattccaacttttaaacctgacaagattgaactaagtcctagtatggaggctccaaaaatcttcgaaagaatccagagccaaacagtgggccaaggatctgatgcacacttccgggtcagagtcgtggggaaaccagaccccgaatgtgaatggtacaaaaatggtgtcaaaattgaacggtctgaccggatctactggtactggcccgaagacaatgtttgtgaattggtcataagagatgtgactgctgaggactctgccagcatcatggtaaaagccatcaacatagctggagaaacctccagtcacgcattcttacttgtccaagccaagcaattgatcactttcacacaggaattacaagatgttgttgctaaggaaaaagacactatggcaacctttgaatgtgaaacttcagaaccatttgtcaaagtgaaatggtataaagatggtatggaggttcatgagggagataaatacaggatgcactctgacagaaaggttcacttcctctccatactgaccattgatacgtctgatgctgaagattacagctgtgtacttgtggaagatgaaaatgtcaaaacgactgctaaacttattgttgaaggtgcagttgttgagtttgtgaaagaacttcaggacatagaagttccagaatcatattcaggagaattagagtgcattgtatccccagaaaatatagaaggaaaatggtatcataatgatgtggagcttaaatccaatggcaaatatacaattacatctcgtcgtggacgtcagaacctcacggtcaaggatgtaaccaaggaggaccagggagaatacagctttgtcatcgacgggaaaaagacaacctgtaaattaaagatgaaaccccgccccattgctatcctacaaggacttagtgaccaaaaagtctgtgagggtgacattgttcagcttgaagttaaagtctccttggaaagtgtggaaggcgtctggatgaaagacggccaagaagtgcagcccagtgacagggttcacattgtgatagacaaacaatctcatatgctgctcattgaagacatgactaaggaagatgctggaaattactctttcaccattccagcccttggcctctccaccagtgggcgtgtctctgtctatagtgtggacgtgataacacctctaaaagatgttaatgtgattgaaggcaccaaggctgtgcttgaatgtaaggtgtcagtccctgatgtgacttctgttaagtggtacttaaatgatgaacaaatcaagcctgatgaccgtgtacaggccattgtgaaaggtactaaacagcgactagtcattaaccgaactcatgcttcagacgaaggaccttacaagctgatagttggcagagttgaaaccaactgtaatctctctgtagaaaaaattaaaattatcagaggtcttcgtgaccttacctgtacagaaactcaaaatgtggtgtttgaggttgagctgtcccactctggaattgatgtcctgtggaattttaaggacaaggaaatcaagcccagttctaaatataaaattgaagcacatggaaaaatatataaattgacagttctaaatatgatgaaagatgatgaaggaaaatacacattttacgcgggagaaaatatgacatctggaaaacttactgtggcaggtggggccatctccaagccactcacagatcagaccgtagctgaatcccaggaagctgtgtttgaatgtgaagttgccaacccagattccaaaggcgaatggttgagggatggcaaacacctaccactgactaacaacatcagaagtgagtctgatggccacaaaaggagacttatcattgctgccaccaaattagatgacattggagaatatacctacaaggtggccacctccaaaacatctgccaaactcaaagttgaagctgtcaaaattaagaagactctgaagaacctcacagtgacagaaacacaggatgctgttttcactgtcgagcttacacaccctaatgtcaaaggtgtccagtggatcaaaaatggagttgtgctggaatccaatgaaaagtatgctatctctgtcaaaggaacaatttactctctgaggattaaaaactgtgccatcgtggatgagtctgtttatggcttcaggcttggaaggcttggagccagtgccagactgcacgtggagactgtcaagatcattaaaaagccaaaggatgtgacagccttggaaaatgccactgttgcctttgaagttagtgtttcccatgacactgttccagtaaaatggttccataagagtgtggaaattaagccaagtgacaaacacagactggtctcagaaaggaaagtccacaagctgatgctgcagaacatctccccctcagatgctggggaatacacagctgtggtcgggcaattggaatgcaaagcaaaactgtttgtggagacattacatattacaaaaaccatgaaaaatatcgaggtgcctgagaccaaaactgcctcttttgagtgtgaggtgtcccacttcaatgtcccttccatgtggctgaagaatggtgtggaaattgagatgagtgaaaagttcaagatagttgtgcagggaaaactccatcagctgatcatcatgaacaccagcacagaggactcggcagaatacacatttgtctgtggcaatgaccaagtcagtgccaccctgacagtcaccccaatcatgattacttccatgctgaaagacatcaacgctgaagaaaaagacactattacttttgaggtgacagtgaactatgaaggcatctcttacaaatggttaaagaatggtgtggaaatcaaatcaactgacaagtgccagatgagaaccaaaaagctcacacactcactgaacatcaggaatgttcactttggggatgctgctgactacacctttgtggctggaaaagcaacatcaacagccacactttatgtggaagctcgtcatatagaatttaggaaacacattaaggacattaaggtactggagaagaagcgagccatgtttgaatgtgaagtttctgaacctgacatcactgtacagtggatgaaagatgaccaggaactgcagatcacagacagaataaagattcagaaggagaaatatgtccaccgccttctgatcccatccacccggatgtctgatgctgggaagtacacagtggtggcaggaggcaacgtgtcaactgcaaaactctttgtagaaggcagagatgttcgcatccgaagtattaaaaaggaggttcaggtcattgagaaacagcgtgctgttgttgaatttgaggtcaatgaagacgatgttgatgcccactggtataaagatggcattgaaatcaatttccaagttcaagaacgacacaaatatgtagtggaaagaagaatccaccgaatgtttatctctgagaccagacagagcgatgcaggagaatacacctttgtggcaggaaggaacaggagttctgtcactctctatgtcaatgctcctgaaccgccccaagttctgcaggagctccagcctgtcactgtgcagtctggcaagcctgcccgcttctgtgccgtgatatccggaagaccacagcccaaaatttcctggtacaaggaagagcagctgctttccactggcttcaagtgcaaatttcttcatgatgggcaagaatacacgcttttgctaattgaagccttcccagaggatgcggcagtctatacctgtgaagccaagaatgactatggtgttgccacaacatcagcttcactctcagtggaagttccagaagttgtgtctcctgatcaggaaatgcctgtttatccacctgccatcatcaccccgcttcaggacactgtcacttctgaagggcagccagcccgttttcaatgccgggtttctggaacagatctaaaagtgtcgtggtacagcaaagacaagaaaatcaagccatctcggttctttagaatgactcaatttgaagacacttatcaactggaaattgccgaagcttatccagaagatgaaggaacttacacgtttgttgctagtaatgctgtaggccaagtatcaagcacagccaacctgagtctggaaggatttagcaaatttgaagaaaatacatcaaactcccaatggcatgtctctttatcagtttcatttaagaaggagccccttggccaaaagcccagcttcatccagcctctgtcaagcctcagggtgcacaacggggagacagtcagatttcatgcgagggtttctggcattcccaagccagaaatccaatggtttcataaccagcagctaattctaccaacaaaagatgtagttttccattttgaggagtccacaggcatggctttaatgcttatagttgatgcttactcagagcatgctgggcagtactcttgcaaagcagccaatagtgctggggaagccacttgtgcagctacactcacagtgactccaaaagctcctgaatcaattttgcatgagaggattgaacaagagattgagatggaaatgaaagagttttctagttcttttctgtctgccgaggaagaaggacttcatagcgccgaacttcaattatctaaaataaatgaaacacttgaacttttgtctgaatctccagtttacccaactaaatttgattccgaaaaggaaggcactggcccaattttcatcaaagaagtgtcaaatgctgatataagcatgggggatgtggctacactgtctgtaactgtcattggcatccccaaacctaaaattcagtggttctttaatggagtgctattaaccccttctgctgactacaaatttgtttttgacggtgatgatcatagcctgatcattctgttcaccaaattggaggatgagggagagtatacatgtatggccagtaatgactatggaaagacaatatgtagtgcctatctaaaaattaattccaaaggagagggtcacaaagacactgaaacagaatcagcagtggcaaaatctctggaaaagctgggaggtccttgtcctcctcacttccttaaggagttaaaaccaattcgctgtgctcaagggcttcctgccatctttgagtacacagtggttggagagcctgcccctactgttacatggttcaaagaaaacaagcagctttgcaccagtgtttattacactatcattcataaccctaatggctctggaactttcattgtcaatgaccctcagagggaagacagtggcctctatatctgtaaagcagagaatatgttgggtgagtccacctgtgcagcagagctgcttgtgcttctggaagacacagacatgactgataccccctgcaaagcaaagtccacaccagaggctcctgaggattttccacagacacccttaaagggtcccgcagttgaagcacttgactcagagcaggaaattgcaacgtttgtaaaagacaccattttgaaagctgctttaattacagaagaaaaccagcaactatcttatgagcatattgctaaagccaatgaattgagcagtcagcttcctttgggagctcaggaattgcaatccattttggagcaagacaagctcactcctgaaagcaccagggaatttctttgcatcaatggcagtattcactttcagcctctcaaggaaccatctcccaacctacagctgcagattgtacagtcccagaaaaccttctccaaagaaggtattctaatgcctgaagagcctgagacacaggcagttctatcagataccgagaaaatcttcccaagtgccatgtccatagaacaaattaattcattaacagttgagcctctgaaaactttattagctgaacctgaagggaattatccacagtcttcaatagaacctccaatgcattcttatctaacctctgtggctgaggaagtactttcaccaaaagaaaagacagtatctgacaccaacagagagcaaagagtgactcttcaaaagcaagaggcacaaagtgcgctcatcttgagtcagagcttagctgagggacacgtggagagtctccagagtcctgatgtcatgatctctcaggtaaactatgagcccctagtcccttcagaacactcatgcacagaaggaggtaaaattttgatagaaagtgcaaatccactggaaaatgcagggcaagattctgcggtcagaattgaggaaggcaagtccttaagatttccactagcacttgaagaaaagcaggtactgctcaaagaagagcattctgacaacgtggtgatgcccccagaccaaatcattgagtctaaaagagagcccgtggcaataaagaaagtgcaggaggtacagggaagggaccttctttctaaggaaagcttgctttctggtattccagaagagcagagattaaacctgaaaattcaaatctgccgggctttgcaagcagccgtggccagcgagcagccaggtcttttctctgagtggctaagaaatattgaaaaggtggaggtcgaggctgtaaacatcacccaagagcccagacacatcatgtgcatgtaccttgttacttcggcaaagtctgtaacagaagaagtaaccatcattattgaagatgttgatcctcaaatggctaacctgaaaatggaacttagggatgctttgtgtgctattatatatgaggaaatagacatcctaacagctgagggtcctagaattcagcaaggagccaaaacaagtttgcaagaagaaatggattctttttcaggttcacagaaggttgaacccattactgaaccagaagttgaatctaaatatctgatctcaactgaagaggtcagttattttaacgtgcaaagtagggttaaatatttggatgccacacctgtcactaaaggggttgcttcagctgttgtctctgacgaaaaacaagatgagagtctgaaaccatcagaggaaaaagaggagtcttcctctgaaagtggtactgaggaggttgctacagtaaagatacaggaagctgagggtggcttaatcaaagaggatggccccatgatacatacacctttagtggacactgtttctgaggaaggtgatattgtacacctcacaacatccataacaaatgctaaagaggtgaattggtattttgagaataaactggtgccttcagatgaaaagttcaagtgtttacaagatcaaaatacatatacgctagtcatcgacaaagtaaataccgaagaccatcaaggagagtatgtctgtgaggccttgaatgacagcggaaaaacagcaacttcagccaaactcactgtagtaaaaagagctgccccagtgatcaagaggaaaatcgaacccctggaagtagcactgggccacctagccaaattcacctgtgagatccaaagtgctcccaatgtccggttccagtggtttaaagctggccgagaaatttatgagagtgacaagtgttctattcgatcttcaaagtatatctccagccttgaaatcctgagaacccaggtggttgactgcggcgagtatacatgcaaagcttccaatgagtatggcagtgtcagctgtacagccacactaactgtgacagtgcctggaggtgaaaagaaagttcgcaaattacttccggaacgtaaacctgaaccaaaggaagaagttgttctgaaaagcgttctaagaaaaagacctgaagaagaagaacctaaagtagaacctaaaaaactagaaaaagttaaaaaacctgcagtaccagaaccaccacctccaaaacctgttgaagaggttgaagtacctactgttacaaaaagggaaaggaagattcctgaaccaacaaaagtgcctgaaatcaagccagcaatacctctccctgcacctgaaccgaaaccaaagcccgaagcagaagtgaaaacaatcaaaccacctcctgtggaacctgaaccaacccccatcgctgccccagtaacagtgccagtggttggaaagaaagcagaagccaaagcacctaaggaagaggctgccaagccaaaaggtcctatcaaaggtgtacccaaaaagactccttcaccaatagaagccgaaaggagaaagttaaggccaggaagtggtggagagaaacctcctgatgaagccccgttcacctaccagctaaaggctgtgccactgaagtttgtgaaagaaatcaaagacatcatcttgacagaatcagagttcgttggctcttcagcaatctttgaatgtttggtctccccttccactgcaattacaacctggatgaaagacggtagcaatatccgtgagagtcccaagcacaggtttattgcagatggtaaagacagaaagctgcacatcattgatgttcaactttccgatgctggtgaatacacctgtgttttacgtttgggaaacaaagaaaagacctccacggctaaacttgttgtagaagaacttcctgtgcgttttgtaaaaacactggaagaggaagtcacagtggtcaaaggacagccattgtacttgagctgcgagttaaacaaagagcgtgacgtggtctggaggaaggatggcaagattgtggtggagaaacctggccgaattgtgccaggcgtcattggcttgatgcgggctctgaccatcaacgatgcagatgacacagatgctggaacatacacagttactgtggaaaacgccaacaacctggagtgttcatcttgcgtaaaagtagtagaagtcattagagattggctggtgaaacctatacgagaccagcatgtgaaacccaaggggacagctatttttgcctgtgatatagcaaaagatactccaaacattaagtggttcaaaggatatgatgaaatccctgcggaaccaaatgataagactgaaatactgagagatggaaatcatctgtacctcaaaattaagaatgctatgccagaagatattgctgagtatgcagtggaaattgaaggaaaaagataccctgcaaagctgacacttggagagcgtgaagttgaactgcttaaaccaatagaggacgttaccatttatgagaaagaaagtgcaagctttgatgcagaaatctcagaggcagacattcctggacaatggaaactgaaaggagaacttctaaggccctcacctacttgtgaaatcaaagcagaaggtggaaaacgcttcttaactttgcacaaagtcaaactggaccaagctggtgaagtcctctaccaggcccttaatgcaattacaactgccattttgacagtaaaagaaatcgaacttgactttgctgtgcccctgaaggatgtcactgttccagaaaggcgacaggctcgattcgaatgtgtcctcacccgagaggcaaatgttatatggtccaaaggacctgatataattaagtcatctgacaaatttgatatcatcgctgatggaaagaaacatattcttgttattaatgattctcaatttgatgatgaaggggtctatactgctgaggtggagggcaagaagacctcagctcggttgtttgtcacaggtataagactgaaattcatgtcacctcttgaagatcaaacagtaaaagaaggtgaaacagcaacttttgtttgtgaactttctcatgaaaaaatgcatgtagtctggttcaaaaatgatgccaaactccatacaagcagaacagtactcatctcttctgagggcaagactcacaaattggaaatgaaagaagtgacattggatgatatatctcagataaaagctcaagtcaaggagctgagctccacagcacagctgaaggtcttagaggccgatccctacttcactgtgaaattacatgacaaaactgcagtggagaaggatgagattactttgaagtgtgaagtgagcaaagatgtaccagtgaaatggttcaaagatggtgaagagattgtcccttcacccaaatattctatcaaggcagatggcctgcgccgcatcttaaaaatcaaaaaggcggaccttaaagataaaggcgaatatgtgtgtgactgtggcacagacaagaccaaggcaaatgttactgttgaggctcgactaataaaagtggaaaagcctctgtacggagtagaggtgtttgttggtgaaacagcccactttgaaattgaactttctgaacctgatgttcacggccagtggaagctgaaaggacagcctttgacagcttcccctgactgtgaaatcattgaggatggaaagaagcatattctgatccttcataactgtcagctgggtatgacaggagaggtttccttccaggctgctaatgccaaatctgcagccaatctgaaagtgaaagaattgcctcttatcttcatcacacctctcagtgatgttaaagtcttcgagaaagatgaggctaagtttgagtgtgaagtatccagggagcccaaaacattccgttggctaaaaggaacccaggaaatcacaggtgatgacagatttgagcttataaaggatggcactaagcattcaatggtgatcaagtcagctgcttttgaagatgaagcaaaatacatgtttgaagctgaagataagcacacaagtggcaaactgatcattgaaggaatccggctcaaattcctcacccctctcaaagatgtaactgccaaagagaaggaaagtgctgtatttactgtggagttatctcatgataacatccgagttaaatggttcaagaatgaccagcgcctacacaccaccaggtcggtctcaatgcaagacgaagggaaaactcattcgatcacattcaaagacctgtctattgatgacacctcccaaattagagtagaagctatggggatgagttcagaagctaaactcactgtgcttgagggagacccatattttacaggaaaacttcaagattatactggtgtagagaaagatgaagttattctacagtgtgaaattagcaaagcagatgcaccagtgaaatggtttaaggatgggaaggaaataaagccatccaaaaatgctgttattaaggcagatggcaagaaacgcatgctaatcctaaagaaagccttgaaatcagatattggacagtacacctgtgactgtgggacagataagacctcaggaaaacttgacattgaggatcgggaaattaaactggtgcgacccctgcacagtgtggaggtgatggagactgagacagcacgctttgaaaccgaaatctctgaagatgatatccacgccaactggaaactcaagggagaggccctactccaaacacctgattgtgaaattaaggaagaaggcaaaatacactcccttgttttgcacaactgtcgcctggaccagacgggtggggtggatttccaagctgccaatgttaaatctagtgcccacctccgagttaagccacgagtaattggtcttctgaggcctttaaaggatgtcaccgtgactgcaggggaaacagccaccttcgactgcgagctctcctacgaagatatcccagtggaatggtatctcaaagggaagaaactagagcccagcgataaggtggtcccacgttcagaaggaaaagttcatacacttactctgagggatgtaaagttagaagatgctggggaagtccaactaacagcaaaagatttcaaaactcacgccaacctctttgtgaaagaacccccagttgaattcactaagcctcttgaggaccagacggtcgaagagggagccactgcagtgctggagtgtgaagtctccagagaaaatgctaaggtgaaatggttcaaaaatgggacagaaatcctcaaaagcaagaagtatgaaattgttgctgatggcagggtcagaaaacttgttatacatgactgtaccccagaggatattaaaacatacacttgtgatgctaaggattttaagacttcctgtaacctgaatgtcgtgcctcctcatgtggaattcttaagaccactcaccgaccttcaagttagagaaaaagaaatggctcgatttgagtgtgaactttcccgagaaaatgctaaggttaagtggtttaaagatggtgctgaaattaaaaagggcaaaaaatatgacatcatatccaagggagcagtgcgcattcttgtcatcaacaaatgtctactggatgatgaagctgaatattcctgtgaagtaaggacagcgagaacttctggcatgctgacagttctggaagaagaagctgtctttaccaaaaatcttgccaacattgaagttagtgaaacagacactataaaactggtttgtgaagtctccaaacctggcgcagaagtgatttggtataaaggggatgaggagatcattgaaacaggaagatatgaaatactgactgaaggacggaagagaatcctggtcattcagaacgctcaccttgaggatgctggcaactacaactgtcgactcccaagctctcgaaccgatggcaaagtcaaagtacatgaactggctgctgaatttatctcaaagcctcaaaaccttgaaatacttgaaggagaaaaggctgaatttgtctgctctatatcaaaagaaagctttccagtccagtggaagagggatgataagacacttgaatctggagataaatatgacgttattgctgatggtaaaaagagggtcctagttgtgaaagatgccacattacaagatatgggcacttacgttgtcatggtaggggccgccagagcagcagctcacttgacagtcattgaaaaactcaggatcgtagttcctcttaaggacacccgggtgaaggaacaacaggaagttgtcttcaactgtgaagtcaatactgaaggtgccaaagccaaatggttcagaaatgaagaagctatatttgatagttcaaaatacatcattctccaaaaagacctagtctacaccctcagaattagagatgcacacttagatgaccaagccaactataatgtgtctttgaccaatcacagaggtgaaaatgttaaaagtgcagccaatctaatagtagaagaggaagaccttaggattgttgagcctcttaaagatattgaaacaatggagaagaaatctgtcacattctggtgcaaggtgaatcgtctcaatgtaacactgaagtggaccaaaaatggtgaagaagtgccttttgacaaccgtgtctcatacagagttgataagtacaagcacatgttaaccattaaagactgtggcttcccagatgaaggtgaatacattgtcactgctggacaagataaatctgttgctgagcttctcatcatagaagccccgacagaatttgtggaacacttggaagatcagacagtcactgagttcgatgacgctgtcttctcctgccagctctccagagagaaagccaatgtaaaatggtacagaaatgggagagaaatcaaagaaggcaaaaaatacaaatttgaaaaagatggaagtatacacagactcattataaaagattgcaggctggatgatgagtgtgaatatgcttgcggggtagaagacaggaagtctcgtgctagactttttgtggaagaaattcctgttgagatcatcaggcctccacaagatattcttgaagcccctggtgctgatgttgtctttttagcagaactcaataaagataaggtggaagtccaatggctaagaaataacatggttgttgtccagggtgataaacaccagatgatgagtgaaggaaagatacatcgactacagatttgtgatattaagccccgtgaccagggtgaatacagatttattgccaaagacaaagaagccagagctaagcttgaactggcagctgcaccaaaaatcaagacagctgaccaagaccttgtggttgatgttggcaagcctctgacaatggtggtgccatatgatgcctaccccaaagcagaagctgaatggtttaaagaaaatgaacctttatctacaaaaaccattgatactacggctgaacaaacttctttcagaattttagaagccaagaaaggagacaaagggaggtataaaattgtgcttcagaacaaacatggaaaagcagaaggattcatcaatttaaaagttattgatgttcctgggccagtacgtaacttagaagtgacagaaacatttgatggtgaagtgagccttgcttgggaagaacctttaactgatggtggaagcaaaatcataggttacgttgttgaaagacgtgacattaagagaaagacctgggttctggccacagaccgtgcagagagttgtgagtttactgtcactggtctacagaaaggaggagttgagtacctattccgtgtgagtgcaagaaacagagttggcactggtgagccagtagaaactgacaatcctgtagaagcaaggagtaaatatgatgttccaggccctcctttgaatgtaaccatcactgatgtgaatcgatttggtgtctcactgacatgggaaccaccagagtatgatggaggtgctgagatcacaaactacgtcattgaattaagagacaagacttctatcaggtgggatactgccatgactgtgagagctgaagacctgtctgcaactgttactgatgtggtagaaggacaggagtacagtttccgagtgagagcccaaaatcgaattggagttggaaaaccaagtgcagccacacccttcgtcaaagttgctgatccaattgagagaccaagtcctcctgtaaacctaacttcctcagatcagactcagtcatcagttcagctcaaatgggaacctcctctgaaagatggaggaagcccaatattaggctatataattgagcgatgcgaagaaggaaaagataattggattcgttgcaatatgaaacttgtccctgaactgacttacaaggttaccggattggaaaaaggaaataaatatttatatagagtatctgcagaaaataaagctggtgtttcagatccatctgaaattcttggtcctctcaccgctgacgatgcatttgttgaaccaacaatggatttaagtgcatttaaagatggtctggaagttattgtcccaaatcctatcacgatcctggttccaagtacaggctatccaaggccaactgcaacctggtgttttggagataaagtactagaaacaggggaccgggtgaaaatgaagaccttgtctgcctatgccgaacttgtcatttctccaagtgaacgttcagacaagggcatttatacactgaaattagaaaaccgtgtgaaaacaatttctggggaaattgatgtcaatgtaattgctcgcccaagtgcacccaaagaattgaaatttggtgatataaccaaggactcagtacatttgacttgggaaccacctgatgatgatggaggaagtccgttaactggatacgttgttgaaaaacgagaagtcagccggaaaacatggactaaagttatggactttgtgactgatctagaattcacagttcctgatcttgttcaaggaaaagagtacttatttaaagtttgtgctcgtaacaaatgtggccctggagaacctgcatatgttgatgaacctgtaaatatgtcaactcctgcaacggtacctgacccaccagagaatgttaaatggagagatcgaacagccaatagcatcttcttaacatgggatccacctaaaaatgatggtggttcacgcatcaaaggatatatagttgaaagatgtccacgtggttctgataaatgggttgcctgtggagaacctgttgcagaaacaaaaatggaagtgacaggtcttgaggaaggcaaatggtatgcctaccgcgtgaaggccttaaacaggcagggtgctagcaaaccaagcagacccacagaggaaatccaggctgtggacacacaagaggccccagaaatcttcctcgatgtgaagctccttgctggtctcactgtaaaagctgggaccaagattgaacttcctgccaccgtaaccggaaaacctgaacctaaaataacttggacaaaggctgatatgattctgaagcaggacaaaagaattaccattgaaaatgtccctaagaaatccacagtgactattgttgatagtaagagaagtgacactggcacatatatcattgaggctgtgaatgtgtgtggccgggccactgctgtggtggaagtgaacgtcttagataaacccggaccaccagctgcctttgacatcacagatgtaaccaatgagtcatgtcttctaacatggaacccaccacgcgatgatggtggatctaagatcacaaactatgttgtggagagacgagcaactgatagtgaagtgtggcacaagctctcatccaccgtcaaggatacaaacttcaaggccaccaaattaatccccaataaagagtacatcttcagagttgctgcagaaaacatgtatggtgttggtgaaccagttcaggcctctccaataacagccaaatatcagtttgatccacctggtcctccaactcgcctagaaccttctgatatcactaaagacgcagtgactctcacatggtgtgagccagatgatgatggtggcagcccaatcacaggatactgggttgaaagactggatcctgatacagataaatgggttagatgcaataagatgccagtaaaggacacaacatacagagtgaaaggtctcactaataagaaaaaatacagattccgtgtgttggctgaaaatcttgctggacctggaaaaccaagcaaatcaactgaaccaatcttaataaaggatcccatagatcctccatggccccctggaaaaccaactgtaaaagatgtaggcaaaacatcagtaaggttgaattggacaaaaccagaacatgatggaggtgcaaagattgagtcttatgtcattgaaatgctgaagactggaacagatgagtgggtcagagtggcggaaggggttcccaccactcagcacttgctcccagggctcatggaaggacaggaatactcattccgagttagagctgtgaataaggctggggaaagtgaacccagtgaacccagtgaccctgtgctttgccgggagaagctatatcctccatcaccaccacgctggcttgaagttattaatatcacaaaaaatacagcagacctaaaatggacagttcctgagaaagatggagggtcccccatcaccaactacattgtggaaaagagagacgtcaggcgaaaaggctggcaaacagtggataccactgtcaaggacaccaagtgcacagtcaccccactgactgagggctctttatatgtgttccgagttgctgcagaaaatgctataggacaaagcgactacaccgaaattgaggactctgtgctggccaaagacacctttaccactcctggaccaccctacgccctggcagtggttgatgtgacaaaacgacatgttgacctaaagtgggagccacctaaaaatgatggtggaagaccaatacagagatatgtcattgagaagaaagaaaggttaggtacccgttgggtgaaagctggaaagactgcaggacctgactgtaacttcagagtaactgatgtcatcgaaggaacagaggtccagtttcaggttcgggctgaaaatgaagctggagttggccacccaagtgaacccacagaaatcctatccattgaagatccaacaagtcctccctcaccaccccttgacctacatgtgactgatgctgggagaaaacacattgccattgcttggaagcctccagagaaaaatggtggaagtcctatcataggataccatgttgaaatgtgtccagtaggcactgagaaatggatgagagttaattctcgcccaataaaggacttgaaattcaaggttgaagaaggtgttgttcctgacaaagaatatgtcctgagagtgagagcagtcaatgctattggtgtcagcgagccatctgaaatctctgaaaatgtggttgccaaagacccagactgcaagccaacaattgacctggagactcatgacattattgttattgaaggtgaaaagttaagcattcctgttcccttcagagctgtcccagttccaactgttagttggcataaagatggcaaagaagttaaagcaagtgatagattaacaatgaagaatgatcacatctctgcacaccttgaagttcccaagagtgtccgtgcagatgccggaatttataccattacactggagaataagctcggctcagcaacagcctcaatcaatgtcaaagtcataggcctacctggaccatgcaaagatattaaagcaagtgacattaccaagagttcttgtaagttaacttgggaacctccagaatttgatggtggaaccccaattcttcattatgtcctggagcgcagagaagctgggaggagaacatatataccagtcatgtctggtgagaacaaactgtcatggactgtgaaggatctcataccaaatggtgaatacttcttccgtgttaaagcagtcaacaaggttggtggaggagaatatattgaactgaaaaatccagtcattgctcaagatccaaagcaaccccctgatccacctgtagatgtagaggttcataatcctacagcggaggcaatgactattacatggaagccacctttgtatgatggagggagcaagataatgggctacatcatagagaagattgctaagggtgaagaaaggtggaagagatgcaatgaacacctggtaccaatcctgacctatacagcaaaaggacttgaagaggggaaagagtaccaattccgtgtgcgagcagagaacgccgcgggtattagtgaaccttctcgggctactcctccaaccaaagctgtagatcccattgatgcccccaaagtcattctgagaacaagcctagaagtgaaacgaggtgatgaaatagcacttgatgcaagtatttctggatcaccttacccaactattacatggataaaggatgaaaatgttattgtaccagaggaaattaagaagcgtgcagcacccttggttaggagaaggaagggtgaagttcaagaagaagaaccatttgtcctgcctctgacacagcgtttgagtattgacaacagcaaaaagggagaatctcagctacgcgtccgagattctctccgacctgaccatggtctgtatatgatcaaagttgaaaatgaccacggtattgcaaaagctccttgtactgtcagtgtgttagatacaccgggaccaccaatcaactttgtatttgaagatatcagaaagacctcagtcctttgtaaatgggaaccaccccttgatgatggtggcagtgaaatcataaactacactttggaaaagaaagacaagacaaaacccgactcagaatggattgttgtcacttcaacacttagacattgcaaatattcagtaacaaaactgattgaaggaaaagagtacctcttccgtgtaagagctgaaaacagatttgggccaggtccaccatgtgtttcaaagccacttgtggctaaagatccatttggaccacctgatgcaccagataagcccattgtggaagatgttaccagcaacagtatgctagtgaaatggaatgaaccaaaagataatggaagccccattttgggttactggcttgaaaaacgtgaagttaacagtacacattggtctcgtgtcaacaaaagccttctgaatgccttgaaagccaatgtagatggcttattagaaggactcacctatgtcttcagagtatgtgctgaaaatgcagctggacctggaaagttcagtccaccttcagatcccaaaacagcacatgatccaatctctcctcctgggccacctatcccaagagtcactgacacaagctctacaactattgaactagaatgggaacccccagctttcaatggtggtggggaaattgttggctattttgttgataagcagttggttggcacaaatgaatggtcacgctgcacagagaagatgatcaaggtccgtcagtacaccgtcaaagaaatccgagagggtgctgattacaaacttcgggtgagtgctgtcaatgccgcaggggaaggaccgcctggagaaacacaacctgttactgtggctgaaccacaagagcctccagctgtggaactggatgtttctgtcaagggtggaatacaaataatggctgggaagactcttagaattccagctgtggtgactggtcgccctgtacctacaaaagtatggaccaaagaagaaggggagctggataaagaccgtgttgtaatagacaacgttggaaccaaatctgaactaattatcaaggatgcactgcgaaaagaccatggcagatatgtgattacagctacaaatagctgtggttccaaatttgcagcagccagggtagaagtttttgatgtccctggtccagttcttgacttaaaacctgttgtaacaaacagaaaaatgtgtctacttaactggtctgatccagaagatgatggaggaagtgaaataacaggctttatcattgaaagaaaagatgccaagatgcatacttggagacaaccaatagagactgagagatctaaatgtgacatcacaggtctgcttgagggacaagaatataagttccgtgttattgccaagaacaagtttggctgtggccctcctgttgaaataggaccaattcttgcagttgatccactaggtcctccaacatctccagagaggctcacatacactgaaaggacaaagtccactatcacacttgactggaaagagccccgcagtaatggtggcagtcccatccaaggatatatcattgaaaaacggcgtcatgacaaacctgactttgaaagagttaacaagcgactctgcccaaccacatcttttctggttgaaaatcttgatgaacaccaaatgtatgagttccgtgtcaaagctgtcaatgaaattggtgaaagtgaaccatccctacctcttaatgtagtcatacaagatgatgaagtgcctccaactattaagttgcgtctgagtgttcgaggagacactatcaaagttaaggcaggagagcctgtccacatccctgcagatgtgacaggccttccaatgcctaagattgaatggtccaaaaatgaaactgtaattgaaaaacccactgatgcacttcagataaccaaggaagaggtatcccgaagtgaggcaaaaactgagcttagcattcccaaagcggtccgggaggacaaaggcacttacacagttactgcttccaatcgccttggctcagtgttccgaaatgttcacgttgaagtatatgaccgcccatccccaccaagaaatcttgctgttactgacattaaagctgaatcttgctacttgacatgggatgcccctcttgataatggtggcagtgaaatcacccattatgttattgacaaacgtgatgcaagtaggaagaaagcagaatgggaggaagtcaccaacactgctgtagagaaaagatatgggatctggaaacttatccccaatggtcagtatgagttccgagtcagggcagtgaataaatatggaatcagtgatgagtgcaaatcagataaagtagtcattcaagatccttatcgccttcctggacctccaggaaaaccaaaagttttggcacgcaccaaaggatcaatgctagtgagctggactcctcctttggacaatggtggctctccaattactggctactggctggagaaaagagaagagggaagtccttattggtcacgtgttagccgagcaccaataaccaaagtgggattgaaaggcgtggaatttaatgttcctcgtttgcttgaaggcgttaaataccagttcagagccatggcaataaatgctgcaggaattggtcctcccagtgaaccatcagatccagaggttgcaggagatcccatatttccaccggggccaccttcttgcccagaagttaaagataaaacgaagtcaagcatctcactaggatggaaacctccagccaaagatggtggcagcccaatcaaaggatacattgtagaaatgcaagaagaaggtactactgactggaaaagagtaaatgaaccagacaaacttataactacctgtgaatgtgtggtgcctaatctgaaagagctcaggaagtacagattcagagtgaaagctgtcaatgaagctggtgaatctgaaccaagtgatacaactggggagatccctgccactgatattcaagaggaaccagaagttttcattgacattggagcacaggactgtctggtttgtaaagctggctcacagattaggattcctgctgtcatcaagggacgcccaacaccaaaatcatcttgggaatttgatggaaaggcaaagaaagcaatgaaggatggagttcatgacatacccgaagatgcacagctggagactgctgaaaactcctcagtaattattattccggagtgtaaacgatctcatacaggcaaatacagcatcacagccaagaataaagcaggacaaaagactgcaaattgcagagttaaagtcatggatgtaccaggcccacccaaagatctgaaagtcagtgatatcacaaggggtagttgcagactttcatggaagatgccagacgacgatggaggagacaggatcaaaggctatgttattgagaagaggactattgatggaaaagcctggaccaaagtcaatccagactgtggaagcaccacatttgtagtgcctgatctcctctctgaacagcaatatttcttccgtgtgcgagcagaaaaccgttttggtattggcccacctgtggaaaccattcagaggaccactgccagagatccgatatatcctcctgatcctcctattaaactcaagattggcctcatcacaaagaacacagtgcatctgtcatggaaacccccgaagaatgatgggggctcccctgttacccactatattgttgagtgccttgcatgggaccctactgggacaaagaaagaagcctggaggcagtgcaataagcgtgatgtggaagaactgcaatttactgttgaagacctagtagagggtggggaatatgaattccgagtcaaagctgtcaatgctgcaggagtcagcaagccttcagccactgttggccctgtgactgtcaaagaccagacatgcccaccatcaattgatctaaaagaattcatggaggttgaagaaggaaccaatgttaacattgtggccaaaattaaaggtgtgccattcccgacactaacctggtttaaagctcctccaaagaagcctgataacaaagaacctgttctctatgacacccatgtcaacaaactggtggtagatgatacttgcactttagttattccgcagtctcgcaggagtgacactggcttatataccatcacagctgtaaataatctgggaacagcatcaaaggagatgagactgaatgtcctgggtcgtcctggccctccagtgggacccataaaatttgaatctgtttcagcagatcaaatgacactatcttggtttccacctaaagatgatggtgggtctaagattacaaactatgtaattgagaaaagagaagctaacaggaagacatgggtccatgtctccagtgaacctaaggagtgcacgtacacgattcccaaattgctagaaggccatgaatatgtattccgaatcatggcccagaataaatatggcattggagaacctcttgacagtgaacctgaaacagcaagaaacctcttctctgtccctggagcaccagataaaccaacagttagcagcgtgactcgtaactccatgactgtcaactgggaagagccagaatatgatggaggctctcctgtgacagggtactggctggaaatgaaagacaccacttcaaagagatggaagagagttaaccgagatcctatcaaagccatgactttgggtgtttcttataaagtgactggtcttattgaaggttccgactatcaattccgggtatatgcaatcaatgctgctggcgtgggtccagcaagtctgccatcagacccagcgactgctagagatccaattgcccctcctggtcctccatttcccaaagtgacagattggactaaatcatctgcagatctggagtggtctcccccactaaaagatggtggatccaaagtaactggatacatcgttgaatataaagaagaaggaaaagaagaatgggaaaagggtaaagataaagaagtgagaggaacaaagcttgttgtgacaggattaaaggaaggagcattctacaaatttagagttagagcagtcaacattgctggcattggagaacctggagaggtcacagatgtcattgaaatgaaggacagacttgtttcacctgaccttcagctagatgccagtgtcagagatagaattgttgtccatgctggaggggtgatccgaatcattgcctatgtgtctggaaagcctcctccaaccgtcacctggaacatgaatgaaagaaccttacctcaagaagccaccattgagaccacagccattagctcatccatggtcatcaagaactgccagaggagccatcaaggcgtctattctcttcttgccaaaaatgaagccggagaaagaaagaagacaattattgttgatgtattagatgttccaggtcccgttggaacaccattcctagctcacaacctaaccaatgagtcctgcaaactgacatggttttctccagaagatgatggaggctctccaatcaccaattatgtcattgaaaagcgtgaatctgaccgcagagcatggaccccagtgacatatacagttacccgacaaaatgctactgtccagggtctcattcaaggaaaagcctactttttccgaattgcggctgaaaatagtattggcatgggtccatttgttgagacatcagaggcacttgttatcagagagccaataactgtaccagagcgtcctgaagacctggaagtcaaagaagttactaaaaatactgtaactttgacttggaatcctcctaagtatgatggtgggtcagaaattattaactatgtcctagaaagtcggctcattgggactgagaagttccacaaagttacaaatgacaacttgcttagcagaaaatacactgttaaaggcttaaaagaaggtgatacctatgagtaccgtgtcagtgctgtcaacattgttggacaaggcaaaccatcattttgcaccaaaccaattacttgcaaggatgagctggcacccccaacgcttcacctcgacttcagagataagctcacgattcgagttggtgaagcttttgccctcactggccgttactcaggcaaaccaaagcctaaggtttcctggttcaaagatgaagctgatgtgctggaagatgatcgcactcatataaagactacaccagcaacacttgctttagagaagatcaaggccaaacgttcagattccggcaaatactgtgtggttgtggagaacagtacaggctctaggaaaggtttctgtcaagttaatgttgttgaccgtcctggaccaccagtaggaccagttagttttgatgaggtgaccaaagattacatggttatctcttggaagcctcctttagatgatggaggcagtaaaatcaccaattatattattgagaagaaggaagtgggtaaagacgtctggatgccagtgacatctgcaagtgctaaaacaacatgcaaagtttctaaactacttgaaggaaaagattatattttccggatacatgctgaaaatctgtatggaataagtgatcctctggtgtctgattcaatgaaagccaaagatcgtttcagggttcctgatgcacctgatcagccaattgttacagaagttaccaaagactctgcattagtaacctggaataagccacatgatggaggaaaacccatcacaaactacatcctggaaaagagagaaactatgtctaaacgatgggctagagttaccaaagatcctattcatccatacactaaatttagggttcctgatcttctagaaggatgtcagtatgaattccgggtttctgcagaaaatgaaattggtattggagatccaagcccaccatccaaaccagtctttgctaaagatccaattgctaaaccaagtccacctgttaatcctgaagcaatagatacaacatgcaattcagtcgatctaacttggcagccaccacgtcatgatggtgggagcaagattctgggttatattgttgagtaccagaaagttggagatgaagagtggagaagagccaatcacacccctgagtcatgtcctgaaactaaatataaagtcaccggtcttcgggacggtcaaacctataagtttagagtgttagcagtcaatgcagctggtgaatcagatccagctcatgttccggagccagtcctagtaaaagacaggcttgaaccccctgagttgattcttgatgccaacatggcaagagaacaacacattaaagttggtgatactctaagacttagtgccatcatcaaaggagtgccattcccaaaagtaacttggaaaaaagaagacagagatgctccaactaaagcaagaattgatgtgactccagttggtagcaagcttgaaattcgtaatgctgcccatgaagatggtggaatttattctttaacagtggagaatccagctggttcaaaaactgtctcagtaaaagtacttgtattagataaacctgggccacctagagatctggaagtcagtgaaattaggaaagattcatgttaccttacttggaaagaaccactggatgatggtggttctgttattaccaattatgtggttgagaggagagatgttgccagcgcccagtggtcacctctctcagctacatcaaagaaaaagagtcacttcgctaagcatctgaatgaaggcaaccagtacctcttccgagtagctgcggagaaccagtatggacgtggtccttttgttgaaacaccaaaaccaatcaaggctttggatcctctccatcccccagggccacccaaggacctgcaccatgtagatgttgacaagactgaagtctccctagtctggaataagccggatcgtgatggtggttctccaatcactggatatttggtagaatatcaagaagaaggcacccaggactggattaaatttaagactgtgacaaacttagagtgtgtggttactggactacaacaaggaaagacctatagattccgtgtaaaagctgaaaacattgtgggtcttggtctccctgacacaactatcccgatagaatgtcaagaaaaactagtgcctccatccgtggagctagatgtgaaattaattgaaggtcttgtggtaaaggctggaaccacagtcagattccctgctattataagaggtgtgcctgttcctactgcaaagtggacaaccgatgggagtgagattaaaaccgatgagcactacacagttgaaacagacaacttctcatcagtacttaccattaagaactgcttaaggagagacactggggaatatcaaatcacagtttccaatgcagccggtagcaaaacagtagccgtacatcttactgttcttgatgttcctgggccaccaacaggtcctattaatattctggatgttactcctgaacacatgactatctcatggcagccacctaaggatgatggaggaagccctgtgataaattatattgttgagaaacaagatacaaggaaagacacgtggggtgttgtctcttccggaagcagtaagacaaagctgaaaatcccacatctgcagaagggctgtgaatatgttttccgagttagagcagagaataagataggtgttggtcctccccttgactccacacctactgttgctaagcataaatttagtcctccgtctcctcctggtaaaccagtggttactgacattactgaaaatgcagcaacagtgtcttggaccctgccaaaatctgatggtggcagtccaataactggctactatatggaacgtcgagaagtaactggcaaatgggtgagggtcaacaaaacacctatcgctgacctgaagttcagagtgactggactctatgaaggaaatacatatgagtttagagtttttgctgaaaatcttgcaggactaagcaaaccatccccaagttctgatccaataaaagcttgccggcccatcaaaccacctggaccacctattaatcctaaactgaaagacaagagcagagaaacagctgatttggtgtggacaaagcctctcagtgatggtggtagccccattctaggatatgtagtggaatgtcagaaacctggcacagcacaatggaacaggattaataaagatgaactcattaggcaatgtgcctttagggtacctggactaattgaaggaaatgagtacagattccgtataaaggcagctaatattgtaggagagggtgagccaagagaactagcagaatctgtgattgcaaaagatatccttcatcctccagaagtagaacttgatgttacttgtcgtgatgttattaccgtgagagtaggccaaactatccgcattctagctcgagtcaaaggcagacctgaaccagacataacttggactaaggaaggcaaagtattggtccgagaaaagagggtggaccttattcaggatctacctcgtgttgagttacaaattaaagaagctgttagagctgatcatggcaagtatatcatctcagctaagaacagcagtggacatgcccaaggttcagccatcgttaacgtccttgacagacctgggccttgccagaatttgaaggttaccaatgtaaccaaagagaactgtacaatttcttgggaaaacccactagataatggtggctcagaaataacaaacttcatagtagaatatcgcaaaccaaaccagaaaggctggtcaattgttgcatcagatgtcactaaacgattaatcaaggccaaccttttagccaacaatgaatactatttccgagtttgtgcagagaataaagtaggtgttgggccaaccatcgaaacaaaaactcccattctggctattaaccctattgacagaccaggtgagcctgaaaaccttcacattgcagataaaggaaagacatttgtctatctaaagtggcggaggcctgactatgatggtggcagtccaaatctgtcatatcatgttgagagaaggcttaagggctccgatgactgggaaagagtgcataaaggaagcattaaagaaactcactacatggttgacagatgtgttgaaaaccagatttatgagttcagagtgcaaacaaagaatgaaggtggggaaagtgactgggtgaagacagaggaagttgttgtgaaagaagacttacaaaaaccagtacttgatctgaaattaagtggggtcctaactgtcaaagcaggggacaccattaggcttgaggcaggggttagaggcaaaccattcccagaagttgcatggaccaaggacaaagacgctacagacttaacaagatcaccaagggtcaagattgatacccgtgctgattcatctaaattttctcttactaaagcaaagcgaagtgatgggggtaaatatgtagttacggcaactaacacggctggcagttttgtggcctatgccactgtcaatgttttagataagcctggtcctgtgagaaatctgaaaattgttgatgtgtccagtgataggtgtactgtttgctgggatccaccagaagatgatggtggctgtgaaatccaaaattatattctagaaaaatgtgagacaaagcgaatggtttggtctacctattctgctactgtcttgacacctggtactacagtaacacgtctcatagaaggaaatgaatatattttcagagtccgtgcagaaaataaaataggcacagggcctccaacagaaagtaaaccagtcatagccaaaaccaagtatgataaacctggtcgccctgatcccccagaagtcactaaagtaagcaaagaagagatgactgtggtttggaatccacctgaatatgatggtggaaagtctataactggatactttttggagaaaaaggaaaagcattcaacacgatgggtccctgtcaacaagagtgcaatccctgagagacgtatgaaagtacagaatctcctcccagaccatgaatatcagttccgtgtcaaggcagaaaatgaaattggaattggagaaccaagcttgccttcaagaccggtggtggcaaaagaccccatagagccacctggtccaccaaccaatttcagagtggttgatacaaccaaacattccataactcttgggtggggaaaaccagtctatgatggtggtgcaccgatcattggatatgttgtggaaatgagaccaaaaatagcagatgcgtctcctgatgaaggctggaaacggtgtaatgctgcagcacagcttgtacgcaaggaattcactgttaccagcttggatgaaaaccaggaatatgagttcagggtgtgtgcccaaaaccaagttggtattgggcgccctgcagagctaaaggaagctatcaaacctaaagaaatactagaacctccggagattgatttggatgccagcatgaggaaactggtcatagtgagagcaggatgccctattcgtctctttgctatagtgagaggacgaccagcccctaaagtcacttggcgaaaagttggcattgataatgtggtcagaaaaggacaagttgatctggttgacactatggccttccttgtcatccccaattctacccgtgatgactcaggaaaatattccttaacacttgtgaacccagcaggagaaaaggctgtattcgtaaatgtcagagtattagacactcctgggcctgtgtctgatttaaaagtttcagatgtcactaaaacatcatgccatgtgtcctgggcccctcctgaaaacgacggtgggagccaagtgacacattatatcgtggagaaacgtgaggcagacagaaagacatggtcgaccgttaccccagaagttaagaaaacaagcttccatgtaaccaatcttgtccctgggaatgagtattacttcagagtaactgctgtcaacgaatatggccctggcgtcccaacagatgtcccaaaaccagtgcttgcatcagatcctctaagtgagccggatcccccaaggaaattagaagtgactgaaatgaccaagaacagtgccaccttagcctggttacctcccctacgtgatggaggtgctaaaatcgatggctacatcactagttacagagaagaagagcagcctgcagatcgctggacagagtactcagtggtaaaagatctgagccttgttgtcactggcctaaaggaaggaaagaaatacaaatttagagtagcggccagaaatgctgttggagtcagtttgccaagagaagctgaaggagtgtatgaagccaaagaacaactgttgccaccaaagatccttatgccagagcaaataactatcaaagctgggaaaaaactccgaattgaagcccatgtgtatggaaagcctcatcccacctgtaaatggaaaaaaggagaagatgaagttgtcacatccagccacctggcagtgcataaagcagacagctcttcaattctgatcataaaagatgtgactaggaaagacagtggttactacagcctcacagcagagaacagttctgggacagacactcagaaaatcaaagttgtagtcatggatgcccccggcccccctcagcctccatttgacatttctgatatagacgctgatgcttgctccctgtcatggcacatccctctggaggacggaggcagtaacatcaccaattatatagtggagaagtgtgatgtaagccgaggtgactgggtcacggctctagcttcagtcacaaaaacttcctgcagggttggaaagctgatcccaggccaggagtacatcttccgggtccgtgctgaaaaccgatttggcatttcagagcctctcacatctccaaagatggttgcgcagttcccatttggtgttcctagtgaaccaaagaatgcacgagtcaccaaagtcaacaaggactgtatttttgttgcttgggacagaccagatagtgatggagggagccccattattggttatctgattgaacgcaaggaaagaaacagtttgctgtgggtgaaagccaatgatactcttgtccggtcaactgaatatccttgtgctggccttgtagaaggtcttgagtattcattcagaatctatgccctaaacaaagctggatccagcccacccagcaaacccacagaatatgtaactgcaagaatgccagttgatcctcctgggaaacctgaggttattgatgtcaccaagagtactgtatctctgatctgggctcgtccaaagcatgatggaggcagtaaaattattggctatttcgtagaagcttgcaaacttcctggtgataaatgggtacggtgcaatactgcacctcaccagattccccaggaagagtacacagctactggcctagaagagaaagctcagtatcaatttagagctattgccaggaccgcggtaaacattagcccaccttctgaaccttctgatccagtgactatcctcgcagaaaatgtccctcccaggatagacctgagtgtggctatgaaatctttgcttactgtgaaagctggaactaatgtctgcttggatgctactgtttttggtaaaccgatgccaacagtttcttggaaaaaagatggcacactgctaaaaccagcagaaggcataaagatggccatgcagcggaatctgtgcaccttggagctattcagcgtgaaccggaaggactcaggagactataccattactgctgaaaattcaagtggttctaaatcagccaccattaagcttaaagtgttagataaaccgggtcctccagcatctgttaaaatcaacaaaatgtattcagatcgtgctatgctttcttgggaaccgcctcttgaagatggaggctcagaaatcaccaactatattgttgacaaacgtgaaacaagcaggcccaactgggctcaagtctctgcaactgtgcctatcaccagctgcagcgtggagaaacttatagagggccatgagtatcagttccgtatttgtgctgaaaataaatatggagtaggcgatccagtcttcactgaaccagcaattgccaaaaacccatatgacccaccaggacgctgtgatcctcctgttattagcaacataaccaaagatcacatgacagtcagctggaagccaccagcagatgatgggggctcacccatcactggctatttgcttgaaaagcgggaaacccaggctgttaactggactaaggtcaacagaaaacctattatagaaagaacattaaaagcaacaggtcttcaagaaggtaccgaatatgagttccgtgttacagctataaataaagctggaccaggcaaacccagtgacgcatccaaggccgcttatgctcgggaccctcagtatcctcctggcccaccggctttccctaaagtatatgatacaactcgcagctctgtgagtctatcttggggcaagccagcctatgacggcggcagccctatcattggttatctcgttgaagtaaaacgggctgactccgataactgggtgaggtgcaacttaccacagaatctacagaaaacccgctttgaggttactggcctgatggaagacacacaatatcaattccgtgtgtatgccgttaataagattggatacagtgaccccagtgatgtgccagataaacactatcccaaggacatcttaattccacctgagggagaacttgatgcggacttaaggaagacactcatattacgtgctggagttactatgagactatatgtaccagtaaaaggacgcccacctccaaagattacttggtctaaaccaaatgtcaatctaagagacaggattggactggacataaagtcaactgactttgacactttcttgcgctgtgaaaatgtgaacaaatatgatgcaggaaaatatatcttaaccctggagaacagctgtggtaaaaaggaatataccattgttgtgaaagtgcttgatactcctgggccacctgtcaatgtgactgttaaggaaatatccaaagactctgcttatgttacctgggagcctcccattattgatggcggaagccccatcataaactatgtggtacaaaaacgtgatgcagagaggaaatcctggtctacagtgacaactgagtgctccaaaacaagcttcagagtagctaatttggaggagggaaaatcctacttcttccgagtgtttgctgaaaatgagtatggcattggtgatcccggtgaaactcgtgatgctgtcaaagcttcccaaactcctggaccagttgtggacctgaaagtgaggtctgtatctaagtcatcctgtagcattggctggaaaaagcctcacagtgatggtggaagtcggattattggatatgtagttgatttcctgactgaagaaaataagtggcaacgagttatgaaatccttaagcctacagtactctgcaaaagatttgactgaagggaaggaatataccttcagagtgagtgctgagaatgaaaatggagaaggaaccccaagcgaaatcactgttgtggcaagggatgatgttgtggctcctgatcttgacttaaagggtctacctgatttgtgctacttggctaaagaaaacagcaacttccggcttaagatccccataaaaggcaagccagctccatcagtctcctggaagaaaggggaagatcctctagcaactgacactagagtcagtgttgagtcatctgcggttaacacaactcttatagtgtacgattgccaaaaatctgatgctggaaaatacacaatcacacttaagaatgttgctggcaccaaggaaggaactatctccataaaggttgttggcaagcctggcatccccactggaccaatcaaatttgatgaagtcacagcagaagccatgaccttaaagtgggctcctccaaaggatgatggaggttctgaaatcaccaactatatcctagagaagagggattctgtgaacaacaagtgggtgacgtgcgcctcagctgtccagaaaaccacctttagagtaaccagacttcatgagggcatggaatataccttcagggtcagtgccgaaaataaatatggtgtaggggaaggcctgaaatcggagccaattgttgcgagacatccatttgatgtgcctgatgctcccccacctcccaatattgtggatgtcagacacgattcagtatctctaacttggactgaccccaagaaaactggtggttctccaattacagggtatcatctcgagttcaaggaaagaaacagccttttgtggaagagagctaacaagactccgataaggatgagagactttaaagtgacaggattaactgaaggtcttgaatatgaattccgagttatggcaatcaatttagcaggtgtgggcaagccaagcctaccatcagagcctgttgtggcactggacccaattgatcctcctggaaaacctgaggttattaacataacaaggaattcagtgactctcatttggactgaacctaaatatgacggtggtcataagttaactggatatatagtggagaagcgagatctaccttcgaagtcttggatgaaagccaaccatgttaatgtcccagaatgtgcctttactgtaactgaccttgttgagggtggaaaatatgaattcagaattagagcaaagaatacagcaggtgctatcagtgctccatcagaaagtacagaaaccattatttgcaaggatgaatacgaggcaccaacaattgtccttgatcccacaataaaagatgggctaacaattaaagcaggggataccattgttttgaatgccattagcattcttggcaaaccccttccaaaatcaagttggtccaaggcaggaaaagacattagaccatcagatatcactcagataacttcaaccccaacatcttccatgcttactatcaagtatgccactagaaaagatgcgggtgaatataccatcactgctaccaatccttttggcacgaaggtggaacatgtgaaggtaacagtccttgatgtacctggtcccccaggtcctgttgaaatcagtaatgtttctgctgaaaaagcaacacttacatggacacctcccttggaagatggcggctcaccaattaagtcctatatacttgaaaagagagaaaccagccgacttttgtggacagtggtttctgaagatattcagtcttgcaggcatgtggcaaccaaacttatccaaggaaatgagtacatcttccgggtctcagctgtaaaccactatggcaaaggagaacctgtacagtctgaacctgtcaaaatggtagacagatttggtccccctggccctcctgaaaaaccagaggtatcaaatgtcactaagaacactgccactgtcagctggaaaaggccagtggatgatggtggcagcgaaattacaggatatcatgtagaaaggagagaaaagaaaagcctgcgatgggtgagagcaataaaaacaccagtttccgatctcaggtgcaaagtaacaggactgcaagaaggaagcacctacgaattccgtgtcagtgcagaaaacagagcaggaattggtccacccagtgaggcttcagattctgttctgatgaaagatgcagcatatcctccaggaccaccttcaaatccgcatgtcactgatactaccaagaaatctgcttctttggcatggggcaagcctcattatgatggtggacttgaaatcactggctatgtcgtggagcatcaaaaagtaggagacgaggcctggataaaagataccacaggaaccgccctcagaatcactcagttcgttgttcctgatcttcagactaaagaaaaatacaacttcagaatcagtgccatcaacgatgcaggtgttggggagccagcggtgattccagatgttgaaatcgtagaacgggagatggctcctgattttgaactagatgccgagcttcgaagaacacttgttgttagagcaggactcagtattaggatatttgtgccaattaaaggtcgtcctgctcctgaagtgacatggaccaaagataacatcaacctgaaaaaccgagccaacattgaaaatacggaatcatttactcttctgattatcccagaatgtaacagatatgataccggtaaatttgtcatgaccattgaaaacccggctgggaagaaaagtggctttgtgaacgtcagagtcttggacacgccaggcccagtcctcaacctgcggcctacagacatcacaaaggacagtgtcaccctgcactgggacctccctctgatagatggaggctcacgtataacaaactacattgtagagaaacgtgaagcaacacggaaatcttattccacagccaccactaagtgccataaatgcacatataaagttaccggcttgtctgaagggtgtgaatatttcttcagagtgatggcagagaatgaatatggaattggtgagccaacagaaactacagagcccgtaaaagcctctgaagcaccatctccaccagacagccttaacatcatggacataactaagagcaccgtcagcctggcatggcctaagcccaaacacgatggtggcagcaagatcactggctatgtgattgaagcccaaagaaaaggctctgaccagtggacccacatcacaaccgtgaaagggttagaatgtgttgtgaggaatctaactgaaggagaggaatataccttccaagtgatggcagtgaacagcgcggggagaagtgcccctagagaaagcagacccgtcattgtcaaggagcagacaatgcttccagagctggatctccgtggcatctatcagaaactggtcattgccaaagctggtgacaacatcaaagttgaaattccagtgctcggtcgaccgaagcccacagtgacatggaaaaaaggagaccaaattcttaaacagacacagagagttaattttgaaaccacagcgacttcaaccattttaaatatcaatgagtgtgtcagaagtgatagtgggccctatccattaacagcaaggaacattgtaggagaggttggtgatgtcatcaccattcaagtccatgatatcccagggccacctactggaccaatcaaatttgatgaagtttcatctgattttgtaaccttctcttgggacccacctgagaacgatggtggtgtaccaataagcaactatgtagtggaaatgcggcagactgacagtactacctgggttgagttagcaaccaccgttatacgtactacctataaagccacccgccttactactggattagagtatcagttccgtgtaaaagctcagaatagatatggagttggaccaggcatcacatcagcatgcatagttgccaactatccatttaaggttcctggacctcctggtacccctcaggtaactgcagttaccaaggattcaatgacaattagctggcatgagccactttctgatggtggaagccccattttaggatatcatgttgaaagaaaagaacgaaatggtattctctggcagactgtgagcaaagctttagtaccaggcaacattttcaaatcaagtggacttacagatggtattgcttatgagttccgggtgattgcagaaaacatggcaggcaaaagtaagccaagcaagccatcagaacctatgttggctctggatcccattgacccacctggaaaaccagtacctctaaatattacaagacacacagtaacacttaaatgggctaagcctgaatatactgggggctttaaaattaccagttatatcgttgaaaagagagaccttcctaatggacggtggctgaaggccaacttcagcaacattttggagaatgaatttacagtcagtggcctaacagaagatgctgcatatgaattccgtgtgatcgccaaaaatgctgcaggtgccatcagtccaccatctgagccatctgatgctatcacttgcagggatgatgttgaggcaccaaagataaaggtggatgttaaatttaaggacacggttatattaaaagcaggtgaagcattcagactggaagctgatgtttcaggccgcccacctccaacaatggaatggagcaaagatggaaaagagctggaaggcacagcaaagttagaaataaaaattgcagatttctctactaatctggtaaacaaagattcaacaagaagggatagtggtgcctatacccttacagcgactaatcctggtggctttgctaaacacattttcaatgtcaaagttcttgacagaccaggcccacctgaaggacctttggctgtaactgaagtgacatcagaaaagtgtgtactatcatggttccctccactggatgatggaggtgccaaaattgatcattacatagtacagaaacgtgaaaccagcagattggcatggacaaatgtagcctcagaagtccaagtaacaaagctaaaggtcactaaactcttgaaaggcaatgaatacatattccgtgtcatggctgtaaataaatatggagtgggagagccactggaatcagagcctgtgcttgcagtgaatccttatggaccccctgatccgcccaaaaaccctgaagtgacaactattactaaagattcgatggttgtctgctggggacatcctgattctgatggtggaagtgaaatcatcaattatattgtggaacggcgtgataaagctggccaacgctggattaaatgcaacaaaaaaactcttactgatttaagatataaagtgtctggactgacagaaggacatgaatatgagttcaggattatggctgaaaatgctgctggaattagtgcaccaagtcctaccagtccattttacaaggcttgtgacactgtgtttaaacctggaccaccaggtaacccacgtgttctggatacaagcagatcatccatttcaatcgcttggaataaacctatctatgatggtggttcagaaatcactgggtatatggttgagattgccctgccagaggaagatgaatggcagattgtcactccaccagcaggactcaaggcaacttcgtatactatcactggcctcacagagaatcaggaatataagatccgcatctatgccatgaattccgaaggacttggggaacctgcccttgttcctggaactccaaaggctgaagacagaatgctgcctccagaaattgaactggatgctgacctgcgcaaagttgttactataagggcctgctgcaccctgagactttttgttcccatcaaaggaaggcctgcacctgaggtgaagtgggcccgggaccatggagaatctttagataaagctagcatcgaatccacaagctcttacaccctgcttattgttggaaatgtaaacagatttgacagtggcaaatatatactaactgtagaaaatagttcaggcagcaagtctgcatttgtcaatgttagagttctcgatacaccaggccccccacaggatctgaaggtaaaagaggtcactaagacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaagaactatattgttgaaaagcgggaatcaacaagaaaagcatattcaactgttgcaacaaactgccacaagacttcctggaaggtagaccagcttcaagaaggctgtagctactatttcagggttctcgcagaaaatgaatatggcattgggctgcctgctgaaaccgcagaatctgtgaaagcatcagaacgacctcttcctccaggaaaaataactttgatggatgtcacaagaaatagtgtgtcactctcttgggagaaaccagagcatgatggaggcagccgaattctaggctacattgtggagatgcagaccaaaggcagtgacaaatgggccacgtgtgccacagtcaaggtcactgaagccactatcactggattaattcagggtgaagaatactctttccgtgtttcagctcagaatgaaaagggcatcagtgatcctagacaactgagtgtgccagtgatcgccaaagatcttgtcattccaccagccttcaaactcctgttcaatactttcactgtactggcaggtgaagacctaaaagttgatgttccattcattggccgccctaccccagctgtaacctggcataaagataatgtaccactgaagcagacaactagagtaaatgcagagagcacagaaaataattcactactgacaataaaggacgcctgccgagaagatgttggccattatgtggttaaactgactaactcagctggtgaagctattgaaacccttaatgttatcgttcttgacaaaccagggcctccaactggaccagttaaaatggatgaagtgacagctgatagtattactctttcctggggcccacccaagtatgatggtggaagttctatcaataattacattgttgagaaacgggacacttccacaaccacctggcaaattgtatcagctacagttgcaaggacaacaataaaggcttgcagactgaagactggatgtgaatatcagtttagaattgcagctgaaaacagatatgggaagagtacctacctcaattcagagcctactgtagcccaatatccattcaaagttcctggtcctcctggcactccagttgtcacactgtcctccagggacagcatggaagtacaatggaatgagccaatcagtgatggaggaagtagagtcattggctatcatctagaacgcaaggaaagaaatagcatcctctgggttaagttgaataaaacacctattcctcaaaccaagtttaagacaactggccttgaagaaggtgttgaatatgaatttagagtctctgcagagaacatcgtgggcattggcaagccgagtaaagtatcagaatgttatgtggctcgtgacccatgtgatccaccaggacggccagaggcaatcattgtcacaaggaattctgtgactcttcagtggaagaaacccacctatgacggtggaagcaagatcactggttatattgttgagaagaaagaattacctgagggccgttggatgaaagccagttttacaaatattattgacactcattttgaagtaactggcctagttgaagatcacagatatgagttccgggttatagcccgaaatgccgcaggagtgtttagtgagccttcagaaagcacaggagcaataacagctagagatgaggtagatccaccacgaataagtatggatccaaaatacaaagacacaatcgtggttcatgctggtgaatcattcaaggttgatgcagatatttatggcaaaccaataccaaccattcagtggataaaaggtgatcaggagctttcaaacacagctcgattagaaataaagagcaccgactttgccaccagtctcagtgtaaaagatgcagtacgtgtcgacagtggaaattacatactgaaggccaaaaatgttgcaggagaaagatcagttactgtgaatgtcaaggttcttgacagaccagggccacctgaaggacctgttgttatctcaggagttacagcagaaaaatgcacactagcttggaaacccccacttcaggatggtgggagtgacatcataaattatattgtggaaaggagagaaaccagccgcttagtttggactgtggttgatgccaatgtgcagactctcagctgcaaggttactaagcttcttgaaggcaatgaatatactttccgtataatggcagtaaacaaatatggtgttggtgaacctcttgaatctgagccagtagttgccaagaatccatttgtagtaccagatgcaccaaaagctccagaagtcacaacagtgaccaaggactcaatgattgttgtatgggaaagaccagcatctgatggtggtagtgaaattcttggatatgttcttgagaaacgggataaagaaggcattagatggacaagatgccataagcgtctgattggagagttgcgcctgagagtaactggactcatagaaaatcacgattatgagttcagagtttctgctgagaatgctgctggacttagtgaaccaagccctccttctgcttaccaaaaggcttgtgatcctatttataaaccaggacccccaaacaaccccaaagtcatagacataaccagatcttcagtattcctttcttggagcaaaccaatatatgatggtggctgtgaaattcaaggatacattgttgaaaaatgtgatgtgagtgttggtgaatggacaatgtgcactccaccaacaggaattaataaaacaaacatagaagtagagaagctgttggaaaagcatgaatacaacttccgtatctgtgctattaataaagctggagttggagaacatgctgacgtccctggacctattatagttgaagaaaaattagaagcaccagacattgatcttgacctagaactaaggaaaatcataaatataagggcaggtggctccttaaggttatttgttcctataaaaggtcgtcctacaccagaagttaaatggggaaaggtggatggtgaaatccgagatgcagctataattgatgtcactagcagtttcacctctcttgttcttgacaatgtcaaccgatatgatagtggaaaatatacgcttacattagaaaacagcagtggaacaaagtctgcctttgttactgtgagagttctggacacgccaagtccacctgttaacctgaaagtcacagaaatcaccaaagactcagtatcaattacatgggaacctcctttgttggatgggggatccaaaataaaaaattacattgttgagaaacgtgaagccacaagaaaatcatatgctgctgttgtaactaactgccataagaattcttggaaaatcgatcagctccaagaaggttgcagttattactttagagtcacagctgagaatgagtatggtattggccttcctgcccagactgctgatccaattaaggttgcagaagtgccacaacctcctggaaaaataactgtggatgatgtcaccagaaacagtgtctctctgagttggacaaaacctgaacatgatggtggcagtaaaatcattcagtatattgtggaaatgcaagctaaacacagtgagaaatggtcagagtgtgctcgagtaaagtctcttcaggcagtaattaccaacctaactcaaggggaagaatatctttttagagttgttgctgtaaatgaaaaggggagaagtgatcctcggtcccttgcagttccaatagttgccaaagatctggtaattgagccagatgtaaaacctgcattcagtagttacagtgtacaggttggccaagatttgaaaatagaagtgccaatttctggacgtcctaagccaaccattacctggactaaagatggtctcccactgaagcagaccacaagaatcaatgttaccgattcactggatctcaccacactcagtattaaagaaactcataaggatgatggtggacaatatggaatcacagttgccaatgttgttggtcagaagacagcatccatcgaaattgtaactctagataaacctgatcctccaaaaggacctgttaaatttgatgacgtcagtgctgaaagtattacattatcttggaaccctccattatatacagggggctgccaaatcaccaactacattgttcagaaaagagatacaaccaccacagtatgggatgttgtttctgctactgttgctagaactacactcaaagtgaccaaactgaaaactggtacagaataccaatttagaatatttgccgaaaacagatatggacaaagctttgccttagagtctgatccaattgtagctcaatatccctacaaagaaccaggccctccaggtacaccatttgccacagccatttccaaagactccatggtcatacagtggcatgaaccagtcaacaatggtggaagccccgtcataggttaccacctggagagaaaagaaagaaacagtattttgtggacaaaggtcaacaaaactattattcatgacacccaattcaaagcacagaatcttgaagaaggcattgaatatgaattcagagtgtatgctgaaaatattgttggtgtaggcaaagcaagcaagaattctgaatgctatgtagccagagatccctgtgacccaccaggaaccccagaaccaataatggttaaaagaaatgaaatcactttacagtggaccaaacctgtgtatgatggtggaagtatgattacaggctacattgtagagaaacgtgatttgcctgatggtcgttggatgaaagctagctttacaaatgtcattgaaactcaatttactgtgtcaggtcttactgaagatcaaagatatgaattcagagtcattgcaaagaatgcagctggtgcaataagtaaaccctctgacagtactggaccaataactgccaaggatgaggttgaactcccaagaatttcaatggatccaaaattcagagacacaattgtggtaaatgctggagaaacattcagacttgaggctgatgtccatggaaagcccctacctaccattgagtggttaagaggagataaggaaattgaagaatctgctagatgtgaaataaagaacacagatttcaaggctttacttattgtaaaagatgcaattagaattgatggtgggcagtatattttaagagcttccaatgttgcaggttctaagtcattcccagtaaatgtaaaagtattagatagaccaggacctccagaagggccagtccaggttactggagtcacttctgaaaaatgctctttaacatggtctccaccacttcaagatggtggcagtgacatttctcactatgttgttgaaaagcgagaaaccagtcgacttgcctggactgttgttgcttcagaagttgtgaccaattctctgaaagttaccaaactcttagaaggtaatgaatatgttttccgtataatggctgtcaacaaatatggtgttggagagcctttggaatctgcaccagtactaatgaaaaatccatttgtgcttcctggaccaccaaaaagcttggaagtcacaaatattgccaaagactccatgaccgtctgttggaaccgtccagatagtgatggtggaagtgagattattggttacattgtagagaaaagagacagaagtggcattcgatggataaaatgtaataaacgccgcattacagatttgcgtctaagagtgacaggattaacagaagatcatgagtatgaattcagggtctctgcagaaaatgctgctggagttggggaaccaagtccagctacagtttattataaagcctgtgatcctgtgttcaaacctggcccacctaccaatgcacacattgtagacaccactaaaaattcaatcacacttgcctggggtaaacccatctatgatggcggcagtgagatcttgggatatgtagtagaaatctgtaaagcagatgaagaagaatggcaaatagttactccacagactggcctgagagtcactcgatttgaaatttcaaaactcactgaacaccaagagtataaaatacgagtctgtgccctcaacaaagttggtttaggtgaggctacatcagttcctggtactgtgaaaccagaagataaacttgaagcacctgaacttgaccttgactccgaattaagaaaaggaattgttgtaagagctggtggatctgccagaattcacattccattcaaaggtcgtccaacgcctgagatcacttggtctcgagaggaaggtgaattcacagataaggtccaaattgaaaagggagtaaactatacccaactatcaatagataactgtgatagaaatgatgctggaaaatacattcttaagttggaaaacagcagtggatcaaagtctgcttttgtaactgtgaaagttcttgacactccaggaccaccacagaatttggcagtcaaagaagtgagaaaagattctgccttcctggtatgggagccacccatcattgatggaggggcaaaggtcaagaactatgtgattgacaaacgtgagtcaaccagaaaagcgtatgctaatgtgagtagtaaatgcagcaaaacaagttttaaagtggaaaaccttacagaaggagccatttattacttcagagtcatggctgaaaatgaatttggagttggtgttccagtggaaactgttgatgccgtgaaagctgctgaacctccttccccaccaggaaaggttacactcactgatgtgtcccagaccagtgcatcacttatgtgggagaaacctgaacatgatggcggtagcagagtcctggggtacgttgttgaaatgcagcccaaaggaactgaaaaatggagcattgtggctgaatccaaagtctgtaatgcagttgttactggtttgagttctggacaagaatatcagttccgtgtcaaggcttataatgagaaaggaaaaagcgatccaagagtgttgggtgttcctgtcatagccaaggacttgactatacagcctagtttaaagttaccatttaacacatatagtatccaagctggagaagatcttaaaatagaaattccagttataggccgaccaagacctaacatttcttgggtcaaagatggtgagcctcttaaacagacaacaagagtaaacgttgaagaaacagctacctcaactgttttgcacattaaagaaggtaacaaagatgactttggaaaatacaccgtaacggcaacaaatagtgcaggcacagcaacagaaaatctcagtgttatcgttttagaaaagcctggacctccagttggcccagttcggtttgatgaagttagtgcagactttgtagtcatatcttgggaacctccagcctatactggtggctgccaaataagcaactacattgtagagaagcgagatacaaccaccaccacttggcacatggtatcagcaacagttgcaagaacaacaattaaaataaccaaactgaaaacaggcacggagtaccagtttagaatttttgctgaaaacaggtatggaaaaagtgccccactggattctaaggcagttattgtacaatatccatttaaagaacctggaccacctggaactccttttgtgacatcaatctcaaaagatcagatgcttgtgcaatggcatgagccagtgaatgatggaggcaccaaaattattggctaccatcttgaacagaaagaaaagaacagtattttatgggtcaagttaaataagacccccattcaggacaccaaattcaaaacaactgggcttgatgagggccttgagtatgagttcaaagtttctgctgaaaatattgttggcattggcaagcctagcaaagtgtcagaatgctttgttgctcgtgatccatgtgacccacctggtcgccctgaagccattgttattacaagaaacaatgtcacactgaaatggaagaaacctgcctatgatggtggtagcaaaataacaggttatattgtagaaaagaaagatctacctgatggccgctggatgaaagccagctttaccaacgtattagaaactgaatttacagtgagtggacttgtagaagaccaaagatatgaatttagagtaattgcaagaaatgcagctggaaactttagtgaaccatctgatagtagtggtgccattactgcaagagatgaaattgatgcaccaaatgcctctctggatccaaaatataaagatgtcatcgttgttcatgcaggagagacttttgttcttgaagccgacatccgtggcaaacctatacctgatgttgtttggtcaaaagatggaaaagaacttgaagaaacagctgctagaatggaaattaaatctactattcagaaaacaactcttgttgtcaaagactgtatacggactgatggaggacaatatattctgaaactcagcaatgttggtggtacaaagtctatacccatcactgtaaaggtacttgacaggccagggcctcctgaagggcctctgaaagttactggagttactgcggaaaaatgttacctggcatggaacccacctttgcaagatggtggtgctaatatttcacattacatcattgaaaagagggagacaagccgactctcttggacccaggtttcaactgaggtacaggcccttaactacaaagttactaaacttcttcctggtaatgagtacattttccgtgtcatggctgtgaataaatatggaattggagagcccttggaatctgggcctgttacggcctgtaatccttataagccaccaggtcctccctcaacacctgaagtctcagcaatcaccaaagattctatggtagtaacatgggcacgcccagtagacgacggaggtaccgaaattgagggctacattcttgaaaaacgagataaggaaggcgttagatggaccaagtgcaacaagaaaacattaacggatctgcggctcagggtaactggtcttaccgaaggccattcctatgaattcagagttgctgctgaaaatgcagctggtgtgggagaacctagtgagccatctgttttctaccgtgcgtgtgatgccttgtatccaccaggtcccccaagcaatccaaaagtgacggacacttccagatcttctgtctccctggcatggagtaagccaatttatgatggtggcgcacctgttaaaggctatgttgtagaggtcaaagaagctgctgcggatgaatggacaacctgcactccaccaacaggattacaaggaaagcagttcacagtgaccaagcttaaagaaaacactgaatataacttccgtatttgtgccatcaattctgaaggtgtaggtgaacctgcaactctacctggctcagtggttgctcaggagaggatagagccaccagaaatagaactcgatgctgatctcagaaaggtggtcgttctgcgtgcaagtgctactttacgcttatttgtcactatcaaaggtcgaccagaacccgaagttaaatgggaaaaggcagaaggcattctcactgacagggctcagatagaggtgaccagctcatttacaatgttggtgattgataatgttaccagatttgacagtggtcggtataatctgacattagaaaataatagtggctccaaaacagcttttgttaacgtcagagttcttgactcaccaagtgcccctgtgaatttgaccataagagaagtgaagaaagactcagtgacgttgtcctgggaaccaccacttattgatggtggagctaagattacaaactacattgtcgaaaaacgagaaactacaagaaaagcctatgctaccattacaaataattgcactaaaactactttcagaattgaaaatctacaagaaggatgttcttactacttccgagtcttggcttccaatgaatatgggattggtttgccagctgaaacaacagaacccgttaaagtgtctgaaccacccctcccacctggaagagtaactcttgttgatgtgacccgtaatacagctacaattaagtgggagaaaccagaaagtgatggtggcagcaaaattactggttatgtggttgaaatgcagactaaagggagtgaaaagtggagcacctgcacacaagttaagactctagaagcaactatatctggcttaactgcaggagaagagtatgtcttcagggtagctgcagttaacgaaaagggaagaagtgatccaagacaacttggagtgccagtaattgcaagggatattgaaataaagccttcagttgagcttcctttccatactttcaatgtaaaggctagagaacaacttaagattgatgtgccattcaaaggaagacctcaagctactgtgaactggagaaaagatggtcagactcttaaagagacaactagagtcaatgtttcttcttcaaagactgtaacatcactatctattaaggaagcttcaaaggaagatgttggaacttatgaattatgtgtttcaaacagtgctggatccataacagttcctattactataattgtccttgacagaccaggacctccaggtcctatacgtattgatgaggttagttgtgacagcataaccatttcttggaatcctccagaatatgatggtggctgccaaattagcaattacattgttgaaaagaaagaaaccacctctacaacatggcacatagtttcacaagcagttgcaagaacatccattaaaatagttcgcctgacaacaggaagtgagtatcagttccgtgtttgtgcagaaaaccgctatggaaagagctcctacagtgaatcttcagctgttgttgcagagtatccattcagtcccccaggtcctcctggtactcctaaagttgtgcatgccacaaaatctaccatgcttgtaacctggcaagtgccagttaatgatggaggaagtcgagtaattggctatcatcttgagtataaagaaagaagcagcattctttggtcaaaagcaaataaaatcctcattgctgatactcaaatgaaagtctccggccttgatgaaggactgatgtatgagtatcgtgtatatgctgaaaatattgctggaattggtaaatgcagtaaatcttgtgaaccagtccctgcaagagatccttgtgaccctcctggacaacctgaagtcacaaatatcacaagaaaatcagtgtcacttaaatggtctaaaccacattatgatggtggagctaagatcacaggatacattgttgaacgcagagaactaccagatggccggtggctgaagtgcaattatactaatatacaagaaacatactttgaagtaactgaacttactgaagatcagcgttatgaattccgggtttttgcaaggaatgctgctgactcagttagtgagccatctgaatccactgggcctattatagttaaagatgatgttgagcctccaagagttatgatggatgtcaagttccgagacgttattgttgtcaaagctggagaggtccttaagataaatgcagacattgcagggcgacctctgccagtaatttcctgggccaaggatggtatagaaattgaagaaagagcaagaacagaaatcatctcaacagacaatcatactttgttaacagttaaagactgtataagacgagacactgggcaatatgtactaacactgaagaatgttgccggcactcggtctgtggccgttaattgcaaagtacttgataagcctggtccaccagcaggaccacttgaaataaatggcctcactgctgagaaatgctctctttcctggggacgtccccaagaagatggtggtgcagatatcgactattacatcgtagaaaaacgtgaaacaagccaccttgcatggacaatatgtgaaggagagttacagatgacatcctgtaaagtaaccaagttactcaaaggcaatgaatatatatttagagtaactggtgttaataaatatggtgttggtgagcccctagagagtgtagctataaaggcactagatccatttacagttccaagtccacccacgtctttggaaattacttctgtgaccaaagaatctatgacactttgctggtcaagacccgagagtgatggaggtagtgaaatatctggatatataattgaaaggcgagagaaaaatagcctaagatgggtgcgtgtaaacaaaaaaccagtttatgatctaagagtgaaatcaacaggacttcgggaaggatgtgaatatgaatatcgtgtttatgcagaaaatgctgctggcctaagtcttccaagtgaaacctctcccttaattagggcagaagatccagtgttcctaccatctcctccatccaaacccaaaattgtggactcaggcaagacaactataactattgcctgggttaagccgctgtttgatggtggggccccgataactggatatactgtagaatacaaaaaatctgatgacactgactggaaaacttccattcagagcttacgagggacagaatatacaataagcggactaacaacaggagctgaatatgttttcagagtaaaatctgtcaataaggttggtgctagtgaccccagtgatagctctgaccctcagatagcaaaggaaagagaagaagaacctttatttgatattgacagtgaaatgaggaagaccttgattgtcaaggctggtgcctcatttaccatgactgtgcctttccgaggaagaccagtacccaatgtcttgtggagtaagccagacactgacctccgtactagagcttatgttgataccacagactctcgtacatcactgaccattgaaaatgccaacagaaatgactctggaaagtacacattaacaattcagaatgttttgagtgctgcttcactgaccttagttgtcaaagttttagataccccaggtcctccaaccaacattactgtgcaagatgtaaccaaagagtctgcagtgttatcctgggatgttcctgaaaacgatggtggagcaccagtgaagaattaccacatagaaaaacgtgaggccagcaagaaagcatgggtctctgtgaccaacaactgtaaccgcctctcctacaaagttaccaatttacaagaaggagctatctattacttcagagtctctggagaaaatgagtttggtgttggtataccagctgaaacaaaggaaggagtaaaaataacagaaaaaccaagcccacctgaaaaacttggagtaacaagtatatccaaagacagtgtttccctgacctggctgaagcctgaacatgatggcggaagcagaattgtacactatgtcgttgaagcactagaaaaaggacagaaaaactgggttaaatgtgcagtggcaaagtcaacccatcacgttgtttccggtctgagagagaattctgaatactttttccgagtgtttgctgaaaatcaagctggcctgagtgacccgagagagcttctgcttcctgttcttattaaggagcaactagaaccacctgaaattgatatgaagaatttcccaagtcacactgtatatgttagagctggttcaaaccttaaagttgacattccaatctctggaaaaccacttcccaaagtgaccttatcaagagatggtgtcccccttaaggcaaccatgagatttaataccgaaattactgctgagaacctgaccatcaatctcaaagaaagtgttacagctgacgctgggagatatgaaatcactgctgccaactccagtggtacaaccaaagctttcattaacattgttgtgctagacaggcctggtcctccaactggccctgttgttattagtgatataactgaagaaagtgtgactctcaaatgggagccacctaagtatgacggtggaagtcaagttaccaactacattctactcaaaagagaaacaagtactgcagtgtggactgaagtgtctgcaacagttgcaagaaccatgatgaaagtcatgaaactgaccacaggagaagaataccaattccgcatcaaggcagaaaaccgctttggcatcagtgatcatatagattcagcttgtgtgactgtcaaactaccatacacaacacctggaccaccatctacaccatgggtcactaatgttactcgagaaagcatcactgtgggctggcatgaaccagtgtcaaatggaggcagtgcagtcgtaggctatcacctggaaatgaaagacagaaacagtattttatggcaaaaagccaacaaactggtcatccgcacaactcacttcaaagtcacaacaatcagtgctggacttatttatgaattcagggtgtatgcagaaaatgctgctggagttggaaaacctagccatccttctgaaccagtcttggcaattgatgcttgtgaacccccaagaaatgttcgtatcactgatatttcaaagaactctgtcagcctttcatggcaacaaccagctttcgatggaggtagcaagattacaggctacattgttgagagacgtgaccttccagatggcagatggaccaaggccagcttcaccaatgttactgaaactcaattcatcatctctggcttgactcagaattcccagtatgaattccgtgtctttgctaggaatgctgttggttccattagcaatccatctgaggttgtagggcccattacttgcatcgattcttatggtggtcctgtaattgatttgcctctagaatatacagaagttgtcaaatacagagcaggtacatctgtgaagctcagagctggcatttctggcaaacctgcgcctactattgagtggtataaagatgataaagaattacaaaccaatgcactggtgtgtgttgaaaataccacggacctcgcatctatactcatcaaagatgccgatcgccttaatagtggatgctatgaattaaaactaaggaatgccatgggctcagcctcagccaccatcagagtacagatccttgacaaaccaggcccacctggtggaccaattgaatttaagactgtaactgctgagaagatcacccttctctggcggcctccagctgatgatggtggtgcaaaaatcactcactacattgtggaaaagcgtgagacaagccgcgttgtgtggtctatggtgtctgaacatttggaagagtgcatcattacaaccaccaaaattatcaaaggaaatgaatacatcttccgggtccgagccgtgaacaaatatggaattggcgagccactggaatctgattccgttgtagccaagaacgcatttgttacacctgggccaccaggcataccagaagtgacaaagattaccaagaattcgatgactgttgtatggagcaggccaattgcagatggcggtagtgatataagtggctatttccttgaaaaacgagacaagaagagcctaggatggtttaaagtactaaaagagactatccgtgacaccagacaaaaagtaacaggactcacagaaaacagtgactatcaatacagagtttgtgctgtaaacgctgctggacagggtccattttctgaaccatctgaattctacaaagctgctgatcctattgatcctccaggtccacctgctaagataagaatcgcagattcaaccaagtcatccatcacccttggctggagtaagcctgtctatgatgggggcagtgctgttactgggtatgttgtcgagataagacaaggagaggaagaggaatggactactgtctctaccaaaggagaggtcagaactacagaatatgtggtatccaacctgaaacctggagtcaattactacttccgggtatctgctgtaaactgtgctggacaaggagaacctatagaaatgaatgaacctgtacaagctaaagatatacttgaggcaccagagattgacctggatgtggctctcagaacttctgttattgccaaagctggtgaagatgtacaagtgttgattccctttaaaggcagacctccacctactgtcacatggagaaaagatgagaagaatcttggcagtgatgccagatacagcattgaaaacactgattcatcctcattactcaccattcctcaagttactcgcaatgatacaggaaaatatattctcacaatagaaaatggagttggtgaacctaagtcttcaactgtgagtgttaaagtgcttgacacaccagctgcctgccagaaactacaggttaaacatgtttctcgaggcacagtcactttgctctgggatcctcctctcattgatggaggatctccaataattaattatgtcattgaaaagagagatgccaccaagagaacatggtctgtcgtgtcacacaaatgttctagcacatccttcaagctaatagatttgtcggagaagactccattcttcttcagagttcttgcagaaaatgaaattggaattggggaaccctgtgaaactacagagccagtgaaggctgctgaagtaccagctcctatacgtgatctctcaatgaaagactcaacaaagacatctgtcatcctcagctggaccaaacctgactttgatggtggtagcgtcatcacagaatatgttgtagaaaggaaaggtaaaggtgaacagacgtggtcccacgctggcataagtaagacatgtgaaattgaggttagccaacttaaggagcagtcagtcctggagttcagagtgtttgccaaaaatgagaaaggactgagtgatcctgtcactattgggccaattacagtgaaagaacttattattacacctgaagttgacctgtcagatatccctggggcacaagtcactgtgagaattgggcacaatgtgcaccttgaattaccttataagggaaaacccaaaccatccatcagttggctgaaagatggcttgccactgaaagaaagtgaatttgttcgcttcagtaaaactgaaaacaaaattactttgagtattaagaatgccaagaaggagcatggaggaaaatacactgttattcttgataatgcagtgtgtagaattgcagtccccattacagtcatcacccttggcccaccatcaaagcccaaaggacccattcgatttgatgaaatcaaggctgatagtgtcatcctgtcatgggatgtacctgaagataatggaggaggagaaattacttgttacagcatcgagaagcgggaaacttcacaaactaactggaagatggtgtgttcaagtgttgccagaacgactttcaaagttcctaatctagtcaaagatgctgagtaccagtttagagtgagagcagaaaacagatacggagtcagccaaccacttgtctcaagcattattgtggcaaaacaccagttcaggattcctggtcccccaggaaagccagttatatacaatgtgacttctgatggcatgtcactaacttgggatgctccagtttatgatggtggttcagaagttactggattccatgttgaaaagaaagaaagaaatagcatcctctggcaaaaagttaatacatcaccaatctctggaagagaatatagagccactggactggtagaaggtctggattaccaattccgtgtatatgctgaaaattctgctggcctaagctcacctagtgacccaagcaaatttaccttagctgtttctccagtagacccacctggcactcctgactacattgatgtcacccgggaaaccatcacacttaaatggaacccaccattgcgtgatggaggcagtaagattgtgggctatagcattgagaaacggcaaggaaatgaacgctgggtgagatgcaactttactgacgtcagtgaatgtcagtacacagttacaggactcagtcctggggatcgctatgagttcagaataattgcaagaaatgctgttggaactataagcccgccctcacagtcttctggcattattatgacaagagatgaaaatgttccaccaatagtagagtttggccctgaatactttgatggtctcattattaagtccggagagagccttagaattaaagctttggtacaaggaagaccagtgcctcgagtaacttggttcaaagatggagtggaaatcgaaaagaggatgaatatggaaataaccgacgtacttggatccaccagcctatttgttagagatgctactcgggaccatcgtggtgtatacacagtggaagccaaaaatgcatctggttctgcaaaagcagaaattaaagtgaaagtacaagatacaccaggaaaagtagttgggccaataagattcaccaatattactggggagaagatgactctgtggtgggatgccccactcaatgacggttgtgctcccataacccactacatcattgaaaaacgggaaaccagcagacttgcctgggcactaattgaggataaatgtgaagcccaaagttacactgccattaaactaataaacggcaatgaataccaattccgtgtttctgcagttaacaagtttggtgttggcaggccacttgattctgatccagtggttgctcaaatacaatatactgttcctgatgcccctggcattccagaacctagcaacataacaggcaacagcattaccctgacatgggcaaggccagaatcagatggtggcagtgaaattcaacagtatatccttgaaagaagagaaaagaaaagcacaagatgggtaaaagtgatcagcaaacgaccaatctctgaaacaagattcaaagtcactggtctgacagaaggcaatgagtatgaattccatgtcatggctgaaaatgctgcaggagttggacctgcaagtggcatctcaagactcattaaatgtagagagcccgtcaacccaccaggtcctcccacagtggtcaaagtaacagacacatcaaagacaactgtgagcttagaatggtccaaaccagtgtttgatggtggcatggaaataattgggtatattattgaaatgtgtaaggccgacttaggagactggcacaaggtgaatgcagaggcatgtgtgaaaacaagatatacagtcactgatctacaagcaggtgaagaatacaaattccgagttagtgctatcaatggtgctggaaaaggcgacagctgtgaagtgactggcacaattaaagcagttgaccggttaacagctcctgagttagacatagatgcaaacttcaaacagactcatgttgttagagctggggccagtattcgcctcttcattgcctaccaaggtagacctactcctacagctgtgtggagcaaaccagactctaaccttagccttcgggctgatatccatacaacagattccttcagcaccctcactgtggaaaactgcaacagaaatgatgcagggaaatatacccttactgtggaaaacaacagtggtagtaagtcaatcacattcaccgtgaaagtgctagacactccaggcccacctggcccaattaccttcaaagatgtgacccggggatctgctacattgatgtgggatgcccctcttcttgacggtggtgcccgaatccatcattatgtggtagagaaacgagaggcaagtcgccgtagttggcaggttatcagtgaaaaatgcactcgtcagatcttcaaggtcaatgacctggccgaaggtgttccgtactatttccgtgtttctgcagtaaatgagtatggtgttggtgagccctatgaaatgccagaaccaattgtagccacagaacagcctgctccacctaggagacttgatgttgttgatactagcaaatcctccgcagtcttagcttggcttaaacctgaccacgatggaggcagccggatcactggctacctgcttgaaatgagacaaaagggatctgacttctgggttgaagctggtcacaccaaacagctaactttcacagtagagcgtcttgttgagaaaactgaatatgaattccgtgtgaaggccaagaatgatgctggctatagtgaacccagagaagccttctcttctgtcatcattaaggagcctcaaatcgagcccactgctgacctcactggaattaccaatcagcttataacttgcaaagcaggaagcccatttaccattgacgtaccaatcagtggtcgtcctgcccccaaagtaacatggaaactggaagaaatgagacttaaagagacagatcgagtgagcattacaacaacaaaagacagaaccacactgactgtaaaggacagcatgagaggtgactctggaagatacttcttgaccctggaaaatacagctggtgttaaaacatttagcgtcacagttgtggtcattggaaggccaggtccagtaaccggccccattgaggtctcatctgtctcagctgaatcgtgtgtcctgtcatggggagaacctaaagatggaggaggcactgaaattactaattacatagttgaaaagcgtgaatcgggtacaacagcttggcagcttgtcaattccagtgtcaagcgcactcaaattaaagtcactcatctcacaaaatacatggaatattctttccgtgtcagttcagagaacagatttggtgtcagcaaacctctagaatcagcaccaataattgctgaacatccatttgtcccaccaagcgctcctaccagacctgaggtctaccatgtgtctgccaatgccatgtctattcgttgggaagaaccctaccacgatggtggcagtaaaatcattggctactgggttgagaagaaagaacgtaatacaattctttgggtgaaagaaaacaaagtgccatgcttagagtgcaactacaaagtaactggtttagtagaaggactggaatatcagttcagaacttatgcactcaatgctgcaggtgttagcaaggccagcgaagcttcaagacctataatggctcaaaatccagttgatgcaccaggcagaccagaggtgacagatgtcacaagatcaacagtatcactgatttggtctgccccagcgtatgatggaggcagcaaggttgtgggctacatcatagagcgtaagccagtcagtgaggtaggagatggtcgctggctgaagtgcaactacaccattgtatctgacaatttcttcaccgtgactgctctcagtgaaggagacacttatgagttccgtgtgttagccaagaatgcagcaggcgtaattagcaaagggtctgaatctacaggccctgtcacttgccgagatgaatacgctccacccaaagccgaactggatgcccgattacacggtgatctggttaccatcagagcaggttctgatcttgttctggatgctgcagttggtggcaaacctgaacccaaaattatctggaccaaaggagacaaggagctagatctctgtgaaaaagtctctttgcagtatactggcaaacgagcaactgctgtgatcaagttctgtgacagaagtgacagtggaaaatacactttaacagtgaaaaatgccagcgggaccaaggccgtgtctgtcatggtcaaagtgcttgattcccctggcccatgtggaaagctcaccgtcagcagagtaacacaggagaagtgcactttagcctggagccttccgcaggaagacggaggagcagaaatcactcactacatcgtggaaagacgcgagactagcaggctcaactgggtgattgttgaaggcgaatgcccaaccctatcctatgtcgttaccaggctcatcaagaacaatgagtacatattccgagtgagggcagtaaacaaatatggccctggtgtgcctgttgaatcagagccaattgtagccagaaactcattcactattccatcaccacccggcatacctgaagaagttgggactggcaaagagcatatcatcattcagtggacaaaacctgaatctgatggtggcaatgaaatcagcaactacctagtagacaaacgtgagaagaagagcctgcgctggacacgtgtcaacaaagactatgtggtgtatgataccaggctgaaggtgaccagcctgatggagggttgtgattaccagttccgggtgaccgcagtgaatgcagctggtaacagtgagcccagcgaagcttccaacttcatctcatgcagagaaccatcatatacccctggaccaccttctgctccaagagttgtggataccaccaaacacagcattagtttggcatggaccaaacccatgtacgatggtggtactgacattgtaggatatgttctggaaatgcaagagaaggacactgatcagtggtaccgagtgcataccaatgccacaataagaaatactgaattcactgtgccagaccttaaaatgggccagaaatattccttcagagttgctgccgtgaacgtgaagggtatgagcgaatacagcgaatcaattgctgaaattgagcccgtggaaagaatagaaataccagatcttgagcttgcagatgatctaaagaagactgtgaccatcagggctggggcctccttgcgcttgatggtgtctgtatctggaagaccacctcctgtcataacgtggagcaagcagggcattgaccttgcaagccgggcaattattgacaccactgagagctactcattgctaatagtggacaaagttaatcggtacgatgctggaaaatacacaattgaagctgaaaaccaatctggcaagaaatcagcaacagtccttgttaaagtctatgatactcctggtccctgtccttcagtgaaagttaaggaagtatcaagagattctgtgactataacttgggaaattcccacgattgatggtggagctccagtcaacaattacatcgttgagaagcgtgaagctgctatgagagcattcaaaacagtaactaccaaatgcagcaagacactttacagaatttctggacttgtagaaggaaccatgtactatttcagagtgctgccagaaaatatttatggcattggagaaccttgtgaaacatctgatgcagtactggtctcagaagtgcctttggtgcctgcaaagctagaagtggtcgatgtcaccaaatccactgttacccttgcctgggaaaaaccactctacgatggtggtagccgactcactggatatgttctcgaggcctgcaaagctggcacagagagatggatgaaggttgtcaccttaaaacccacagtcctagagcacactgttacttccttaaatgaaggtgaacaatacttatttagaataagggcacaaaatgagaaaggtgtgtcagaaccaagagagactgtcacagccgtgactgtacaagacctcagagtgttgccaacaatcgatctttctacaatgcctcagaagaccatccatgtcccagctggcagaccagtagagctggtgatacctattgctggccgtccacctcctgctgcttcctggttctttgctggttctaaactgagagaatcagagcgtgtcacagttgaaactcacactaaagtagctaaattaaccatccgtgaaaccactatcagagatactggagaatacacacttgaattgaagaatgttaccggaactacttcagaaaccattaaagttatcattcttgacaagcctggtccaccaacaggacctattaagattgatgaaattgatgctacatcaattaccatttcctgggaaccacctgaattggacggtggtgctccactgagtggttatgtggtagaacaacgtgacgctcatcgtccaggatggctgcccgtttctgaatcagtgactaggtccacgtttaagtttaccagactcaccgaaggaaatgagtatgtgttccgtgtggctgcaacaaaccgcttcgggattggctcttacttgcagtctgaggtcatagagtgtcgcagcagcatccgtattcctggacccccagaaacattacagatatttgatgtttcccgtgatggcatgacacttacttggtacccaccagaggatgacggtggctcccaagtgactggatatattgtggagcgcaaagaagtgagagcagatcgatgggtccgtgtaaataaagtacctgtgacaatgacacggtaccgctccactggccttactgaaggcttagaatatgaacaccgtgtcacagccattaatgcaagagggtctgggaaaccaagtcgtccttccaaacccatcgttgccatggatccaattgctcctccaggaaagccacaaaacccaagagttactgatacaacaaggacatcagtctccctggcctggagtgttccagaagatgaaggaggatctaaagtcacaggctacttgattgaaatgcaaaaagtagatcaacatgaatggaccaagtgtaacaccactccaaccaagattcgagagtatactctaacacacctacctcagggtgcagaatacaggttccgcgtcctagcttgtaatgctggtggacctggtgagcctgctgaggtaccaggaacagtcaaagtcactgaaatgcttgaatatcctgattatgaacttgatgaaagataccaagaaggtatctttgtaaggcaaggtggcgtcatcagacttaccataccaatcaaaggaaaaccattcccaatatgtaaatggaccaaggaaggccaggatattagtaagcgtgccatgattgcaacatctgaaacacacactgagcttgtgatcaaagaagcagacaggggtgattctggcacttatgacctggttctggaaaataaatgtggcaagaaggctgtctacatcaaggtcagggtgataggaagtcccaacagtccagaagggccactggaatatgatgacatccaagtccgctctgtgagggtcagctggagacctcctgctgatgatggtggtgctgacatcttaggctacatcctcgagagacgagaagtgcctaaagccgcctggtataccattgattccagagtccgaggtacatctctggtggtaaaaggcctcaaagagaatgtagaataccatttccgtgtttcagcagaaaaccagtttggcataagcaaacccttgaaatctgaggaaccagtcacaccaaaaacaccattgaatcctccagaacctccaagcaatcctccagaagtactcgatgtaaccaagagttctgttagcttgtcctggtcccggcccaaagatgatggtggttctagagtcacaggctactacatcgaacgcaaagagacatccactgacaagtgggtcagacacaacaagactcagatcaccaccacaatgtacactgtcacagggcttgttcccgatgctgagtatcagttccgcatcatcgcacagaatgatgttggcctgagtgagaccagccctgcttctgaaccagttgtttgcaaagatccatttgataaaccaagccaaccaggagaacttgagattctttcaatatccaaagatagtgtcactctacagtgggagaaacctgaatgtgatggtggtaaagaaattcttggatactgggttgaatatagacagtctggagacagtgcctggaagaagagcaataaggaacgtattaaggacaagcaattcacaataggaggtttgctggaagctactgagtatgaattcagggtttttgctgagaatgagactgggctgagcagacctcgcagaactgctatgtctataaagactaaactcacatctggagaggccccaggaatacgcaaagaaatgaaggatgttaccacaaaattgggtgaagctgctcaactctcatgccagattgttggaaggcctcttcctgacattaaatggtacagatttggtaaagagctcatacaaagccggaaatacaaaatgtcttcagatggacgcacacacactcttacagtaatgacagaggaacaggaagatgaaggtgtttatacctgcatagccaccaatgaggttggagaagtagaaaccagtagtaagcttctcctgcaagcaacaccgcagttccatcctggttacccactgaaagagaaatattatggagctgtgggttccacacttcggcttcatgttatgtacattggtcgtccagtacctgccatgacttggttccatggtcagaaacttttgcaaaactcagaaaacattactattgaaaacactgagcactatactcatcttgtcatgaagaatgtccaacgtaagactcatgctgggaaatacaaagtccagctcagcaatgtttttggaacagttgatgccatccttgatgtggaaatacaagataaaccagacaaacctacaggaccaattgtgatcgaagctctattgaagaactccgcagtgatcagctggaaaccacccgcagatgacggaggctcctggatcaccaactatgtggtggaaaaatgtgaggccaaggagggggctgaatggcaattggtgtcttcagccatctcagtgacaacctgtagaattgtgaacctcacagaaaatgctggctattacttccgggtttcagctcagaacactttcggcatcagtgaccctctagaagtgtcctcagttgtgatcattaagagtccatttgaaaagccaggtgctcctggcaaaccaactattactgctgtcacaaaagattcttgtgttgtggcctggaagccacctgccagtgatggaggtgcaaagattagaaattactaccttgagaagcgtgagaagaagcagaataaatggatttctgtgacaacagaagaaattcgagaaactgtcttttcagtgaaaaaccttattgaaggtcttgaatacgagtttcgtgtgaaatgtgaaaatctaggtggggaaagtgaatggagtgaaatatcagaacccatcactcccaaatctgatgtcccaattcaggcaccacactttaaagaggaactgagaaatctaaatgtcagatatcagagcaatgctaccttggtctgcaaagtgactggtcatccaaaacctatcgtcaaatggtacagacaaggcaaagaaatcattgcagatggattaaaatataggattcaagaatttaagggtggctaccaccagctcatcattgcaagtgtcacagatgatgatgccacagtttaccaagtcagagctaccaaccaagggggatctgtgtctggcactgcctccttggaagtggaagttccagctaagatacacttacctaaaactcttgaaggcatgggagcagttcatgctctccgaggtgaagtggtcagcatcaagattcctttcagtggcaaaccagatcctgtgatcacctggcagaaaggacaagatctcattgacaataatggccactaccaagttattgtcacaagatccttcacatcacttgttttccccaatggggtagagagaaaagatgctggtttctatgtggtctgtgctaaaaacagatttggaattgatcagaagacagttgaactggatgtggctgatgttcctgacccacccagaggagtcaaagttagtgatgtctcacgagattctgtcaacttaacatggactgagccagcctctgatggtggcagcaaaatcaccaactacattgttgaaaaatgtgcaactactgcagaaagatggctccgtgtaggacaggcccgagaaacacgttataccgtgatcaacttatttggaaaaacaagttaccagttccgggtaatagctgaaaataaatttggtctgagcaagccttcagagccttcagaaccaaccataaccaaagaagataagaccagagctatgaactatgatgaagaggtagatgaaaccagggaagtctccatgactaaagcatctcactcttcaaccaaggaactctatgagaaatatatgattgctgaagatcttgggcgtggtgagtttggaattgtccatcgttgtgttgaaacatcctcaaagaagacatacatggccaaatttgttaaagtcaaagggactgatcaggttttggtaaagaaggaaatttccattctgaatattgctaggcatagaaacatcttacacctccatgaatcatttgaaagcatggaagaattagttatgatctttgagtttatatcaggacttgacatatttgagcgcattaacacaagtgcttttgaacttaatgaaagagaaattgtaagttatgttcaccaggtctgtgaagcacttcagtttttacacagtcataatattggacactttgacattagaccagaaaatatcatttaccaaaccagaagaagctctaccattaaaatcatagaatttggtcaagcccgtcagctgaaaccaggggacaacttcaggcttctattcactgccccagaatactatgcacctgaagtccaccagcatgatgttgtcagcacagccacagacatgtggtcacttggaacactggtatatgtgctattgagtggtatcaacccattcctggctgaaactaaccaacagatcattgagaatatcatgaatgctgaatatactttcgatgaggaagcattcaaagagattagcattgaagccatggattttgttgaccggttgttagtgaaagagaggaaatctcgcatgacagcatcggaggctctccagcacccatggttgaagcagaagatagaaagagtcagtactaaagttatcagaacattaaaacaccggcgttattaccacaccctgatcaagaaagacctcaacatggttgtgtcagcagcccggatctcctgtggtggtgcaattcgatctcagaagggagtgagtgttgctaaagttaaagtggcatccattgaaattggcccagtttctgggcagataatgcatgcagttggtgaagaaggaggacatgtcaaatatgtatgcaaaattgaaaattatgatcagtctacccaagtgacttggtactttggcgtccgacagctggagaacagtgagaaatacgaaatcacctacgaagatggagtggccatcctctatgtcaaagacattaccaaattagatgatggtacctacagatgcaaagtagtcaatgactatggtgaagacagttcttatgcagagctatttgttaaaggtgtgagagaagtctatgactattactgccgtagaaccatgaagaaaattaagcgcagaacagacacaatgagactcctggaaaggccaccagaatttaccctgcctctctataataagacagcttatgtaggtgaaaatgtccggtttggagtaactataactgtccacccagagcctcatgtaacatggtataaatcaggtcagaaaatcaaaccaggtgacaatgacaagaagtacacatttgagtcagacaagggtctttaccaattaacaatcaacagtgtcactacagatgatgacgctgaatatactgttgtggcaaggaacaaatatggtgaagacagctgtaaagcaaagctgacagtaaccctacacccacctccaacagatagtaccttaagacccatgttcaaaaggttactggcaaatgcagaatgccaagaaggccaaagtgtctgctttgagatcagagtgtctggcatccccccaccaacattaaaatgggagaaagatggtcagccactgtccctcgggcctaacattgaaattatccatgaaggcttggattattatgctctgcacatcagggacactttgcctgaagacacgggttattatagagtcacagccactaacacagctgggtccaccagctgccaggctcacctacaagtggaacgcctgaggtacaagaaacaggaattcaagagtaaggaggagcatgagcgacacgtacaaaaacaaattgacaaaaccctcagaatggctgaaattctttctggaactgaaagtgtaccactgacacaggtagctaaagaggctctgagagaagctgctgtcctttataaaccggctgtaagcaccaagactgtaaaaggggaattcagacttgagatagaagaaaagaaggaggagagaaaactccggatgccttatgatgtaccagagccacgcaagtataagcagactaccatagaagaagaccaacgcatcaagcagttcgtgcccatgtctgacatgaagtggtataaaaagatacgtgatcagtatgaaatgcctgggaaacttgacagagttgtacagaaacgacccaagcgcatccgcctttcaagatgggaacagttctatgtgatgcctcttccacgcattacagatcaatacagacctaaatggcgtattcctaaactgtcccaagatgatcttgagatagtgagaccagcccgccggcgtacaccttctcctgattatgacttttactaccgacctagaagacgttctcttggggacatctctgatgaagaattactcctccccattgatgactacttagcaatgaaaagaacagaggaagagaggctgcgtcttgaagaagagcttgagttaggtttttcagcttcacccccaagtcgaagccctccacactttgagctttctagcctacgttactcttcaccacaagctcatgtcaaggtggaggaaacaagaaaagacttcaggtattcaacctatcacatcccaacgaaggctgaagctagtacaagttatgcagaactgagggaacggcatgcccaggctgcgtacagacagccaaagcaacggcaaagaatcatggctgagagggaggatgaagagttgcttcgcccagttacgaccacccagcatctctcagaatacaaaagcgaacttgacttcatgtcaaaggaggaaaagtctagaaagaaatcaaggcgacaaagagaagtgacagaaataacagaaattgaggaagaatacgaaatctcaaaacatgctcaaagagaatcatcctcatctgcgtctagactactgagacgacggcgctccctgtctccaacttatattgagttaatgaggccagtgtctgagctgatccggtcacgtccacaaccggctgaggaatacgaagatgacacagaaagaaggtcacctactccagagagaactcgcccacgatcccccagccctgtgtctagtgagagatcactctcgagatttgagaggtctgcaagatttgatatcttttccaggtatgagtccatgaaagctgctttaaaaactcagaagacatcagaaaggaagtatgaagttttgagtcagcagcctttcacactggaccatgcccctcgaatcacactgagaatgcgctcgcacagggtaccatgtggccaaaatacacgttttattttaaatgttcagtctaagccaactgccgaggttaaatggtaccacaatggtgtggaactccaagaaagcagtaagattcattacaccaacacgagtggagtcctcaccctggaaattctggactgtcatactgatgacagtggaacctaccgtgctgtgtgcaccaactacaagggcgaagcttctgactatgcaacgttggacgtgacaggaggggattataccacctatgcttcccaacgcagagatgaagaggtccccagatctgttttccctgagctgacaagaacagaggcgtatgctgtttcatcatttaagaaaacatctgagatggaagcttcgtcttctgtcagggaagtgaaatcacagatgacggagacaagggaaagtctctcctcatatgaacactctgcatctgcagaaatgaaaagtgctgcattagaagaaaagtcactggaagaaaaatccacaaccagaaagatcaagacgactttggcagcaagaattctaacaaagccacggtccatgaccgtctacgagggcgagtctgcaaggttttcttgtgacaccgatggtgagccggtaccaactgtgacctggctgcgtaaaggacaagtgctaagtacttctgcccgccaccaagtgaccaccacaaagtacaaatcaacctttgagatctcttcagtccaggcttccgatgagggcaattacagcgtggtggtagaaaacagtgaagggaaacaagaagcagagttcactctgactattcaaaaggccagggtaactgaaaaggctgtgacatcaccaccaagagtcaaatccccagagcctcgggtgaaatccccagaagcagttaagtctccaaaacgagtgaaatctccagaaccttctcacccgaaagccgtatcacccacagagacaaaaccaacaccaacagagaaagttcagcacctcccagtctctgccccaccaaagattactcagttcctgaaagcagaagcttctaaagagattgcaaaactgacctgtgtggttgaaagcagtgtattaagggcaaaagaggtcacctggtataaagatggcaagaaactgaaggaaaatgggcatttccagtttcattattcagcagatggtacctatgagctcaaaatcaataacctcactgaatctgatcaaggagaatatgtttgtgagatttctggtgaaggtggaacgtctaaaaccaacttacaatttatggggcaagcctttaagagtatccatgagaaggtatcaaaaatatcagaaactaagaaatcagatcagaaaaccactgagtcaacagtaaccagaaaaactgaaccaaaagctcctgaaccaatttcctcaaaaccagtaattgttactgggttgcaggatacaactgtttcttcagacagtgttgctaaatttgcagttaaggctactggagaaccccggccaactgccatctggacaaaagatggaaaggccattacacaaggaggtaaatataaactctctgaagacaagggagggttcttcttagaaattcataagactgatacttctgacagtggactttatacttgtacagtaaaaaattcagctggatctgtgtcctctagctgcaaattaacaataaaagctataaaagatactgaggcacagaaagtctctacacaaaagacttctgaaattacacctcagaagaaagctgttgtccaagaggaaatttcccaaaaagccctaaggtctgaagaaattaagatgtcagaggcaaaatctcaagaaaagttagccctcaaagaggaagcttcaaaggttctgatttctgaagaagtcaagaaatcagcagcaacctccctggaaaaatccattgtccatgaggaaatcactaaaacatcacaggcatcagaagaagtcagaactcatgctgagattaaagcattttctactcagatgagcataaacgaaggtcaaagactggttttaaaagccaacattgctggtgccactgatgtgaaatgggtactgaatggcgtagagcttaccaactctgaggagtaccgatatggtgtctcaggcagcgatcagaccctaaccatcaagcaagccagtcacagagatgaaggaatcctcacctgcataagcaaaaccaaggaaggaatcgtcaagtgtcagtatgatttgacactgagcaaagaactctcagatgctccagccttcatctcacagcctagatctcaaaatattaatgaaggacaaaatgttctctttacttgtgaaatcagtggcgagccatcccctgaaatcgaatggtttaaaaacaacctgccaatttctatttcttcaaatgtcagcataagccgctccagaaatgtatactcccttgaaatccgaaatgcatcagtcagcgacagtggaaagtacacaattaaggccaaaaatttccgtggccagtgttcagctacagcttccttaatggtccttcctctagttgaagaaccttccagagaggtagtattgagaacaagtggtgacacaagcttgcaaggaagcttctcgtctcagtcagtccaaatgtctgcctccaagcaggaggcctccttcagcagtttcagcagcagcagtgctagcagcatgactgagatgaaatttgcaagcatgtctgcccaaagcatgtcctccatgcaagagtcctttgtagaaatgagttccagcagctttatgggaatatctaatatgacacaactggaaagctcaactagtaaaatgcttaaagcaggcataagaggaattccgcctaaaattgaagctcttccatctgatatcagcattgatgaaggcaaagttctaacagtagcctgtgctttcacgggtgagcctaccccagaagtaacatggtcctgtggtggaagaaaaatccacagtcaagaacaggggaggttccacattgaaaacacagatgacctgacaaccctgatcatcatggacgtacagaaacaagatggtggactttataccctgagtttagggaatgaatttggatctgactctgccactgtgaatatacatattcgatccatttaagagggcctgtgcccttatactctacactcattcttaacttttcgcaaacgtttcacacggactaatctttctgaactgtaaatatttaaagaaaaaaaagtagttttgtatcaacctaaatgagtcaaagttcaaaaatattcatttcaatcttttcataattgttgacctaagaatataatacatttgctagtgacatgtacatactgtatatagccggattaacggttataaagttttgtaccatttattttatgacattttacaatgtaagttttgaaactaactgttggtaggagaaagtttcttatggaacgaataccctgctcaacatttaatcaatctttgtgcctcaacatactgttgatgtctaagtatgcctcagtgggttgagaaaatccccattgaagatgtcctgtccacctaaaagagaatgatgctgtgcatatcacttgatatgtgcaccaatacctactgaatcagaaatgtaaggcattggtgatgtttgcatttaccctcctgtaagcaacactttaacgtcttacattttctctgatgatgtcacacaaaattatcatgacaaatattaccagagcaaagtgtaacggccaacactttgttcgctcattttacgctgtctctgacataaggagtgcctgaatagcttggaaaagtaacatctcctggccatcccttcatttaaccaagctattcaagtattcctatgccagagcagtgccaactcttggaggtcccagagtgcagccaatgcctttgtgtggtagttctaaattttaattgcacctgaaaaacctgggcacctaagcaatgagccacagcaaaaagtaaagaacaacaacaaaataaagctgttgttaaattttaaacaatattactaattgcccaaaatgtcaatttgatgtagttcttttcatgcaagtataaattcaattgttagttataattgttggacctccttgagatagtaacaacaaaataaagcaagctatctgcacctcaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:7273 -> Molecular function: GO:0002020 [protease binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0003676 [nucleic acid binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IMP
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: ISS
            GeneID:7273 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0043621 [protein self-association] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051015 [actin filament binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051371 [muscle alpha-actinin binding] evidence: IPI
            GeneID:7273 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0002576 [platelet degranulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0003300 [cardiac muscle hypertrophy] evidence: IMP
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: NAS
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0006941 [striated muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0007076 [mitotic chromosome condensation] evidence: IEP
            GeneID:7273 -> Biological process: GO:0007512 [adult heart development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030168 [platelet activation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030240 [skeletal muscle thin filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0030241 [skeletal muscle myosin thick filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0035995 [detection of muscle stretch] evidence: TAS
            GeneID:7273 -> Biological process: GO:0043056 [forward locomotion] evidence: IEA
            GeneID:7273 -> Biological process: GO:0045214 [sarcomere organization] evidence: IMP
            GeneID:7273 -> Biological process: GO:0045859 [regulation of protein kinase activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048739 [cardiac muscle fiber development] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048769 [sarcomerogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0050790 [regulation of catalytic activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0051592 [response to calcium ion] evidence: IDA
            GeneID:7273 -> Biological process: GO:0055003 [cardiac myofibril assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0055008 [cardiac muscle tissue morphogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
            GeneID:7273 -> Cellular component: GO:0000794 [condensed nuclear chromosome] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005865 [striated muscle thin filament] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0030018 [Z disc] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IEA
            GeneID:7273 -> Cellular component: GO:0031674 [I band] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_597676 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.