GGRNA Home | Help | Advanced search

2019-03-23 03:36:12, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_133378             101520 bp    mRNA    linear   PRI 29-APR-2013
DEFINITION  Homo sapiens titin (TTN), transcript variant N2-A, mRNA.
ACCESSION   NM_133378
VERSION     NM_133378.4  GI:291045224
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 101520)
  AUTHORS   LeWinter,M.M. and Granzier,H.L.
  TITLE     Titin is a major human disease gene
  JOURNAL   Circulation 127 (8), 938-944 (2013)
   PUBMED   23439446
  REMARK    GeneRIF: [review] Signal pathways of titin isoforms are described
            in a major human cardiovascular disease.
            Review article
REFERENCE   2  (bases 1 to 101520)
  AUTHORS   Hamdani,N., Krysiak,J., Kreusser,M.M., Neef,S., Dos Remedios,C.G.,
            Maier,L.S., Kruger,M., Backs,J. and Linke,W.A.
  TITLE     Crucial role for Ca2(+)/calmodulin-dependent protein kinase-II in
            regulating diastolic stress of normal and failing hearts via titin
            phosphorylation
  JOURNAL   Circ. Res. 112 (4), 664-674 (2013)
   PUBMED   23283722
  REMARK    GeneRIF: Human end-stage failing hearts revealed higher CaMKII
            expression/activity & phosphorylation at PEVK/titin N2B-unique
            sequence sites than donor hearts. Deranged CaMKII-dependent titin
            phosphorylation contributes to altered diastolic stress.
REFERENCE   3  (bases 1 to 101520)
  AUTHORS   Somkuti,J., Martonfalvi,Z., Kellermayer,M.S. and Smeller,L.
  TITLE     Different pressure-temperature behavior of the structured and
            unstructured regions of titin
  JOURNAL   Biochim. Biophys. Acta 1834 (1), 112-118 (2013)
   PUBMED   23063534
  REMARK    GeneRIF: Different pressure-temperature behavior of the structured
            and unstructured regions of titin.
REFERENCE   4  (bases 1 to 101520)
  AUTHORS   Tskhovrebova,L. and Trinick,J.
  TITLE     Roles of titin in the structure and elasticity of the sarcomere
  JOURNAL   J. Biomed. Biotechnol. 2010, 612482 (2010)
   PUBMED   20625501
  REMARK    GeneRIF: Recent titin data is reviewed and its implications for
            sarcomere architecture and elasticity, are discussed.
            Review article
REFERENCE   5  (bases 1 to 101520)
  AUTHORS   Labeit,S., Lahmers,S., Burkart,C., Fong,C., McNabb,M., Witt,S.,
            Witt,C., Labeit,D. and Granzier,H.
  TITLE     Expression of distinct classes of titin isoforms in striated and
            smooth muscles by alternative splicing, and their conserved
            interaction with filamins
  JOURNAL   J. Mol. Biol. 362 (4), 664-681 (2006)
   PUBMED   16949617
  REMARK    GeneRIF: This suggests that the titin Z2-Zis1 domain can link
            filamins and alpha-actinin together in the periphery of the
            Z-line/dense bodies in a fashion that is conserved in smooth and
            striated muscles.
REFERENCE   6  (bases 1 to 101520)
  AUTHORS   Bang,M.L., Centner,T., Fornoff,F., Geach,A.J., Gotthardt,M.,
            McNabb,M., Witt,C.C., Labeit,D., Gregorio,C.C., Granzier,H. and
            Labeit,S.
  TITLE     The complete gene sequence of titin, expression of an unusual
            approximately 700-kDa titin isoform, and its interaction with
            obscurin identify a novel Z-line to I-band linking system
  JOURNAL   Circ. Res. 89 (11), 1065-1072 (2001)
   PUBMED   11717165
REFERENCE   7  (bases 1 to 101520)
  AUTHORS   Freiburg,A., Trombitas,K., Hell,W., Cazorla,O., Fougerousse,F.,
            Centner,T., Kolmerer,B., Witt,C., Beckmann,J.S., Gregorio,C.C.,
            Granzier,H. and Labeit,S.
  TITLE     Series of exon-skipping events in the elastic spring region of
            titin as the structural basis for myofibrillar elastic diversity
  JOURNAL   Circ. Res. 86 (11), 1114-1121 (2000)
   PUBMED   10850961
REFERENCE   8  (bases 1 to 101520)
  AUTHORS   Labeit,S. and Kolmerer,B.
  TITLE     Titins: giant proteins in charge of muscle ultrastructure and
            elasticity
  JOURNAL   Science 270 (5234), 293-296 (1995)
   PUBMED   7569978
REFERENCE   9  (bases 1 to 101520)
  AUTHORS   Furst,D.O., Vinkemeier,U. and Weber,K.
  TITLE     Mammalian skeletal muscle C-protein: purification from bovine
            muscle, binding to titin and the characterization of a full-length
            human cDNA
  JOURNAL   J. Cell. Sci. 102 (PT 4), 769-778 (1992)
   PUBMED   1429890
REFERENCE   10 (bases 1 to 101520)
  AUTHORS   Labeit,S., Gautel,M., Lakey,A. and Trinick,J.
  TITLE     Towards a molecular understanding of titin
  JOURNAL   EMBO J. 11 (5), 1711-1716 (1992)
   PUBMED   1582406
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AC023270.7, AC010680.10,
            FJ695199.1 and AC009948.3.
            On Mar 13, 2010 this sequence version replaced gi:110349718.
            
            Summary: This gene encodes a large abundant protein of striated
            muscle. The product of this gene is divided into two regions, a
            N-terminal I-band and a C-terminal A-band. The I-band, which is the
            elastic part of the molecule, contains two regions of tandem
            immunoglobulin domains on either side of a PEVK region that is rich
            in proline, glutamate, valine and lysine. The A-band, which is
            thought to act as a protein-ruler, contains a mixture of
            immunoglobulin and fibronectin repeats, and possesses kinase
            activity. An N-terminal Z-disc region and a C-terminal M-line
            region bind to the Z-line and M-line of the sarcomere,
            respectively, so that a single titin molecule spans half the length
            of a sarcomere. Titin also contains binding sites for muscle
            associated proteins so it serves as an adhesion template for the
            assembly of contractile machinery in muscle cells. It has also been
            identified as a structural protein for chromosomes. Alternative
            splicing of this gene results in multiple transcript variants.
            Considerable variability exists in the I-band, the M-line and the
            Z-disc regions of titin. Variability in the I-band region
            contributes to the differences in elasticity of different titin
            isoforms and, therefore, to the differences in elasticity of
            different muscle types. Mutations in this gene are associated with
            familial hypertrophic cardiomyopathy 9, and autoantibodies to titin
            are produced in patients with the autoimmune disease scleroderma.
            [provided by RefSeq, Feb 2012].
            
            Transcript Variant: This variant (N2-A) encodes isoform N2-A, which
            is the predominant titin isoform in skeletal muscle. This variant
            lacks the N2B region but includes the PEVK region. This variant is
            supported by data in PMIDs 7569978, 10850961 and 11717165.
            
            Sequence Note: This RefSeq record was created from genomic sequence
            data to make the sequence consistent with the reference genome
            assembly. The genomic coordinates used for the transcript record
            were based on transcript alignments.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025081, ERS025082
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-212               AC023270.7         65697-65908         c
            213-316             AC023270.7         63037-63140         c
            317-520             AC023270.7         60623-60826         c
            521-808             AC023270.7         58880-59167         c
            809-894             AC023270.7         58310-58395         c
            895-1139            AC023270.7         57972-58216         c
            1140-1470           AC023270.7         53407-53737         c
            1471-1623           AC023270.7         52884-53036         c
            1624-1761           AC023270.7         51889-52026         c
            1762-1887           AC023270.7         50557-50682         c
            1888-2025           AC023270.7         49193-49330         c
            2026-2163           AC023270.7         48463-48600         c
            2164-2301           AC023270.7         47845-47982         c
            2302-2595           AC023270.7         44333-44626         c
            2596-2718           AC023270.7         44105-44227         c
            2719-3000           AC023270.7         42555-42836         c
            3001-3066           AC023270.7         42205-42270         c
            3067-3325           AC023270.7         41291-41549         c
            3326-3389           AC023270.7         41024-41087         c
            3390-3605           AC023270.7         40697-40912         c
            3606-3748           AC023270.7         39606-39748         c
            3749-3954           AC023270.7         38485-38690         c
            3955-4188           AC023270.7         37714-37947         c
            4189-4433           AC023270.7         37359-37603         c
            4434-4705           AC023270.7         36189-36460         c
            4706-4870           AC023270.7         35905-36069         c
            4871-5039           AC023270.7         35634-35802         c
            5040-6733           AC023270.7         33841-35534         c
            6734-7015           AC023270.7         33406-33687         c
            7016-7282           AC023270.7         32692-32958         c
            7283-7555           AC023270.7         32323-32595         c
            7556-7819           AC023270.7         31947-32210         c
            7820-8080           AC023270.7         31594-31854         c
            8081-8341           AC023270.7         29696-29956         c
            8342-8605           AC023270.7         28897-29160         c
            8606-8866           AC023270.7         28545-28805         c
            8867-9127           AC023270.7         28164-28424         c
            9128-9388           AC023270.7         27158-27418         c
            9389-9530           AC023270.7         26499-26640         c
            9531-9696           AC023270.7         26244-26409         c
            9697-9928           AC023270.7         24866-25097         c
            9929-10213          AC023270.7         23012-23296         c
            10214-10339         AC023270.7         22662-22787         c
            10340-10528         AC023270.7         17469-17657         c
            10529-10585         AC023270.7         11609-11665         c
            10586-10864         AC010680.10        172043-172321       c
            10865-11428         AC010680.10        169472-170035       c
            11429-11710         AC010680.10        168668-168949       c
            11711-11989         AC010680.10        168289-168567       c
            11990-12268         AC010680.10        167575-167853       c
            12269-12547         AC010680.10        167200-167478       c
            12548-12835         AC010680.10        166795-167082       c
            12836-13114         AC010680.10        166401-166679       c
            13115-13396         AC010680.10        166027-166308       c
            13397-13675         AC010680.10        165654-165932       c
            13676-13954         AC010680.10        165266-165544       c
            13955-14233         AC010680.10        164886-165164       c
            14234-14521         AC010680.10        164466-164753       c
            14522-14800         AC010680.10        164054-164332       c
            14801-15082         AC010680.10        163625-163906       c
            15083-15361         AC010680.10        163249-163527       c
            15362-15640         AC010680.10        162852-163130       c
            15641-15919         AC010680.10        162461-162739       c
            15920-16207         AC010680.10        162071-162358       c
            16208-16486         AC010680.10        161546-161824       c
            16487-16768         AC010680.10        161051-161332       c
            16769-17047         AC010680.10        159729-160007       c
            17048-17329         AC010680.10        159329-159610       c
            17330-17608         AC010680.10        158221-158499       c
            17609-17896         AC010680.10        157817-158104       c
            17897-18175         AC010680.10        157379-157657       c
            18176-18454         AC010680.10        157007-157285       c
            18455-18733         AC010680.10        156620-156898       c
            18734-19021         AC010680.10        156220-156507       c
            19022-19309         AC010680.10        155808-156095       c
            19310-19591         AC010680.10        154882-155163       c
            19592-19870         AC010680.10        154346-154624       c
            19871-20152         AC010680.10        153944-154225       c
            20153-20431         AC010680.10        153515-153793       c
            20432-20719         AC010680.10        153125-153412       c
            20720-20998         AC010680.10        152656-152934       c
            20999-21277         AC010680.10        152283-152561       c
            21278-21556         AC010680.10        151904-152182       c
            21557-21844         AC010680.10        151484-151771       c
            21845-22132         AC010680.10        151056-151343       c
            22133-22414         AC010680.10        149454-149735       c
            22415-22693         AC010680.10        148947-149225       c
            22694-22975         AC010680.10        148253-148534       c
            22976-23254         AC010680.10        147858-148136       c
            23255-23542         AC010680.10        147046-147333       c
            23543-23821         AC010680.10        146658-146936       c
            23822-24100         AC010680.10        146276-146554       c
            24101-24379         AC010680.10        145905-146183       c
            24380-24667         AC010680.10        145023-145310       c
            24668-24955         AC010680.10        144596-144883       c
            24956-25246         AC010680.10        143527-143817       c
            25247-25534         AC010680.10        141487-141774       c
            25535-25627         AC010680.10        140823-140915       c
            25628-25913         AC010680.10        140415-140700       c
            25914-26097         AC010680.10        139135-139318       c
            26098-26187         AC010680.10        138838-138927       c
            26188-26455         AC010680.10        138471-138738       c
            26456-26716         AC010680.10        138108-138368       c
            26717-26926         AC010680.10        136415-136624       c
            26927-27004         AC010680.10        136129-136206       c
            27005-27031         AC010680.10        136001-136027       c
            27032-27091         AC010680.10        135489-135548       c
            27092-27175         AC010680.10        135081-135164       c
            27176-27247         AC010680.10        132804-132875       c
            27248-27295         AC010680.10        131082-131129       c
            27296-27700         AC010680.10        129826-130230       c
            27701-27763         AC010680.10        129309-129371       c
            27764-27841         AC010680.10        128790-128867       c
            27842-27919         AC010680.10        128560-128637       c
            27920-28006         AC010680.10        127883-127969       c
            28007-28087         AC010680.10        127570-127650       c
            28088-28171         AC010680.10        126458-126541       c
            28172-28255         AC010680.10        125977-126060       c
            28256-28339         AC010680.10        123774-123857       c
            28340-28420         AC010680.10        123476-123556       c
            28421-28504         AC010680.10        123251-123334       c
            28505-28588         AC010680.10        123014-123097       c
            28589-28690         AC010680.10        122638-122739       c
            28691-28804         AC010680.10        122072-122185       c
            28805-28885         AC010680.10        119479-119559       c
            28886-28963         AC010680.10        119214-119291       c
            28964-29047         AC010680.10        118867-118950       c
            29048-29131         AC010680.10        118627-118710       c
            29132-29215         AC010680.10        118291-118374       c
            29216-29299         AC010680.10        117960-118043       c
            29300-29380         AC010680.10        117172-117252       c
            29381-29587         AC010680.10        116658-116864       c
            29588-29665         AC010680.10        115622-115699       c
            29666-29740         AC010680.10        115337-115411       c
            29741-29833         AC010680.10        115040-115132       c
            29834-29911         AC010680.10        114215-114292       c
            29912-30073         AC010680.10        113855-114016       c
            30074-30157         AC010680.10        113560-113643       c
            30158-30235         AC010680.10        113300-113377       c
            30236-30319         AC010680.10        112708-112791       c
            30320-30403         AC010680.10        112375-112458       c
            30404-30487         AC010680.10        112086-112169       c
            30488-30784         AC010680.10        111582-111878       c
            30785-30859         AC010680.10        109882-109956       c
            30860-30934         AC010680.10        109000-109074       c
            30935-31030         AC010680.10        108275-108370       c
            31031-31108         AC010680.10        107594-107671       c
            31109-31177         AC010680.10        106596-106664       c
            31178-31252         AC010680.10        106368-106442       c
            31253-31549         AC010680.10        105932-106228       c
            31550-31630         AC010680.10        105051-105131       c
            31631-31708         AC010680.10        104179-104256       c
            31709-31798         AC010680.10        96927-97016         c
            31799-31882         AC010680.10        93133-93216         c
            31883-31966         AC010680.10        92966-93049         c
            31967-32050         AC010680.10        86419-86502         c
            32051-32134         AC010680.10        86225-86308         c
            32135-32218         AC010680.10        86057-86140         c
            32219-32302         AC010680.10        85845-85928         c
            32303-32386         AC010680.10        85627-85710         c
            32387-32470         AC010680.10        85414-85497         c
            32471-32548         AC010680.10        85204-85281         c
            32549-32632         AC010680.10        84712-84795         c
            32633-32740         AC010680.10        84125-84232         c
            32741-32818         AC010680.10        83778-83855         c
            32819-32929         AC010680.10        79881-79991         c
            32930-32998         AC010680.10        78509-78577         c
            32999-33079         AC010680.10        76198-76278         c
            33080-33154         AC010680.10        75202-75276         c
            33155-33244         AC010680.10        74502-74591         c
            33245-33307         AC010680.10        74009-74071         c
            33308-33397         AC010680.10        73660-73749         c
            33398-33448         AC010680.10        71330-71380         c
            33449-33850         AC010680.10        70359-70760         c
            33851-34129         AC010680.10        69924-70202         c
            34130-34405         AC010680.10        69401-69676         c
            34406-34545         AC010680.10        69126-69265         c
            34546-34672         AC010680.10        68684-68810         c
            34673-34936         AC010680.10        68327-68590         c
            34937-35203         AC010680.10        67778-68044         c
            35204-35467         AC010680.10        67374-67637         c
            35468-35607         AC010680.10        67148-67287         c
            35608-35734         AC010680.10        66879-67005         c
            35735-36001         AC010680.10        66487-66753         c
            36002-36268         AC010680.10        66108-66374         c
            36269-36535         AC010680.10        64995-65261         c
            36536-36675         AC010680.10        64765-64904         c
            36676-36802         AC010680.10        64202-64328         c
            36803-36945         AC010680.10        63262-63404         c
            36946-37069         AC010680.10        59234-59357         c
            37070-37336         AC010680.10        58426-58692         c
            37337-37434         AC010680.10        56631-56728         c
            37435-37603         AC010680.10        55801-55969         c
            37604-37870         AC010680.10        55436-55702         c
            37871-38137         AC010680.10        55063-55329         c
            38138-38416         AC010680.10        54676-54954         c
            38417-38825         AC010680.10        54178-54586         c
            38826-38950         AC010680.10        53949-54073         c
            38951-39217         AC010680.10        53582-53848         c
            39218-39487         AC010680.10        52545-52814         c
            39488-39790         AC010680.10        52150-52452         c
            39791-40093         AC010680.10        51740-52042         c
            40094-40281         AC010680.10        51286-51473         c
            40282-40396         AC010680.10        51081-51195         c
            40397-40681         AC010680.10        50690-50974         c
            40682-40833         AC010680.10        50440-50591         c
            40834-40981         AC010680.10        49602-49749         c
            40982-41159         AC010680.10        49268-49445         c
            41160-41281         AC010680.10        48808-48929         c
            41282-41569         AC010680.10        48427-48714         c
            41570-41866         AC010680.10        48013-48309         c
            41867-42053         AC010680.10        47712-47898         c
            42054-42169         AC010680.10        47122-47237         c
            42170-42469         AC010680.10        46734-47033         c
            42470-42769         AC010680.10        46238-46537         c
            42770-42875         AC010680.10        46018-46123         c
            42876-43072         AC010680.10        45719-45915         c
            43073-43378         AC010680.10        45333-45638         c
            43379-43657         AC010680.10        44954-45232         c
            43658-43957         AC010680.10        44051-44350         c
            43958-44260         AC010680.10        43645-43947         c
            44261-44623         AC010680.10        43169-43531         c
            44624-44926         AC010680.10        42567-42869         c
            44927-45226         AC010680.10        42139-42438         c
            45227-45523         AC010680.10        41746-42042         c
            45524-45808         AC010680.10        41362-41646         c
            45809-46102         AC010680.10        40982-41275         c
            46103-46402         AC010680.10        39375-39674         c
            46403-46711         AC010680.10        38948-39256         c
            46712-46902         AC010680.10        38669-38859         c
            46903-47332         AC010680.10        37837-38266         c
            47333-47641         AC010680.10        36243-36551         c
            47642-47790         AC010680.10        35963-36111         c
            47791-47823         AC010680.10        35843-35875         c
            47824-47953         AC010680.10        35619-35748         c
            47954-48253         AC010680.10        35226-35525         c
            48254-48571         AC010680.10        34815-35132         c
            48572-48868         AC010680.10        33515-33811         c
            48869-49168         AC010680.10        33107-33406         c
            49169-49483         AC010680.10        32709-33023         c
            49484-49632         AC010680.10        32467-32615         c
            49633-49783         AC010680.10        31869-32019         c
            49784-49935         AC010680.10        31629-31780         c
            49936-50065         FJ695199.1         64-193              c
            50066-50368         AC010680.10        29469-29771         c
            50369-50671         AC010680.10        28306-28608         c
            50672-50953         AC010680.10        27923-28204         c
            50954-51253         AC010680.10        27530-27829         c
            51254-51556         AC010680.10        27135-27437         c
            51557-51865         AC010680.10        26737-27045         c
            51866-52147         AC010680.10        26341-26622         c
            52148-52447         AC010680.10        25940-26239         c
            52448-52741         AC010680.10        25561-25854         c
            52742-55708         AC010680.10        22500-25466         c
            55709-56029         AC010680.10        21861-22181         c
            56030-56314         AC010680.10        21478-21762         c
            56315-56614         AC010680.10        21080-21379         c
            56615-56917         AC010680.10        20467-20769         c
            56918-57193         AC010680.10        19034-19309         c
            57194-57493         AC010680.10        18631-18930         c
            57494-57796         AC010680.10        18238-18540         c
            57797-58096         AC010680.10        17569-17868         c
            58097-58384         AC010680.10        16902-17189         c
            58385-58681         AC010680.10        16258-16554         c
            58682-58984         AC010680.10        15868-16170         c
            58985-59290         AC010680.10        15461-15766         c
            59291-59578         AC010680.10        14284-14571         c
            59579-59869         AC010680.10        13901-14191         c
            59870-60157         AC010680.10        13523-13810         c
            60158-60745         AC010680.10        12768-13355         c
            60746-60850         AC010680.10        12573-12677         c
            60851-61048         AC010680.10        11950-12147         c
            61049-61345         AC010680.10        11564-11860         c
            61346-61933         AC010680.10        10885-11472         c
            61934-62236         AC010680.10        10491-10793         c
            62237-72614         AC010680.10        1-10378             c
            72615-79342         AC009948.3         165901-172628       c
            79343-79639         AC009948.3         164931-165227       c
            79640-80227         AC009948.3         164238-164825       c
            80228-80530         AC009948.3         163843-164145       c
            80531-80827         AC009948.3         163438-163734       c
            80828-81115         AC009948.3         161455-161742       c
            81116-81415         AC009948.3         161043-161342       c
            81416-81718         AC009948.3         160504-160806       c
            81719-82024         AC009948.3         160092-160397       c
            82025-83791         AC009948.3         158220-159986       c
            83792-84085         AC009948.3         157557-157850       c
            84086-84373         AC009948.3         156576-156863       c
            84374-84673         AC009948.3         156160-156459       c
            84674-86740         AC009948.3         153997-156063       c
            86741-87043         AC009948.3         153593-153895       c
            87044-87349         AC009948.3         153190-153495       c
            87350-87640         AC009948.3         152802-153092       c
            87641-87937         AC009948.3         152410-152706       c
            87938-88243         AC009948.3         151978-152283       c
            88244-88549         AC009948.3         150791-151096       c
            88550-88831         AC009948.3         150424-150705       c
            88832-89425         AC009948.3         149659-150252       c
            89426-89713         AC009948.3         149252-149539       c
            89714-90013         AC009948.3         148854-149153       c
            90014-90316         AC009948.3         147872-148174       c
            90317-90619         AC009948.3         146658-146960       c
            90620-91204         AC009948.3         145972-146556       c
            91205-91510         AC009948.3         145536-145841       c
            91511-91810         AC009948.3         145130-145429       c
            91811-92386         AC009948.3         143932-144507       c
            92387-92692         AC009948.3         143528-143833       c
            92693-93286         AC009948.3         142572-143165       c
            93287-98895         AC009948.3         136831-142439       c
            98896-99052         AC009948.3         136550-136706       c
            99053-99744         AC009948.3         135118-135809       c
            99745-99898         AC009948.3         134864-135017       c
            99899-100201        AC009948.3         134036-134338       c
            100202-101520       AC009948.3         132579-133897       c
FEATURES             Location/Qualifiers
     source          1..101520
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="2"
                     /map="2q31"
     gene            1..101520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="titin"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
     exon            1..212
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       85
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647840"
     misc_feature    202..204
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="upstream in-frame stop codon"
     exon            213..316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     CDS             226..100497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /EC_number="2.7.11.1"
                     /note="isoform N2-A is encoded by transcript variant N2-A;
                     connectin; rhabdomyosarcoma antigen MU-RMS-40.14"
                     /codon_start=1
                     /product="titin isoform N2-A"
                     /protein_id="NP_596869.4"
                     /db_xref="GI:291045225"
                     /db_xref="CCDS:CCDS54424.1"
                     /db_xref="GeneID:7273"
                     /db_xref="HGNC:12403"
                     /db_xref="MIM:188840"
                     /translation="
MTTQAPTFTQPLQSVVVLEGSTATFEAHISGFPVPEVSWFRDGQVISTSTLPGVQISFSDGRAKLTIPAVTKANSGRYSLKATNGSGQATSTAELLVKAETAPPNFVQRLQSMTVRQGSQVRLQVRVTGIPTPVVKFYRDGAEIQSSLDFQISQEGDLYSLLIAEAYPEDSGTYSVNATNSVGRATSTAELLVQGEEEVPAKKTKTIVSTAQISESRQTRIEKKIEAHFDARSIATVEMVIDGAAGQQLPHKTPPRIPPKPKSRSPTPPSIAAKAQLARQQSPSPIRHSPSPVRHVRAPTPSPVRSVSPAARISTSPIRSVRSPLLMRKTQASTVATGPEVPPPWKQEGYVASSSEAEMRETTLTTSTQIRTEERWEGRYGVQEQVTISGAAGAAASVSASASYAAEAVATGAKEVKQDADKSAAVATVVAAVDMARVREPVISAVEQTAQRTTTTAVHIQPAQEQVRKEAEKTAVTKVVVAADKAKEQELKSRTKEVITTKQEQMHVTHEQIRKETEKTFVPKVVISAAKAKEQETRISEEITKKQKQVTQEAIRQETEITAASMVVVATAKSTKLETVPGAQEETTTQQDQMHLSYEKIMKETRKTVVPKVIVATPKVKEQDLVSRGREGITTKREQVQITQEKMRKEAEKTALSTIAVATAKAKEQETILRTRETMATRQEQIQVTHGKVDVGKKAEAVATVVAAVDQARVREPREPGHLEESYAQQTTLEYGYKERISAAKVAEPPQRPASEPHVVPKAVKPRVIQAPSETHIKTTDQKGMHISSQIKKTTDLTTERLVHVDKRPRTASPHFTVSKISVPKTEHGYEASIAGSAIATLQKELSATSSAQKITKSVKAPTVKPSETRVRAEPTPLPQFPFADTPDTYKSEAGVEVKKEVGVSITGTTVREERFEVLHGREAKVTETARVPAPVEIPVTPPTLVSGLKNVTVIEGESVTLECHISGYPSPTVTWYREDYQIESSIDFQITFQSGIARLMIREAFAEDSGRFTCSAVNEAGTVSTSCYLAVQVSEEFEKETTAVTEKFTTEEKRFVESRDVVMTDTSLTEEQAGPGEPAAPYFITKPVVQKLVEGGSVVFGCQVGGNPKPHVYWKKSGVPLTTGYRYKVSYNKQTGECKLVISMTFADDAGEYTIVVRNKHGETSASASLLEEADYELLMKSQQEMLYQTQVTAFVQEPKVGETAPGFVYSEYEKEYEKEQALIRKKMAKDTVVVRTYVEDQEFHISSFEERLIKEIEYRIIKTTLEELLEEDGEEKMAVDISESEAVESGFDSRIKNYRILEGMGVTFHCKMSGYPLPKIAWYKDGKRIKHGERYQMDFLQDGRASLRIPVVLPEDEGIYTAFASNIKGNAICSGKLYVEPAAPLGAPTYIPTLEPVSRIRSLSPRSVSRSPIRMSPARMSPARMSPARMSPARMSPGRRLEETDESQLERLYKPVFVLKPVSFKCLEGQTARFDLKVVGRPMPETFWFHDGQQIVNDYTHKVVIKEDGTQSLIIVPATPSDSGEWTVVAQNRAGRSSISVILTVEAVEHQVKPMFVEKLKNVNIKEGSRLEMKVRATGNPNPDIVWLKNSDIIVPHKYPKIRIEGTKGEAALKIDSTVSQDSAWYTATAINKAGRDTTRCKVNVEVEFAEPEPERKLIIPRGTYRAKEIAAPELEPLHLRYGQEQWEEGDLYDKEKQQKPFFKKKLTSLRLKRFGPAHFECRLTPIGDPTMVVEWLHDGKPLEAANRLRMINEFGYCSLDYGVAYSRDSGIITCRATNKYGTDHTSATLIVKDEKSLVEESQLPEGRKGLQRIEELERMAHEGALTGVTTDQKEKQKPDIVLYPEPVRVLEGETARFRCRVTGYPQPKVNWYLNGQLIRKSKRFRVRYDGIHYLDIVDCKSYDTGEVKVTAENPEGVIEHKVKLEIQQREDFRSVLRRAPEPRPEFHVHEPGKLQFEVQKVDRPVDTTETKEVVKLKRAERITHEKVPEESEELRSKFKRRTEEGYYEAITAVELKSRKKDESYEELLRKTKDELLHWTKELTEEEKKALAEEGKITIPTFKPDKIELSPSMEAPKIFERIQSQTVGQGSDAHFRVRVVGKPDPECEWYKNGVKIERSDRIYWYWPEDNVCELVIRDVTAEDSASIMVKAINIAGETSSHAFLLVQAKQLITFTQELQDVVAKEKDTMATFECETSEPFVKVKWYKDGMEVHEGDKYRMHSDRKVHFLSILTIDTSDAEDYSCVLVEDENVKTTAKLIVEGAVVEFVKELQDIEVPESYSGELECIVSPENIEGKWYHNDVELKSNGKYTITSRRGRQNLTVKDVTKEDQGEYSFVIDGKKTTCKLKMKPRPIAILQGLSDQKVCEGDIVQLEVKVSLESVEGVWMKDGQEVQPSDRVHIVIDKQSHMLLIEDMTKEDAGNYSFTIPALGLSTSGRVSVYSVDVITPLKDVNVIEGTKAVLECKVSVPDVTSVKWYLNDEQIKPDDRVQAIVKGTKQRLVINRTHASDEGPYKLIVGRVETNCNLSVEKIKIIRGLRDLTCTETQNVVFEVELSHSGIDVLWNFKDKEIKPSSKYKIEAHGKIYKLTVLNMMKDDEGKYTFYAGENMTSGKLTVAGGAISKPLTDQTVAESQEAVFECEVANPDSKGEWLRDGKHLPLTNNIRSESDGHKRRLIIAATKLDDIGEYTYKVATSKTSAKLKVEAVKIKKTLKNLTVTETQDAVFTVELTHPNVKGVQWIKNGVVLESNEKYAISVKGTIYSLRIKNCAIVDESVYGFRLGRLGASARLHVETVKIIKKPKDVTALENATVAFEVSVSHDTVPVKWFHKSVEIKPSDKHRLVSERKVHKLMLQNISPSDAGEYTAVVGQLECKAKLFVETLHITKTMKNIEVPETKTASFECEVSHFNVPSMWLKNGVEIEMSEKFKIVVQGKLHQLIIMNTSTEDSAEYTFVCGNDQVSATLTVTPIMITSMLKDINAEEKDTITFEVTVNYEGISYKWLKNGVEIKSTDKCQMRTKKLTHSLNIRNVHFGDAADYTFVAGKATSTATLYVEARHIEFRKHIKDIKVLEKKRAMFECEVSEPDITVQWMKDDQELQITDRIKIQKEKYVHRLLIPSTRMSDAGKYTVVAGGNVSTAKLFVEGRDVRIRSIKKEVQVIEKQRAVVEFEVNEDDVDAHWYKDGIEINFQVQERHKYVVERRIHRMFISETRQSDAGEYTFVAGRNRSSVTLYVNAPEPPQVLQELQPVTVQSGKPARFCAVISGRPQPKISWYKEEQLLSTGFKCKFLHDGQEYTLLLIEAFPEDAAVYTCEAKNDYGVATTSASLSVEVPEVVSPDQEMPVYPPAIITPLQDTVTSEGQPARFQCRVSGTDLKVSWYSKDKKIKPSRFFRMTQFEDTYQLEIAEAYPEDEGTYTFVASNAVGQVSSTANLSLEAPESILHERIEQEIEMEMKAAPVIKRKIEPLEVALGHLAKFTCEIQSAPNVRFQWFKAGREIYESDKCSIRSSKYISSLEILRTQVVDCGEYTCKASNEYGSVSCTATLTVTEAYPPTFLSRPKSLTTFVGKAAKFICTVTGTPVIETIWQKDGAALSPSPNWRISDAENKHILELSNLTIQDRGVYSCKASNKFGADICQAELIIIDKPHFIKELEPVQSAINKKVHLECQVDEDRKVTVTWSKDGQKLPPGKDYKICFEDKIATLEIPLAKLKDSGTYVCTASNEAGSSSCSATVTVREPPSFVKKVDPSYLMLPGESARLHCKLKGSPVIQVTWFKNNKELSESNTVRMYFVNSEAILDITDVKVEDSGSYSCEAVNDVGSDSCSTEIVIKEPPSFIKTLEPADIVRGTNALLQCEVSGTGPFEISWFKDKKQIRSSKKYRLFSQKSLVCLEIFSFNSADVGEYECVVANEVGKCGCMATHLLKEPPTFVKKVDDLIALGGQTVTLQAAVRGSEPISVTWMKGQEVIREDGKIKMSFSNGVAVLIIPDVQISFGGKYTCLAENEAGSQTSVGELIVKEPAKIIERAELIQVTAGDPATLEYTVAGTPELKPKWYKDGRPLVASKKYRISFKNNVAQLKFYSAELHDSGQYTFEISNEVGSSSCETTFTVLDRDIAPFFTKPLRNVDSVVNGTCRLDCKIAGSLPMRVSWFKDGKEIAASDRYRIAFVEGTASLEIIRVDMNDAGNFTCRATNSVGSKDSSGALIVQEPPSFVTKPGSKDVLPGSAVCLKSTFQGSTPLTIRWFKGNKELVSGGSCYITKEALESSLELYLVKTSDSGTYTCKVSNVAGGVECSANLFVKEPATFVEKLEPSQLLKKGDATQLACKVTGTPPIKITWFANDREIKESSKHRMSFVESTAVLRLTDVGIEDSGEYMCEAQNEAGSDHCSSIVIVKESPYFTKEFKPIEVLKEYDVMLLAEVAGTPPFEITWFKDNTILRSGRKYKTFIQDHLVSLQILKFVAADAGEYQCRVTNEVGSSICSARVTLREPPSFIKKIESTSSLRGGTAAFQATLKGSLPITVTWLKDSDEITEDDNIRMTFENNVASLYLSGIEVKHDGKYVCQAKNDAGIQRCSALLSVKEPATITEEAVSIDVTQGDPATLQVKFSGTKEITAKWFKDGQELTLGSKYKISVTDTVSILKIISTEKKDSGEYTFEVQNDVGRSSCKARINVLDLIIPPSFTKKLKKMDSIKGSFIDLECIVAGSHPISIQWFKDDQEISASEKYKFSFHDNTAFLEISQLEGTDSGTYTCSATNKAGHNQCSGHLTVKEPPYFVEKPQSQDVNPNTRVQLKALVGGTAPMTIKWFKDNKELHSGAARSVWKDDTSTSLELFAAKATDSGTYICQLSNDVGTATSKATLFVKEPPQFIKKPSPVLVLRNGQSTTFECQITGTPKIRVSWYLDGNEITAIQKHGISFIDGLATFQISGARVENSGTYVCEARNDAGTASCSIELKVKEPPTFIRELKPVEVVKYSDVELECEVTGTPPFEVTWLKNNREIRSSKKYTLTDRVSVFNLHITKCDPSDTGEYQCIVSNEGGSCSCSTRVALKEPPSFIKKIENTTTVLKSSATFQSTVAGSPPISITWLKDDQILDEDDNVYISFVDSVATLQIRSVDNGHSGRYTCQAKNESGVERCYAFLLVQEPAQIVEKAKSVDVTEKDPMTLECVVAGTPELKVKWLKDGKQIVPSRYFSMSFENNVASFRIQSVMKQDSGQYTFKVENDFGSSSCDAYLRVLDQNIPPSFTKKLTKMDKVLGSSIHMECKVSGSLPISAQWFKDGKEISTSAKYRLVCHERSVSLEVNNLELEDTANYTCKVSNVAGDDACSGILTVKEPPSFLVKPGRQQAIPDSTVEFKAILKGTPPFKIKWFKDDVELVSGPKCFIGLEGSTSFLNLYSVDASKTGQYTCHVTNDVGSDSCTTMLLVTEPPKFVKKLEASKIVKAGDSSRLECKIAGSPEIRVVWFRNEHELPASDKYRMTFIDSVAVIQMNNLSTEDSGDFICEAQNPAGSTSCSTKVIVKEPPVFSSFPPIVETLKNAEVSLECELSGTPPFEVVWYKDKRQLRSSKKYKIASKNFHTSIHILNVDTSDIGEYHCKAQNEVGSDTCVCTVKLKEPPRFVSKLNSLTVVAGEPAELQASIEGAQPIFVQWLKEKEEVIRESENIRITFVENVATLQFAKAEPANAGKYICQIKNDGGMRENMATLMVLEPAVIVEKAGPMTVTVGETCTLECKVAGTPELSVEWYKDGKLLTSSQKHKFSFYNKISSLRILSVERQDAGTYTFQVQNNVGKSSCTAVVDVSDRAVPPSFTRRLKNTGGVLGASCILECKVAGSSPISVAWFHEKTKIVSGAKYQTTFSDNVCTLQLNSLDSSDMGNYTCVAANVAGSDECRAVLTVQEPPSFVKEPEPLEVLPGKNVTFTSVIRGTPPFKVNWFRGARELVKGDRCNIYFEDTVAELELFNIDISQSGEYTCVVSNNAGQASCTTRLFVKEPAAFLKRLSDHSVEPGKSIILESTYTGTLPISVTWKKDGFNITTSEKCNIVTTEKTCILEILNSTKRDAGQYSCEIENEAGRDVCGALVSTLEPPYFVTELEPLEAAVGDSVSLQCQVAGTPEITVSWYKGDTKLRPTPEYRTYFTNNVATLVFNKVNINDSGEYTCKAENSIGTASSKTVFRIQERQLPPSFARQLKDIEQTVGLPVTLTCRLNGSAPIQVCWYRDGVLLRDDENLQTSFVDNVATLKILQTDLSHSGQYSCSASNPLGTASSSARLTAREPKKSPFFDIKPVSIDVIAGESADFECHVTGAQPMRITWSKDNKEIRPGGNYTITCVGNTPHLRILKVGKGDSGQYTCQATNDVGKDMCSAQLSVKEPPKFVKKLEASKVAKQGESIQLECKISGSPEIKVSWFRNDSELHESWKYNMSFINSVALLTINEASAEDSGDYICEAHNGVGDASCSTALTVKAPPVFTQKPSPVGALKGSDVILQCEISGTPPFEVVWVKDRKQVRNSKKFKITSKHFDTSLHILNLEASDVGEYHCKATNEVGSDTCSCSVKFKEPPRFVKKLSDTSTLIGDAVELRAIVEGFQPISVVWLKDRGEVIRESENTRISFIDNIATLQLGSPEASNSGKYICQIKNDAGMRECSAVLTVLEPARIIEKPEPMTVTTGNPFALECVVTGTPELSAKWFKDGRELSADSKHHITFINKVASLKIPCAEMSDKGLYSFEVKNSVGKSNCTVSVHVSDRIVPPSFIRKLKDVNAILGASVVLECRVSGSAPISVGWFQDGNEIVSGPKCQSSFSENVCTLNLSLLEPSDTGIYTCVAANVAGSDECSAVLTVQEPPSFEQTPDSVEVLPGMSLTFTSVIRGTPPFKVKWFKGSRELVPGESCNISLEDFVTELELFEVQPLESGDYSCLVTNDAGSASCTTHLFVKEPATFVKRLADFSVETGSPIVLEATYTGTPPISVSWIKDEYLISQSERCSITMTEKSTILEILESTIEDYAQYSCLIENEAGQDICEALVSVLEPPYFIEPLEHVEAVIGEPATLQCKVDGTPEIRISWYKEHTKLRSAPAYKMQFKNNVASLVINKVDHSDVGEYSCKADNSVGAVASSAVLVIKARKLPPFFARKLKDVHETLGFPVAFECRINGSEPLQVSWYKDGVLLKDDANLQTSFVHNVATLQILQTDQSHIGQYNCSASNPLGTASSSAKLILSEHEVPPFFDLKPVSVDLALGESGTFKCHVTGTAPIKITWAKDNREIRPGGNYKMTLVENTATLTVLKVGKGDAGQYTCYASNIAGKDSCSAQLGVQEPPRFIKKLEPSRIVKQDEFTRYECKIGGSPEIKVLWYKDETEIQESSKFRMSFVDSVAVLEMHNLSVEDSGDYTCEAHNAAGSASSSTSLKVKEPPIFRKKPHPIETLKGADVHLECELQGTPPFHVSWYKDKRELRSGKKYKIMSENFLTSIHILNVDAADIGEYQCKATNDVGSDTCVGSIALKAPPRFVKKLSDISTVVGKEVQLQTTIEGAEPISVVWFKDKGEIVRESDNIWISYSENIATLQFSRVEPANAGKYTCQIKNDAGMQECFATLSVLEPATIVEKPESIKVTTGDTCTLECTVAGTPELSTKWFKDGKELTSDNKYKISFFNKVSGLKIINVAPSDSGVYSFEVQNPVGKDSCTASLQVSDRTVPPSFTRKLKETNGLSGSSVVMECKVYGSPPISVSWFHEGNEISSGRKYQTTLTDNTCALTVNMLEESDSGDYTCIATNMAGSDECSAPLTVREPPSFVQKPDPMDVLTGTNVTFTSIVKGTPPFSVSWFKGSSELVPGDRCNVSLEDSVAELELFDVDTSQSGEYTCIVSNEAGKASCTTHLYIKAPAKFVKRLNDYSIEKGKPLILEGTFTGTPPISVTWKKNGINVTPSQRCNITTTEKSAILEIPSSTVEDAGQYNCYIENASGKDSCSAQILILEPPYFVKQLEPVKVSVGDSASLQCQLAGTPEIGVSWYKGDTKLRPTTTYKMHFRNNVATLVFNQVDINDSGEYICKAENSVGEVSASTFLTVQEQKLPPSFSRQLRDVQETVGLPVVFDCAISGSEPISVSWYKDGKPLKDSPNVQTSFLDNTATLNIFKTDRSLAGQYSCTATNPIGSASSSARLILTEGKNPPFFDIRLAPVDAVVGESADFECHVTGTQPIKVSWAKDSREIRSGGKYQISYLENSAHLTVLKVDKGDSGQYTCYAVNEVGKDSCTAQLNIKERLIPPSFTKRLSETVEETEGNSFKLEGRVAGSQPITVAWYKNNIEIQPTSNCEITFKNNTLVLQVRKAGMNDAGLYTCKVSNDAGSALCTSSIVIKEPKKPPVFDQHLTPVTVSEGEYVQLSCHVQGSEPIRIQWLKAGREIKPSDRCSFSFASGTAVLELRDVAKADSGDYVCKASNVAGSDTTKSKVTIKDKPAVAPATKKAAVDGRLFFVSEPQSIRVVEKTTATFIAKVGGDPIPNVKWTKGKWRQLNQGGRVFIHQKGDEAKLEIRDTTKTDSGLYRCVAFNEHGEIESNVNLQVDERKKQEKIEGDLRAMLKKTPILKKGAGEEEEIDIMELLKNVDPKEYEKYARMYGITDFRGLLQAFELLKQSQEEETHRLEIEEIERSERDEKEFEELVSFIQQRLSQTEPVTLIKDIENQTVLKDNDAVFEIDIKINYPEIKLSWYKGTEKLEPSDKFEISIDGDRHTLRVKNCQLKDQGNYRLVCGPHIASAKLTVIEPAWERHLQDVTLKEGQTCTMTCQFSVPNVKSEWFRNGRILKPQGRHKTEVEHKVHKLTIADVRAEDQGQYTCKYEDLETSAELRIEAEPIQFTKRIQNIVVSEHQSATFECEVSFDDAIVTWYKGPTELTESQKYNFRNDGRCHYMTIHNVTPDDEGVYSVIARLEPRGEARSTAELYLTTKEIKLELKPPDIPDSRVPIPTMPIRAVPPEEIPPVVAPPIPLLLPTPEEKKPPPKRIEVTKKAVKKDAKKVVAKPKEMTPREEIVKKPPPPTTLIPAKAPEIIDVSSKAEEVKIMTITRKKEVQKEKEAVYEKKQAVHKEKRVFIESFEEPYDELEVEPYTEPFEQPYYEEPDEDYEEIKVEAKKEVHEEWEEDFEEGQEYYEREEGYDEGEEEWEEAYQEREVIQVQKEVYEESHERKVPAKVPEKKAPPPPKVIKKPVIEKIEKTSRRMEEEKVQVTKVPEVSKKIVPQKPSRTPVQEEVIEVKVPAVHTKKMVISEEKMFFASHTEEEVSVTVPEVQKEIVTEEKIHVAISKRVEPPPKVPELPEKPAPEEVAPVPIPKKVEPPAPKVPEVPKKPVPEEKKPVPVPKKEPAAPPKVPEVPKKPVPEEKIPVPVAKKKEAPPAKVPEVQKGVVTEEKITIVTQREESPPPAVPEIPKKKVPEERKPVPRKEEEVPPPPKVPALPKKPVPEEKVAVPVPVAKKAPPPRAEVSKKTVVEEKRFVAEEKLSFAVPQRVEVTRHEVSAEEEWSYSEEEEGVSISVYREEEREEEEEAEVTEYEVMEEPEEYVVEEKLHIISKRVEAEPAEVTERQEKKIVLKPKIPAKIEEPPPAKVPEAPKKIVPEKKVPAPVPKKEKVPPPKVPEEPKKPVPEKKVPPKVIKMEEPLPAKVTERHMQITQEEKVLVAVTKKEAPPKARVPEEPKRAVPEEKVLKLKPKREEEPPAKVTEFRKRVVKEEKVSIEAPKREPQPIKEVTIMEEKERAYTLEEEAVSVQREEEYEEYEEYDYKEFEEYEPTEEYDQYEEYEEREYERYEEHEEYITEPEKPIPVKPVPEEPVPTKPKAPPAKVLKKAVPEEKVPVPIPKKLKPPPPKVPEEPKKVFEEKIRISITKREKEQVTEPAAKVPMKPKRVVAEEKVPVPRKEVAPPVRVPEVPKELEPEEVAFEEEVVTHVEEYLVEEEEEYIHEEEEFITEEEVVPVIPVKVPEVPRKPVPEEKKPVPVPKKKEAPPAKVPEVPKKPEEKVPVLIPKKEKPPPAKVPEVPKKPVPEEKVPVPVPKKVEAPPAKVPEVPKKPVPEKKVPVPAPKKVEAPPAKVPEVPKKLIPEEKKPTPVPKKVEAPPPKVPKKREPVPVPVALPQEEEVLFEEEIVPEEEVLPEEEEVLPEEEEVLPEEEEVLPEEEEIPPEEEEVPPEEEYVPEEEEFVPEEEVLPEVKPKVPVPAPVPEIKKKVTEKKVVIPKKEEAPPAKVPEVPKKVEEKRIILPKEEEVLPVEVTEEPEEEPISEEEIPEEPPSIEEVEEVAPPRVPEVIKKAVPEAPTPVPKKVEAPPAKVSKKIPEEKVPVPVQKKEAPPAKVPEVPKKVPEKKVLVPKKEAVPPAKGRTVLEEKVSVAFRQEVVVKERLELEVVEAEVEEIPEEEEFHEVEEYFEEGEFHEVEEFIKLEQHRVEEEHRVEKVHRVIEVFEAEEVEVFEKPKAPPKGPEISEKIIPPKKPPTKVVPRKEPPAKVPEVPKKIVVEEKVRVPEEPRVPPTKVPEVLPPKEVVPEKKVPVPPAKKPEAPPPKVPEAPKEVVPEKKVPVPPPKKPEVPPTKVPEVPKAAVPEKKVPEAIPPKPESPPPEVPEAPKEVVPEKKVPAAPPKKPEVTPVKVPEAPKEVVPEKKVPVPPPKKPEVPPTKVPEVPKVAVPEKKVPEAIPPKPESPPPEVFEEPEEVALEEPPAEVVEEPEPAAPPQVTVPPKKPVPEKKAPAVVAKKPELPPVKVPEVPKEVVPEKKVPLVVPKKPEAPPAKVPEVPKEVVPEKKVAVPKKPEVPPAKVPEVPKKPVLEEKPAVPVPERAESPPPEVYEEPEEIAPEEEIAPEEEKPVPVAEEEEPEVPPPAVPEEPKKIIPEKKVPVIKKPEAPPPKEPEPEKVIEKPKLKPRPPPPPPAPPKEDVKEKIFQLKAIPKKKVPEKPQVPEKVELTPLKVPGGEKKVRKLLPERKPEPKEEVVLKSVLRKRPEEEEPKVEPKKLEKVKKPAVPEPPPPKPVEEVEVPTVTKRERKIPEPTKVPEIKPAIPLPAPEPKPKPEAEVKTIKPPPVEPEPTPIAAPVTVPVVGKKAEAKAPKEEAAKPKGPIKGVPKKTPSPIEAERRKLRPGSGGEKPPDEAPFTYQLKAVPLKFVKEIKDIILTESEFVGSSAIFECLVSPSTAITTWMKDGSNIRESPKHRFIADGKDRKLHIIDVQLSDAGEYTCVLRLGNKEKTSTAKLVVEELPVRFVKTLEEEVTVVKGQPLYLSCELNKERDVVWRKDGKIVVEKPGRIVPGVIGLMRALTINDADDTDAGTYTVTVENANNLECSSCVKVVEVIRDWLVKPIRDQHVKPKGTAIFACDIAKDTPNIKWFKGYDEIPAEPNDKTEILRDGNHLYLKIKNAMPEDIAEYAVEIEGKRYPAKLTLGEREVELLKPIEDVTIYEKESASFDAEISEADIPGQWKLKGELLRPSPTCEIKAEGGKRFLTLHKVKLDQAGEVLYQALNAITTAILTVKEIELDFAVPLKDVTVPERRQARFECVLTREANVIWSKGPDIIKSSDKFDIIADGKKHILVINDSQFDDEGVYTAEVEGKKTSARLFVTGIRLKFMSPLEDQTVKEGETATFVCELSHEKMHVVWFKNDAKLHTSRTVLISSEGKTHKLEMKEVTLDDISQIKAQVKELSSTAQLKVLEADPYFTVKLHDKTAVEKDEITLKCEVSKDVPVKWFKDGEEIVPSPKYSIKADGLRRILKIKKADLKDKGEYVCDCGTDKTKANVTVEARLIKVEKPLYGVEVFVGETAHFEIELSEPDVHGQWKLKGQPLTASPDCEIIEDGKKHILILHNCQLGMTGEVSFQAANAKSAANLKVKELPLIFITPLSDVKVFEKDEAKFECEVSREPKTFRWLKGTQEITGDDRFELIKDGTKHSMVIKSAAFEDEAKYMFEAEDKHTSGKLIIEGIRLKFLTPLKDVTAKEKESAVFTVELSHDNIRVKWFKNDQRLHTTRSVSMQDEGKTHSITFKDLSIDDTSQIRVEAMGMSSEAKLTVLEGDPYFTGKLQDYTGVEKDEVILQCEISKADAPVKWFKDGKEIKPSKNAVIKADGKKRMLILKKALKSDIGQYTCDCGTDKTSGKLDIEDREIKLVRPLHSVEVMETETARFETEISEDDIHANWKLKGEALLQTPDCEIKEEGKIHSLVLHNCRLDQTGGVDFQAANVKSSAHLRVKPRVIGLLRPLKDVTVTAGETATFDCELSYEDIPVEWYLKGKKLEPSDKVVPRSEGKVHTLTLRDVKLEDAGEVQLTAKDFKTHANLFVKEPPVEFTKPLEDQTVEEGATAVLECEVSRENAKVKWFKNGTEILKSKKYEIVADGRVRKLVIHDCTPEDIKTYTCDAKDFKTSCNLNVVPPHVEFLRPLTDLQVREKEMARFECELSRENAKVKWFKDGAEIKKGKKYDIISKGAVRILVINKCLLDDEAEYSCEVRTARTSGMLTVLEEEAVFTKNLANIEVSETDTIKLVCEVSKPGAEVIWYKGDEEIIETGRYEILTEGRKRILVIQNAHLEDAGNYNCRLPSSRTDGKVKVHELAAEFISKPQNLEILEGEKAEFVCSISKESFPVQWKRDDKTLESGDKYDVIADGKKRVLVVKDATLQDMGTYVVMVGAARAAAHLTVIEKLRIVVPLKDTRVKEQQEVVFNCEVNTEGAKAKWFRNEEAIFDSSKYIILQKDLVYTLRIRDAHLDDQANYNVSLTNHRGENVKSAANLIVEEEDLRIVEPLKDIETMEKKSVTFWCKVNRLNVTLKWTKNGEEVPFDNRVSYRVDKYKHMLTIKDCGFPDEGEYIVTAGQDKSVAELLIIEAPTEFVEHLEDQTVTEFDDAVFSCQLSREKANVKWYRNGREIKEGKKYKFEKDGSIHRLIIKDCRLDDECEYACGVEDRKSRARLFVEEIPVEIIRPPQDILEAPGADVVFLAELNKDKVEVQWLRNNMVVVQGDKHQMMSEGKIHRLQICDIKPRDQGEYRFIAKDKEARAKLELAAAPKIKTADQDLVVDVGKPLTMVVPYDAYPKAEAEWFKENEPLSTKTIDTTAEQTSFRILEAKKGDKGRYKIVLQNKHGKAEGFINLKVIDVPGPVRNLEVTETFDGEVSLAWEEPLTDGGSKIIGYVVERRDIKRKTWVLATDRAESCEFTVTGLQKGGVEYLFRVSARNRVGTGEPVETDNPVEARSKYDVPGPPLNVTITDVNRFGVSLTWEPPEYDGGAEITNYVIELRDKTSIRWDTAMTVRAEDLSATVTDVVEGQEYSFRVRAQNRIGVGKPSAATPFVKVADPIERPSPPVNLTSSDQTQSSVQLKWEPPLKDGGSPILGYIIERCEEGKDNWIRCNMKLVPELTYKVTGLEKGNKYLYRVSAENKAGVSDPSEILGPLTADDAFVEPTMDLSAFKDGLEVIVPNPITILVPSTGYPRPTATWCFGDKVLETGDRVKMKTLSAYAELVISPSERSDKGIYTLKLENRVKTISGEIDVNVIARPSAPKELKFGDITKDSVHLTWEPPDDDGGSPLTGYVVEKREVSRKTWTKVMDFVTDLEFTVPDLVQGKEYLFKVCARNKCGPGEPAYVDEPVNMSTPATVPDPPENVKWRDRTANSIFLTWDPPKNDGGSRIKGYIVERCPRGSDKWVACGEPVAETKMEVTGLEEGKWYAYRVKALNRQGASKPSRPTEEIQAVDTQEAPEIFLDVKLLAGLTVKAGTKIELPATVTGKPEPKITWTKADMILKQDKRITIENVPKKSTVTIVDSKRSDTGTYIIEAVNVCGRATAVVEVNVLDKPGPPAAFDITDVTNESCLLTWNPPRDDGGSKITNYVVERRATDSEVWHKLSSTVKDTNFKATKLIPNKEYIFRVAAENMYGVGEPVQASPITAKYQFDPPGPPTRLEPSDITKDAVTLTWCEPDDDGGSPITGYWVERLDPDTDKWVRCNKMPVKDTTYRVKGLTNKKKYRFRVLAENLAGPGKPSKSTEPILIKDPIDPPWPPGKPTVKDVGKTSVRLNWTKPEHDGGAKIESYVIEMLKTGTDEWVRVAEGVPTTQHLLPGLMEGQEYSFRVRAVNKAGESEPSEPSDPVLCREKLYPPSPPRWLEVINITKNTADLKWTVPEKDGGSPITNYIVEKRDVRRKGWQTVDTTVKDTKCTVTPLTEGSLYVFRVAAENAIGQSDYTEIEDSVLAKDTFTTPGPPYALAVVDVTKRHVDLKWEPPKNDGGRPIQRYVIEKKERLGTRWVKAGKTAGPDCNFRVTDVIEGTEVQFQVRAENEAGVGHPSEPTEILSIEDPTSPPSPPLDLHVTDAGRKHIAIAWKPPEKNGGSPIIGYHVEMCPVGTEKWMRVNSRPIKDLKFKVEEGVVPDKEYVLRVRAVNAIGVSEPSEISENVVAKDPDCKPTIDLETHDIIVIEGEKLSIPVPFRAVPVPTVSWHKDGKEVKASDRLTMKNDHISAHLEVPKSVRADAGIYTITLENKLGSATASINVKVIGLPGPCKDIKASDITKSSCKLTWEPPEFDGGTPILHYVLERREAGRRTYIPVMSGENKLSWTVKDLIPNGEYFFRVKAVNKVGGGEYIELKNPVIAQDPKQPPDPPVDVEVHNPTAEAMTITWKPPLYDGGSKIMGYIIEKIAKGEERWKRCNEHLVPILTYTAKGLEEGKEYQFRVRAENAAGISEPSRATPPTKAVDPIDAPKVILRTSLEVKRGDEIALDASISGSPYPTITWIKDENVIVPEEIKKRAAPLVRRRKGEVQEEEPFVLPLTQRLSIDNSKKGESQLRVRDSLRPDHGLYMIKVENDHGIAKAPCTVSVLDTPGPPINFVFEDIRKTSVLCKWEPPLDDGGSEIINYTLEKKDKTKPDSEWIVVTSTLRHCKYSVTKLIEGKEYLFRVRAENRFGPGPPCVSKPLVAKDPFGPPDAPDKPIVEDVTSNSMLVKWNEPKDNGSPILGYWLEKREVNSTHWSRVNKSLLNALKANVDGLLEGLTYVFRVCAENAAGPGKFSPPSDPKTAHDPISPPGPPIPRVTDTSSTTIELEWEPPAFNGGGEIVGYFVDKQLVGTNEWSRCTEKMIKVRQYTVKEIREGADYKLRVSAVNAAGEGPPGETQPVTVAEPQEPPAVELDVSVKGGIQIMAGKTLRIPAVVTGRPVPTKVWTKEEGELDKDRVVIDNVGTKSELIIKDALRKDHGRYVITATNSCGSKFAAARVEVFDVPGPVLDLKPVVTNRKMCLLNWSDPEDDGGSEITGFIIERKDAKMHTWRQPIETERSKCDITGLLEGQEYKFRVIAKNKFGCGPPVEIGPILAVDPLGPPTSPERLTYTERTKSTITLDWKEPRSNGGSPIQGYIIEKRRHDKPDFERVNKRLCPTTSFLVENLDEHQMYEFRVKAVNEIGESEPSLPLNVVIQDDEVPPTIKLRLSVRGDTIKVKAGEPVHIPADVTGLPMPKIEWSKNETVIEKPTDALQITKEEVSRSEAKTELSIPKAVREDKGTYTVTASNRLGSVFRNVHVEVYDRPSPPRNLAVTDIKAESCYLTWDAPLDNGGSEITHYVIDKRDASRKKAEWEEVTNTAVEKRYGIWKLIPNGQYEFRVRAVNKYGISDECKSDKVVIQDPYRLPGPPGKPKVLARTKGSMLVSWTPPLDNGGSPITGYWLEKREEGSPYWSRVSRAPITKVGLKGVEFNVPRLLEGVKYQFRAMAINAAGIGPPSEPSDPEVAGDPIFPPGPPSCPEVKDKTKSSISLGWKPPAKDGGSPIKGYIVEMQEEGTTDWKRVNEPDKLITTCECVVPNLKELRKYRFRVKAVNEAGESEPSDTTGEIPATDIQEEPEVFIDIGAQDCLVCKAGSQIRIPAVIKGRPTPKSSWEFDGKAKKAMKDGVHDIPEDAQLETAENSSVIIIPECKRSHTGKYSITAKNKAGQKTANCRVKVMDVPGPPKDLKVSDITRGSCRLSWKMPDDDGGDRIKGYVIEKRTIDGKAWTKVNPDCGSTTFVVPDLLSEQQYFFRVRAENRFGIGPPVETIQRTTARDPIYPPDPPIKLKIGLITKNTVHLSWKPPKNDGGSPVTHYIVECLAWDPTGTKKEAWRQCNKRDVEELQFTVEDLVEGGEYEFRVKAVNAAGVSKPSATVGPVTVKDQTCPPSIDLKEFMEVEEGTNVNIVAKIKGVPFPTLTWFKAPPKKPDNKEPVLYDTHVNKLVVDDTCTLVIPQSRRSDTGLYTITAVNNLGTASKEMRLNVLGRPGPPVGPIKFESVSADQMTLSWFPPKDDGGSKITNYVIEKREANRKTWVHVSSEPKECTYTIPKLLEGHEYVFRIMAQNKYGIGEPLDSEPETARNLFSVPGAPDKPTVSSVTRNSMTVNWEEPEYDGGSPVTGYWLEMKDTTSKRWKRVNRDPIKAMTLGVSYKVTGLIEGSDYQFRVYAINAAGVGPASLPSDPATARDPIAPPGPPFPKVTDWTKSSADLEWSPPLKDGGSKVTGYIVEYKEEGKEEWEKGKDKEVRGTKLVVTGLKEGAFYKFRVRAVNIAGIGEPGEVTDVIEMKDRLVSPDLQLDASVRDRIVVHAGGVIRIIAYVSGKPPPTVTWNMNERTLPQEATIETTAISSSMVIKNCQRSHQGVYSLLAKNEAGERKKTIIVDVLDVPGPVGTPFLAHNLTNESCKLTWFSPEDDGGSPITNYVIEKRESDRRAWTPVTYTVTRQNATVQGLIQGKAYFFRIAAENSIGMGPFVETSEALVIREPITVPERPEDLEVKEVTKNTVTLTWNPPKYDGGSEIINYVLESRLIGTEKFHKVTNDNLLSRKYTVKGLKEGDTYEYRVSAVNIVGQGKPSFCTKPITCKDELAPPTLHLDFRDKLTIRVGEAFALTGRYSGKPKPKVSWFKDEADVLEDDRTHIKTTPATLALEKIKAKRSDSGKYCVVVENSTGSRKGFCQVNVVDRPGPPVGPVSFDEVTKDYMVISWKPPLDDGGSKITNYIIEKKEVGKDVWMPVTSASAKTTCKVSKLLEGKDYIFRIHAENLYGISDPLVSDSMKAKDRFRVPDAPDQPIVTEVTKDSALVTWNKPHDGGKPITNYILEKRETMSKRWARVTKDPIHPYTKFRVPDLLEGCQYEFRVSAENEIGIGDPSPPSKPVFAKDPIAKPSPPVNPEAIDTTCNSVDLTWQPPRHDGGSKILGYIVEYQKVGDEEWRRANHTPESCPETKYKVTGLRDGQTYKFRVLAVNAAGESDPAHVPEPVLVKDRLEPPELILDANMAREQHIKVGDTLRLSAIIKGVPFPKVTWKKEDRDAPTKARIDVTPVGSKLEIRNAAHEDGGIYSLTVENPAGSKTVSVKVLVLDKPGPPRDLEVSEIRKDSCYLTWKEPLDDGGSVITNYVVERRDVASAQWSPLSATSKKKSHFAKHLNEGNQYLFRVAAENQYGRGPFVETPKPIKALDPLHPPGPPKDLHHVDVDKTEVSLVWNKPDRDGGSPITGYLVEYQEEGTQDWIKFKTVTNLECVVTGLQQGKTYRFRVKAENIVGLGLPDTTIPIECQEKLVPPSVELDVKLIEGLVVKAGTTVRFPAIIRGVPVPTAKWTTDGSEIKTDEHYTVETDNFSSVLTIKNCLRRDTGEYQITVSNAAGSKTVAVHLTVLDVPGPPTGPINILDVTPEHMTISWQPPKDDGGSPVINYIVEKQDTRKDTWGVVSSGSSKTKLKIPHLQKGCEYVFRVRAENKIGVGPPLDSTPTVAKHKFSPPSPPGKPVVTDITENAATVSWTLPKSDGGSPITGYYMERREVTGKWVRVNKTPIADLKFRVTGLYEGNTYEFRVFAENLAGLSKPSPSSDPIKACRPIKPPGPPINPKLKDKSRETADLVWTKPLSDGGSPILGYVVECQKPGTAQWNRINKDELIRQCAFRVPGLIEGNEYRFRIKAANIVGEGEPRELAESVIAKDILHPPEVELDVTCRDVITVRVGQTIRILARVKGRPEPDITWTKEGKVLVREKRVDLIQDLPRVELQIKEAVRADHGKYIISAKNSSGHAQGSAIVNVLDRPGPCQNLKVTNVTKENCTISWENPLDNGGSEITNFIVEYRKPNQKGWSIVASDVTKRLIKANLLANNEYYFRVCAENKVGVGPTIETKTPILAINPIDRPGEPENLHIADKGKTFVYLKWRRPDYDGGSPNLSYHVERRLKGSDDWERVHKGSIKETHYMVDRCVENQIYEFRVQTKNEGGESDWVKTEEVVVKEDLQKPVLDLKLSGVLTVKAGDTIRLEAGVRGKPFPEVAWTKDKDATDLTRSPRVKIDTRADSSKFSLTKAKRSDGGKYVVTATNTAGSFVAYATVNVLDKPGPVRNLKIVDVSSDRCTVCWDPPEDDGGCEIQNYILEKCETKRMVWSTYSATVLTPGTTVTRLIEGNEYIFRVRAENKIGTGPPTESKPVIAKTKYDKPGRPDPPEVTKVSKEEMTVVWNPPEYDGGKSITGYFLEKKEKHSTRWVPVNKSAIPERRMKVQNLLPDHEYQFRVKAENEIGIGEPSLPSRPVVAKDPIEPPGPPTNFRVVDTTKHSITLGWGKPVYDGGAPIIGYVVEMRPKIADASPDEGWKRCNAAAQLVRKEFTVTSLDENQEYEFRVCAQNQVGIGRPAELKEAIKPKEILEPPEIDLDASMRKLVIVRAGCPIRLFAIVRGRPAPKVTWRKVGIDNVVRKGQVDLVDTMAFLVIPNSTRDDSGKYSLTLVNPAGEKAVFVNVRVLDTPGPVSDLKVSDVTKTSCHVSWAPPENDGGSQVTHYIVEKREADRKTWSTVTPEVKKTSFHVTNLVPGNEYYFRVTAVNEYGPGVPTDVPKPVLASDPLSEPDPPRKLEVTEMTKNSATLAWLPPLRDGGAKIDGYITSYREEEQPADRWTEYSVVKDLSLVVTGLKEGKKYKFRVAARNAVGVSLPREAEGVYEAKEQLLPPKILMPEQITIKAGKKLRIEAHVYGKPHPTCKWKKGEDEVVTSSHLAVHKADSSSILIIKDVTRKDSGYYSLTAENSSGTDTQKIKVVVMDAPGPPQPPFDISDIDADACSLSWHIPLEDGGSNITNYIVEKCDVSRGDWVTALASVTKTSCRVGKLIPGQEYIFRVRAENRFGISEPLTSPKMVAQFPFGVPSEPKNARVTKVNKDCIFVAWDRPDSDGGSPIIGYLIERKERNSLLWVKANDTLVRSTEYPCAGLVEGLEYSFRIYALNKAGSSPPSKPTEYVTARMPVDPPGKPEVIDVTKSTVSLIWARPKHDGGSKIIGYFVEACKLPGDKWVRCNTAPHQIPQEEYTATGLEEKAQYQFRAIARTAVNISPPSEPSDPVTILAENVPPRIDLSVAMKSLLTVKAGTNVCLDATVFGKPMPTVSWKKDGTLLKPAEGIKMAMQRNLCTLELFSVNRKDSGDYTITAENSSGSKSATIKLKVLDKPGPPASVKINKMYSDRAMLSWEPPLEDGGSEITNYIVDKRETSRPNWAQVSATVPITSCSVEKLIEGHEYQFRICAENKYGVGDPVFTEPAIAKNPYDPPGRCDPPVISNITKDHMTVSWKPPADDGGSPITGYLLEKRETQAVNWTKVNRKPIIERTLKATGLQEGTEYEFRVTAINKAGPGKPSDASKAAYARDPQYPPGPPAFPKVYDTTRSSVSLSWGKPAYDGGSPIIGYLVEVKRADSDNWVRCNLPQNLQKTRFEVTGLMEDTQYQFRVYAVNKIGYSDPSDVPDKHYPKDILIPPEGELDADLRKTLILRAGVTMRLYVPVKGRPPPKITWSKPNVNLRDRIGLDIKSTDFDTFLRCENVNKYDAGKYILTLENSCGKKEYTIVVKVLDTPGPPVNVTVKEISKDSAYVTWEPPIIDGGSPIINYVVQKRDAERKSWSTVTTECSKTSFRVANLEEGKSYFFRVFAENEYGIGDPGETRDAVKASQTPGPVVDLKVRSVSKSSCSIGWKKPHSDGGSRIIGYVVDFLTEENKWQRVMKSLSLQYSAKDLTEGKEYTFRVSAENENGEGTPSEITVVARDDVVAPDLDLKGLPDLCYLAKENSNFRLKIPIKGKPAPSVSWKKGEDPLATDTRVSVESSAVNTTLIVYDCQKSDAGKYTITLKNVAGTKEGTISIKVVGKPGIPTGPIKFDEVTAEAMTLKWAPPKDDGGSEITNYILEKRDSVNNKWVTCASAVQKTTFRVTRLHEGMEYTFRVSAENKYGVGEGLKSEPIVARHPFDVPDAPPPPNIVDVRHDSVSLTWTDPKKTGGSPITGYHLEFKERNSLLWKRANKTPIRMRDFKVTGLTEGLEYEFRVMAINLAGVGKPSLPSEPVVALDPIDPPGKPEVINITRNSVTLIWTEPKYDGGHKLTGYIVEKRDLPSKSWMKANHVNVPECAFTVTDLVEGGKYEFRIRAKNTAGAISAPSESTETIICKDEYEAPTIVLDPTIKDGLTIKAGDTIVLNAISILGKPLPKSSWSKAGKDIRPSDITQITSTPTSSMLTIKYATRKDAGEYTITATNPFGTKVEHVKVTVLDVPGPPGPVEISNVSAEKATLTWTPPLEDGGSPIKSYILEKRETSRLLWTVVSEDIQSCRHVATKLIQGNEYIFRVSAVNHYGKGEPVQSEPVKMVDRFGPPGPPEKPEVSNVTKNTATVSWKRPVDDGGSEITGYHVERREKKSLRWVRAIKTPVSDLRCKVTGLQEGSTYEFRVSAENRAGIGPPSEASDSVLMKDAAYPPGPPSNPHVTDTTKKSASLAWGKPHYDGGLEITGYVVEHQKVGDEAWIKDTTGTALRITQFVVPDLQTKEKYNFRISAINDAGVGEPAVIPDVEIVEREMAPDFELDAELRRTLVVRAGLSIRIFVPIKGRPAPEVTWTKDNINLKNRANIENTESFTLLIIPECNRYDTGKFVMTIENPAGKKSGFVNVRVLDTPGPVLNLRPTDITKDSVTLHWDLPLIDGGSRITNYIVEKREATRKSYSTATTKCHKCTYKVTGLSEGCEYFFRVMAENEYGIGEPTETTEPVKASEAPSPPDSLNIMDITKSTVSLAWPKPKHDGGSKITGYVIEAQRKGSDQWTHITTVKGLECVVRNLTEGEEYTFQVMAVNSAGRSAPRESRPVIVKEQTMLPELDLRGIYQKLVIAKAGDNIKVEIPVLGRPKPTVTWKKGDQILKQTQRVNFETTATSTILNINECVRSDSGPYPLTARNIVGEVGDVITIQVHDIPGPPTGPIKFDEVSSDFVTFSWDPPENDGGVPISNYVVEMRQTDSTTWVELATTVIRTTYKATRLTTGLEYQFRVKAQNRYGVGPGITSACIVANYPFKVPGPPGTPQVTAVTKDSMTISWHEPLSDGGSPILGYHVERKERNGILWQTVSKALVPGNIFKSSGLTDGIAYEFRVIAENMAGKSKPSKPSEPMLALDPIDPPGKPVPLNITRHTVTLKWAKPEYTGGFKITSYIVEKRDLPNGRWLKANFSNILENEFTVSGLTEDAAYEFRVIAKNAAGAISPPSEPSDAITCRDDVEAPKIKVDVKFKDTVILKAGEAFRLEADVSGRPPPTMEWSKDGKELEGTAKLEIKIADFSTNLVNKDSTRRDSGAYTLTATNPGGFAKHIFNVKVLDRPGPPEGPLAVTEVTSEKCVLSWFPPLDDGGAKIDHYIVQKRETSRLAWTNVASEVQVTKLKVTKLLKGNEYIFRVMAVNKYGVGEPLESEPVLAVNPYGPPDPPKNPEVTTITKDSMVVCWGHPDSDGGSEIINYIVERRDKAGQRWIKCNKKTLTDLRYKVSGLTEGHEYEFRIMAENAAGISAPSPTSPFYKACDTVFKPGPPGNPRVLDTSRSSISIAWNKPIYDGGSEITGYMVEIALPEEDEWQIVTPPAGLKATSYTITGLTENQEYKIRIYAMNSEGLGEPALVPGTPKAEDRMLPPEIELDADLRKVVTIRACCTLRLFVPIKGRPAPEVKWARDHGESLDKASIESTSSYTLLIVGNVNRFDSGKYILTVENSSGSKSAFVNVRVLDTPGPPQDLKVKEVTKTSVTLTWDPPLLDGGSKIKNYIVEKRESTRKAYSTVATNCHKTSWKVDQLQEGCSYYFRVLAENEYGIGLPAETAESVKASERPLPPGKITLMDVTRNSVSLSWEKPEHDGGSRILGYIVEMQTKGSDKWATCATVKVTEATITGLIQGEEYSFRVSAQNEKGISDPRQLSVPVIAKDLVIPPAFKLLFNTFTVLAGEDLKVDVPFIGRPTPAVTWHKDNVPLKQTTRVNAESTENNSLLTIKDACREDVGHYVVKLTNSAGEAIETLNVIVLDKPGPPTGPVKMDEVTADSITLSWGPPKYDGGSSINNYIVEKRDTSTTTWQIVSATVARTTIKACRLKTGCEYQFRIAAENRYGKSTYLNSEPTVAQYPFKVPGPPGTPVVTLSSRDSMEVQWNEPISDGGSRVIGYHLERKERNSILWVKLNKTPIPQTKFKTTGLEEGVEYEFRVSAENIVGIGKPSKVSECYVARDPCDPPGRPEAIIVTRNSVTLQWKKPTYDGGSKITGYIVEKKELPEGRWMKASFTNIIDTHFEVTGLVEDHRYEFRVIARNAAGVFSEPSESTGAITARDEVDPPRISMDPKYKDTIVVHAGESFKVDADIYGKPIPTIQWIKGDQELSNTARLEIKSTDFATSLSVKDAVRVDSGNYILKAKNVAGERSVTVNVKVLDRPGPPEGPVVISGVTAEKCTLAWKPPLQDGGSDIINYIVERRETSRLVWTVVDANVQTLSCKVTKLLEGNEYTFRIMAVNKYGVGEPLESEPVVAKNPFVVPDAPKAPEVTTVTKDSMIVVWERPASDGGSEILGYVLEKRDKEGIRWTRCHKRLIGELRLRVTGLIENHDYEFRVSAENAAGLSEPSPPSAYQKACDPIYKPGPPNNPKVIDITRSSVFLSWSKPIYDGGCEIQGYIVEKCDVSVGEWTMCTPPTGINKTNIEVEKLLEKHEYNFRICAINKAGVGEHADVPGPIIVEEKLEAPDIDLDLELRKIINIRAGGSLRLFVPIKGRPTPEVKWGKVDGEIRDAAIIDVTSSFTSLVLDNVNRYDSGKYTLTLENSSGTKSAFVTVRVLDTPSPPVNLKVTEITKDSVSITWEPPLLDGGSKIKNYIVEKREATRKSYAAVVTNCHKNSWKIDQLQEGCSYYFRVTAENEYGIGLPAQTADPIKVAEVPQPPGKITVDDVTRNSVSLSWTKPEHDGGSKIIQYIVEMQAKHSEKWSECARVKSLQAVITNLTQGEEYLFRVVAVNEKGRSDPRSLAVPIVAKDLVIEPDVKPAFSSYSVQVGQDLKIEVPISGRPKPTITWTKDGLPLKQTTRINVTDSLDLTTLSIKETHKDDGGQYGITVANVVGQKTASIEIVTLDKPDPPKGPVKFDDVSAESITLSWNPPLYTGGCQITNYIVQKRDTTTTVWDVVSATVARTTLKVTKLKTGTEYQFRIFAENRYGQSFALESDPIVAQYPYKEPGPPGTPFATAISKDSMVIQWHEPVNNGGSPVIGYHLERKERNSILWTKVNKTIIHDTQFKAQNLEEGIEYEFRVYAENIVGVGKASKNSECYVARDPCDPPGTPEPIMVKRNEITLQWTKPVYDGGSMITGYIVEKRDLPDGRWMKASFTNVIETQFTVSGLTEDQRYEFRVIAKNAAGAISKPSDSTGPITAKDEVELPRISMDPKFRDTIVVNAGETFRLEADVHGKPLPTIEWLRGDKEIEESARCEIKNTDFKALLIVKDAIRIDGGQYILRASNVAGSKSFPVNVKVLDRPGPPEGPVQVTGVTSEKCSLTWSPPLQDGGSDISHYVVEKRETSRLAWTVVASEVVTNSLKVTKLLEGNEYVFRIMAVNKYGVGEPLESAPVLMKNPFVLPGPPKSLEVTNIAKDSMTVCWNRPDSDGGSEIIGYIVEKRDRSGIRWIKCNKRRITDLRLRVTGLTEDHEYEFRVSAENAAGVGEPSPATVYYKACDPVFKPGPPTNAHIVDTTKNSITLAWGKPIYDGGSEILGYVVEICKADEEEWQIVTPQTGLRVTRFEISKLTEHQEYKIRVCALNKVGLGEATSVPGTVKPEDKLEAPELDLDSELRKGIVVRAGGSARIHIPFKGRPTPEITWSREEGEFTDKVQIEKGVNYTQLSIDNCDRNDAGKYILKLENSSGSKSAFVTVKVLDTPGPPQNLAVKEVRKDSAFLVWEPPIIDGGAKVKNYVIDKRESTRKAYANVSSKCSKTSFKVENLTEGAIYYFRVMAENEFGVGVPVETVDAVKAAEPPSPPGKVTLTDVSQTSASLMWEKPEHDGGSRVLGYVVEMQPKGTEKWSIVAESKVCNAVVTGLSSGQEYQFRVKAYNEKGKSDPRVLGVPVIAKDLTIQPSLKLPFNTYSIQAGEDLKIEIPVIGRPRPNISWVKDGEPLKQTTRVNVEETATSTVLHIKEGNKDDFGKYTVTATNSAGTATENLSVIVLEKPGPPVGPVRFDEVSADFVVISWEPPAYTGGCQISNYIVEKRDTTTTTWHMVSATVARTTIKITKLKTGTEYQFRIFAENRYGKSAPLDSKAVIVQYPFKEPGPPGTPFVTSISKDQMLVQWHEPVNDGGTKIIGYHLEQKEKNSILWVKLNKTPIQDTKFKTTGLDEGLEYEFKVSAENIVGIGKPSKVSECFVARDPCDPPGRPEAIVITRNNVTLKWKKPAYDGGSKITGYIVEKKDLPDGRWMKASFTNVLETEFTVSGLVEDQRYEFRVIARNAAGNFSEPSDSSGAITARDEIDAPNASLDPKYKDVIVVHAGETFVLEADIRGKPIPDVVWSKDGKELEETAARMEIKSTIQKTTLVVKDCIRTDGGQYILKLSNVGGTKSIPITVKVLDRPGPPEGPLKVTGVTAEKCYLAWNPPLQDGGANISHYIIEKRETSRLSWTQVSTEVQALNYKVTKLLPGNEYIFRVMAVNKYGIGEPLESGPVTACNPYKPPGPPSTPEVSAITKDSMVVTWARPVDDGGTEIEGYILEKRDKEGVRWTKCNKKTLTDLRLRVTGLTEGHSYEFRVAAENAAGVGEPSEPSVFYRACDALYPPGPPSNPKVTDTSRSSVSLAWSKPIYDGGAPVKGYVVEVKEAAADEWTTCTPPTGLQGKQFTVTKLKENTEYNFRICAINSEGVGEPATLPGSVVAQERIEPPEIELDADLRKVVVLRASATLRLFVTIKGRPEPEVKWEKAEGILTDRAQIEVTSSFTMLVIDNVTRFDSGRYNLTLENNSGSKTAFVNVRVLDSPSAPVNLTIREVKKDSVTLSWEPPLIDGGAKITNYIVEKRETTRKAYATITNNCTKTTFRIENLQEGCSYYFRVLASNEYGIGLPAETTEPVKVSEPPLPPGRVTLVDVTRNTATIKWEKPESDGGSKITGYVVEMQTKGSEKWSTCTQVKTLEATISGLTAGEEYVFRVAAVNEKGRSDPRQLGVPVIARDIEIKPSVELPFHTFNVKAREQLKIDVPFKGRPQATVNWRKDGQTLKETTRVNVSSSKTVTSLSIKEASKEDVGTYELCVSNSAGSITVPITIIVLDRPGPPGPIRIDEVSCDSITISWNPPEYDGGCQISNYIVEKKETTSTTWHIVSQAVARTSIKIVRLTTGSEYQFRVCAENRYGKSSYSESSAVVAEYPFSPPGPPGTPKVVHATKSTMLVTWQVPVNDGGSRVIGYHLEYKERSSILWSKANKILIADTQMKVSGLDEGLMYEYRVYAENIAGIGKCSKSCEPVPARDPCDPPGQPEVTNITRKSVSLKWSKPHYDGGAKITGYIVERRELPDGRWLKCNYTNIQETYFEVTELTEDQRYEFRVFARNAADSVSEPSESTGPIIVKDDVEPPRVMMDVKFRDVIVVKAGEVLKINADIAGRPLPVISWAKDGIEIEERARTEIISTDNHTLLTVKDCIRRDTGQYVLTLKNVAGTRSVAVNCKVLDKPGPPAGPLEINGLTAEKCSLSWGRPQEDGGADIDYYIVEKRETSHLAWTICEGELQMTSCKVTKLLKGNEYIFRVTGVNKYGVGEPLESVAIKALDPFTVPSPPTSLEITSVTKESMTLCWSRPESDGGSEISGYIIERREKNSLRWVRVNKKPVYDLRVKSTGLREGCEYEYRVYAENAAGLSLPSETSPLIRAEDPVFLPSPPSKPKIVDSGKTTITIAWVKPLFDGGAPITGYTVEYKKSDDTDWKTSIQSLRGTEYTISGLTTGAEYVFRVKSVNKVGASDPSDSSDPQIAKEREEEPLFDIDSEMRKTLIVKAGASFTMTVPFRGRPVPNVLWSKPDTDLRTRAYVDTTDSRTSLTIENANRNDSGKYTLTIQNVLSAASLTLVVKVLDTPGPPTNITVQDVTKESAVLSWDVPENDGGAPVKNYHIEKREASKKAWVSVTNNCNRLSYKVTNLQEGAIYYFRVSGENEFGVGIPAETKEGVKITEKPSPPEKLGVTSISKDSVSLTWLKPEHDGGSRIVHYVVEALEKGQKNWVKCAVAKSTHHVVSGLRENSEYFFRVFAENQAGLSDPRELLLPVLIKEQLEPPEIDMKNFPSHTVYVRAGSNLKVDIPISGKPLPKVTLSRDGVPLKATMRFNTEITAENLTINLKESVTADAGRYEITAANSSGTTKAFINIVVLDRPGPPTGPVVISDITEESVTLKWEPPKYDGGSQVTNYILLKRETSTAVWTEVSATVARTMMKVMKLTTGEEYQFRIKAENRFGISDHIDSACVTVKLPYTTPGPPSTPWVTNVTRESITVGWHEPVSNGGSAVVGYHLEMKDRNSILWQKANKLVIRTTHFKVTTISAGLIYEFRVYAENAAGVGKPSHPSEPVLAIDACEPPRNVRITDISKNSVSLSWQQPAFDGGSKITGYIVERRDLPDGRWTKASFTNVTETQFIISGLTQNSQYEFRVFARNAVGSISNPSEVVGPITCIDSYGGPVIDLPLEYTEVVKYRAGTSVKLRAGISGKPAPTIEWYKDDKELQTNALVCVENTTDLASILIKDADRLNSGCYELKLRNAMGSASATIRVQILDKPGPPGGPIEFKTVTAEKITLLWRPPADDGGAKITHYIVEKRETSRVVWSMVSEHLEECIITTTKIIKGNEYIFRVRAVNKYGIGEPLESDSVVAKNAFVTPGPPGIPEVTKITKNSMTVVWSRPIADGGSDISGYFLEKRDKKSLGWFKVLKETIRDTRQKVTGLTENSDYQYRVCAVNAAGQGPFSEPSEFYKAADPIDPPGPPAKIRIADSTKSSITLGWSKPVYDGGSAVTGYVVEIRQGEEEEWTTVSTKGEVRTTEYVVSNLKPGVNYYFRVSAVNCAGQGEPIEMNEPVQAKDILEAPEIDLDVALRTSVIAKAGEDVQVLIPFKGRPPPTVTWRKDEKNLGSDARYSIENTDSSSLLTIPQVTRNDTGKYILTIENGVGEPKSSTVSVKVLDTPAACQKLQVKHVSRGTVTLLWDPPLIDGGSPIINYVIEKRDATKRTWSVVSHKCSSTSFKLIDLSEKTPFFFRVLAENEIGIGEPCETTEPVKAAEVPAPIRDLSMKDSTKTSVILSWTKPDFDGGSVITEYVVERKGKGEQTWSHAGISKTCEIEVSQLKEQSVLEFRVFAKNEKGLSDPVTIGPITVKELIITPEVDLSDIPGAQVTVRIGHNVHLELPYKGKPKPSISWLKDGLPLKESEFVRFSKTENKITLSIKNAKKEHGGKYTVILDNAVCRIAVPITVITLGPPSKPKGPIRFDEIKADSVILSWDVPEDNGGGEITCYSIEKRETSQTNWKMVCSSVARTTFKVPNLVKDAEYQFRVRAENRYGVSQPLVSSIIVAKHQFRIPGPPGKPVIYNVTSDGMSLTWDAPVYDGGSEVTGFHVEKKERNSILWQKVNTSPISGREYRATGLVEGLDYQFRVYAENSAGLSSPSDPSKFTLAVSPVDPPGTPDYIDVTRETITLKWNPPLRDGGSKIVGYSIEKRQGNERWVRCNFTDVSECQYTVTGLSPGDRYEFRIIARNAVGTISPPSQSSGIIMTRDENVPPIVEFGPEYFDGLIIKSGESLRIKALVQGRPVPRVTWFKDGVEIEKRMNMEITDVLGSTSLFVRDATRDHRGVYTVEAKNASGSAKAEIKVKVQDTPGKVVGPIRFTNITGEKMTLWWDAPLNDGCAPITHYIIEKRETSRLAWALIEDKCEAQSYTAIKLINGNEYQFRVSAVNKFGVGRPLDSDPVVAQIQYTVPDAPGIPEPSNITGNSITLTWARPESDGGSEIQQYILERREKKSTRWVKVISKRPISETRFKVTGLTEGNEYEFHVMAENAAGVGPASGISRLIKCREPVNPPGPPTVVKVTDTSKTTVSLEWSKPVFDGGMEIIGYIIEMCKADLGDWHKVNAEACVKTRYTVTDLQAGEEYKFRVSAINGAGKGDSCEVTGTIKAVDRLTAPELDIDANFKQTHVVRAGASIRLFIAYQGRPTPTAVWSKPDSNLSLRADIHTTDSFSTLTVENCNRNDAGKYTLTVENNSGSKSITFTVKVLDTPGPPGPITFKDVTRGSATLMWDAPLLDGGARIHHYVVEKREASRRSWQVISEKCTRQIFKVNDLAEGVPYYFRVSAVNEYGVGEPYEMPEPIVATEQPAPPRRLDVVDTSKSSAVLAWLKPDHDGGSRITGYLLEMRQKGSDFWVEAGHTKQLTFTVERLVEKTEYEFRVKAKNDAGYSEPREAFSSVIIKEPQIEPTADLTGITNQLITCKAGSPFTIDVPISGRPAPKVTWKLEEMRLKETDRVSITTTKDRTTLTVKDSMRGDSGRYFLTLENTAGVKTFSVTVVVIGRPGPVTGPIEVSSVSAESCVLSWGEPKDGGGTEITNYIVEKRESGTTAWQLVNSSVKRTQIKVTHLTKYMEYSFRVSSENRFGVSKPLESAPIIAEHPFVPPSAPTRPEVYHVSANAMSIRWEEPYHDGGSKIIGYWVEKKERNTILWVKENKVPCLECNYKVTGLVEGLEYQFRTYALNAAGVSKASEASRPIMAQNPVDAPGRPEVTDVTRSTVSLIWSAPAYDGGSKVVGYIIERKPVSEVGDGRWLKCNYTIVSDNFFTVTALSEGDTYEFRVLAKNAAGVISKGSESTGPVTCRDEYAPPKAELDARLHGDLVTIRAGSDLVLDAAVGGKPEPKIIWTKGDKELDLCEKVSLQYTGKRATAVIKFCDRSDSGKYTLTVKNASGTKAVSVMVKVLDSPGPCGKLTVSRVTQEKCTLAWSLPQEDGGAEITHYIVERRETSRLNWVIVEGECPTLSYVVTRLIKNNEYIFRVRAVNKYGPGVPVESEPIVARNSFTIPSPPGIPEEVGTGKEHIIIQWTKPESDGGNEISNYLVDKREKKSLRWTRVNKDYVVYDTRLKVTSLMEGCDYQFRVTAVNAAGNSEPSEASNFISCREPSYTPGPPSAPRVVDTTKHSISLAWTKPMYDGGTDIVGYVLEMQEKDTDQWYRVHTNATIRNTEFTVPDLKMGQKYSFRVAAVNVKGMSEYSESIAEIEPVERIEIPDLELADDLKKTVTIRAGASLRLMVSVSGRPPPVITWSKQGIDLASRAIIDTTESYSLLIVDKVNRYDAGKYTIEAENQSGKKSATVLVKVYDTPGPCPSVKVKEVSRDSVTITWEIPTIDGGAPVNNYIVEKREAAMRAFKTVTTKCSKTLYRISGLVEGTMYYFRVLPENIYGIGEPCETSDAVLVSEVPLVPAKLEVVDVTKSTVTLAWEKPLYDGGSRLTGYVLEACKAGTERWMKVVTLKPTVLEHTVTSLNEGEQYLFRIRAQNEKGVSEPRETVTAVTVQDLRVLPTIDLSTMPQKTIHVPAGRPVELVIPIAGRPPPAASWFFAGSKLRESERVTVETHTKVAKLTIRETTIRDTGEYTLELKNVTGTTSETIKVIILDKPGPPTGPIKIDEIDATSITISWEPPELDGGAPLSGYVVEQRDAHRPGWLPVSESVTRSTFKFTRLTEGNEYVFRVAATNRFGIGSYLQSEVIECRSSIRIPGPPETLQIFDVSRDGMTLTWYPPEDDGGSQVTGYIVERKEVRADRWVRVNKVPVTMTRYRSTGLTEGLEYEHRVTAINARGSGKPSRPSKPIVAMDPIAPPGKPQNPRVTDTTRTSVSLAWSVPEDEGGSKVTGYLIEMQKVDQHEWTKCNTTPTKIREYTLTHLPQGAEYRFRVLACNAGGPGEPAEVPGTVKVTEMLEYPDYELDERYQEGIFVRQGGVIRLTIPIKGKPFPICKWTKEGQDISKRAMIATSETHTELVIKEADRGDSGTYDLVLENKCGKKAVYIKVRVIGSPNSPEGPLEYDDIQVRSVRVSWRPPADDGGADILGYILERREVPKAAWYTIDSRVRGTSLVVKGLKENVEYHFRVSAENQFGISKPLKSEEPVTPKTPLNPPEPPSNPPEVLDVTKSSVSLSWSRPKDDGGSRVTGYYIERKETSTDKWVRHNKTQITTTMYTVTGLVPDAEYQFRIIAQNDVGLSETSPASEPVVCKDPFDKPSQPGELEILSISKDSVTLQWEKPECDGGKEILGYWVEYRQSGDSAWKKSNKERIKDKQFTIGGLLEATEYEFRVFAENETGLSRPRRTAMSIKTKLTSGEAPGIRKEMKDVTTKLGEAAQLSCQIVGRPLPDIKWYRFGKELIQSRKYKMSSDGRTHTLTVMTEEQEDEGVYTCIATNEVGEVETSSKLLLQATPQFHPGYPLKEKYYGAVGSTLRLHVMYIGRPVPAMTWFHGQKLLQNSENITIENTEHYTHLVMKNVQRKTHAGKYKVQLSNVFGTVDAILDVEIQDKPDKPTGPIVIEALLKNSAVISWKPPADDGGSWITNYVVEKCEAKEGAEWQLVSSAISVTTCRIVNLTENAGYYFRVSAQNTFGISDPLEVSSVVIIKSPFEKPGAPGKPTITAVTKDSCVVAWKPPASDGGAKIRNYYLEKREKKQNKWISVTTEEIRETVFSVKNLIEGLEYEFRVKCENLGGESEWSEISEPITPKSDVPIQAPHFKEELRNLNVRYQSNATLVCKVTGHPKPIVKWYRQGKEIIADGLKYRIQEFKGGYHQLIIASVTDDDATVYQVRATNQGGSVSGTASLEVEVPAKIHLPKTLEGMGAVHALRGEVVSIKIPFSGKPDPVITWQKGQDLIDNNGHYQVIVTRSFTSLVFPNGVERKDAGFYVVCAKNRFGIDQKTVELDVADVPDPPRGVKVSDVSRDSVNLTWTEPASDGGSKITNYIVEKCATTAERWLRVGQARETRYTVINLFGKTSYQFRVIAENKFGLSKPSEPSEPTITKEDKTRAMNYDEEVDETREVSMTKASHSSTKELYEKYMIAEDLGRGEFGIVHRCVETSSKKTYMAKFVKVKGTDQVLVKKEISILNIARHRNILHLHESFESMEELVMIFEFISGLDIFERINTSAFELNEREIVSYVHQVCEALQFLHSHNIGHFDIRPENIIYQTRRSSTIKIIEFGQARQLKPGDNFRLLFTAPEYYAPEVHQHDVVSTATDMWSLGTLVYVLLSGINPFLAETNQQIIENIMNAEYTFDEEAFKEISIEAMDFVDRLLVKERKSRMTASEALQHPWLKQKIERVSTKVIRTLKHRRYYHTLIKKDLNMVVSAARISCGGAIRSQKGVSVAKVKVASIEIGPVSGQIMHAVGEEGGHVKYVCKIENYDQSTQVTWYFGVRQLENSEKYEITYEDGVAILYVKDITKLDDGTYRCKVVNDYGEDSSYAELFVKGVREVYDYYCRRTMKKIKRRTDTMRLLERPPEFTLPLYNKTAYVGENVRFGVTITVHPEPHVTWYKSGQKIKPGDNDKKYTFESDKGLYQLTINSVTTDDDAEYTVVARNKYGEDSCKAKLTVTLHPPPTDSTLRPMFKRLLANAECQEGQSVCFEIRVSGIPPPTLKWEKDGQPLSLGPNIEIIHEGLDYYALHIRDTLPEDTGYYRVTATNTAGSTSCQAHLQVERLRYKKQEFKSKEEHERHVQKQIDKTLRMAEILSGTESVPLTQVAKEALREAAVLYKPAVSTKTVKGEFRLEIEEKKEERKLRMPYDVPEPRKYKQTTIEEDQRIKQFVPMSDMKWYKKIRDQYEMPGKLDRVVQKRPKRIRLSRWEQFYVMPLPRITDQYRPKWRIPKLSQDDLEIVRPARRRTPSPDYDFYYRPRRRSLGDISDEELLLPIDDYLAMKRTEEERLRLEEELELGFSASPPSRSPPHFELSSLRYSSPQAHVKVEETRKDFRYSTYHIPTKAEASTSYAELRERHAQAAYRQPKQRQRIMAEREDEELLRPVTTTQHLSEYKSELDFMSKEEKSRKKSRRQREVTEITEIEEEYEISKHAQRESSSSASRLLRRRRSLSPTYIELMRPVSELIRSRPQPAEEYEDDTERRSPTPERTRPRSPSPVSSERSLSRFERSARFDIFSRYESMKAALKTQKTSERKYEVLSQQPFTLDHAPRITLRMRSHRVPCGQNTRFILNVQSKPTAEVKWYHNGVELQESSKIHYTNTSGVLTLEILDCHTDDSGTYRAVCTNYKGEASDYATLDVTGGDYTTYASQRRDEEVPRSVFPELTRTEAYAVSSFKKTSEMEASSSVREVKSQMTETRESLSSYEHSASAEMKSAALEEKSLEEKSTTRKIKTTLAARILTKPRSMTVYEGESARFSCDTDGEPVPTVTWLRKGQVLSTSARHQVTTTKYKSTFEISSVQASDEGNYSVVVENSEGKQEAEFTLTIQKARVTEKAVTSPPRVKSPEPRVKSPEAVKSPKRVKSPEPSHPKAVSPTETKPTPTEKVQHLPVSAPPKITQFLKAEASKEIAKLTCVVESSVLRAKEVTWYKDGKKLKENGHFQFHYSADGTYELKINNLTESDQGEYVCEISGEGGTSKTNLQFMGQAFKSIHEKVSKISETKKSDQKTTESTVTRKTEPKAPEPISSKPVIVTGLQDTTVSSDSVAKFAVKATGEPRPTAIWTKDGKAITQGGKYKLSEDKGGFFLEIHKTDTSDSGLYTCTVKNSAGSVSSSCKLTIKAIKDTEAQKVSTQKTSEITPQKKAVVQEEISQKALRSEEIKMSEAKSQEKLALKEEASKVLISEEVKKSAATSLEKSIVHEEITKTSQASEEVRTHAEIKAFSTQMSINEGQRLVLKANIAGATDVKWVLNGVELTNSEEYRYGVSGSDQTLTIKQASHRDEGILTCISKTKEGIVKCQYDLTLSKELSDAPAFISQPRSQNINEGQNVLFTCEISGEPSPEIEWFKNNLPISISSNVSISRSRNVYSLEIRNASVSDSGKYTIKAKNFRGQCSATASLMVLPLVEEPSREVVLRTSGDTSLQGSFSSQSVQMSASKQEASFSSFSSSSASSMTEMKFASMSAQSMSSMQESFVEMSSSSFMGISNMTQLESSTSKMLKAGIRGIPPKIEALPSDISIDEGKVLTVACAFTGEPTPEVTWSCGGRKIHSQEQGRFHIENTDDLTTLIIMDVQKQDGGLYTLSLGNEFGSDSATVNIHIRSI
"
     misc_feature    241..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    262..516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    535..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    556..804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    1753..1872
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    1879..2004
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2017..2142
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    2155..2280
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Titin Z; Region: Titin_Z; pfam09042"
                     /db_xref="CDD:149937"
     misc_feature    3052..3321
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    3103..3306
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    3469..3738
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    3520..3735
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    4102..4368
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4147..4353
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    4594..4866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4633..4866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    4891..5166
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    4912..5166
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    <5389..5607
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    5746..6012
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    5764..6012
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    6457..6729
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6508..6717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    6748..7011
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    6766..7011
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    7027..7281
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7045..>7233
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    <7387..>7512
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    7564..7815
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    7579..7815
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    7825..8076
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8089..8337
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8107..8337
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    8347..8601
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8611..8862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8626..8862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    8872..9123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    8890..9126
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    9136..9384
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9151..9384
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    9400..9651
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9418..9651
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    <9760..9924
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    9982..10203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10009..10200
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    10258..10518
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10279..10521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    10591..10860
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10642..10851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    10876..11145
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    10894..11145
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    11155..11424
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    11206..11415
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    11434..11706
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    11488..11697
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    11716..11976
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    11758..11955
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin C-2 Type; Region: IGc2; smart00408"
                     /db_xref="CDD:197706"
     misc_feature    11995..12264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    12046..12246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    12301..12543
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    12301..12543
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    12562..12831
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    12616..12816
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    12841..13110
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    12892..13101
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    13123..13392
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    13180..13377
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    13402..13668
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    13453..13662
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    13681..13950
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    13747..13938
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14017..14229
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    14248..14517
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    14305..14502
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    14527..14796
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    14545..14796
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    14806..15078
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    14863..15069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    15088..15351
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15139..15348
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    15367..15636
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15418..15624
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    15649..15915
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15667..15915
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    15934..16203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    15991..16188
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    16213..16482
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16264..16470
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    16492..16764
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16549..16755
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    16774..17040
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    16792..17040
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    17053..17325
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17077..17325
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    17338..17604
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17389..17595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    17623..17892
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17677..17883
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    17902..18171
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    17953..18162
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    18187..18444
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18202..18447
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    18460..18714
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18511..18720
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    18748..19014
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    18799..19008
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    19036..19305
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19093..19296
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    19315..19587
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19369..19575
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    19597..19863
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19648..19851
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    19876..20148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    19897..20148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    20155..20400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    20161..20427
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20446..20715
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20497..20706
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    20725..20994
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    20743..20994
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    21007..21273
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21034..21273
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    21283..21513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21334..21513
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    21571..21837
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21622..21831
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    21859..22128
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    21913..22119
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    22138..22410
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    22201..22401
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    22420..22671
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    22471..22671
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    22699..22971
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    22750..22962
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    22984..23250
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    23035..23241
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    23269..23538
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    23320..23526
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    23548..23811
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    23599..23808
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    23830..24087
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    23896..24075
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    24106..24375
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24157..24363
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    24394..24660
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24445..24654
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    24682..24951
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    24739..24942
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    24970..25242
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    25039..25227
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    25261..25530
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    25312..25515
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    25591..25857
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    25603..25857
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    26209..26451
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    26212..26451
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    26458..26712
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    26479..26712
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    26728..26988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    26746..26991
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    29203..29286
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="PPAK motif; Region: PPAK; pfam02818"
                     /db_xref="CDD:202413"
     misc_feature    29287..29367
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="PPAK motif; Region: PPAK; pfam02818"
                     /db_xref="CDD:202413"
     misc_feature    33571..33846
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    33631..33837
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    33904..34095
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    34162..>34356
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    34423..34668
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    34687..34935
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    34948..35199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    34966..35199
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    35212..35463
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    35242..35463
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    35479..35730
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    35503..35730
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    35764..35988
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    36013..36264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    36298..>36492
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    36547..36798
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    36820..37065
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    36832..37065
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    37081..37332
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    37105..37341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of semaphorin;
                     Region: Ig_Semaphorin_C; cd04979"
                     /db_xref="CDD:143180"
     misc_feature    order(37126..37128,37255..37257)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:143180"
     misc_feature    37408..37566
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    37636..37830
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    37882..38133
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    37897..38133
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    38146..38412
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    38164..38412
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    38428..38679
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    38446..38679
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    38695..38946
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    38713..38946
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    38962..>39171
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    39244..39483
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    39271..39483
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    39493..39759
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39493..39495,39688..39690,39736..39738)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(39739..39744,39748..39753)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    39796..40074
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(39796..39798,39994..39996,40039..40041)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40042..40047,40051..40056)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40099..40380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40099..40101,40297..40299,40342..40344)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40345..40350,40354..40359)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40441..40677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    40456..40677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    40687..40944
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40687..40689,40882..40884,40927..40929)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(40930..40935,40939..40944)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    40987..41256
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(40987..40989,41182..41184,41227..41229)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(41230..41235,41239..41244)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41323..41565
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    41344..41565
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    41575..41853
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(41575..41577,41770..41772,41815..41817)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(41818..41823,41827..41832)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    41872..42144
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(41872..41874,42070..42072,42115..42117)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42118..42123,42127..42132)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42196..42444
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42370..42372,42415..42417)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42418..42423,42427..42432)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42475..42744
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42475..42477,42670..42672,42715..42717)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(42718..42723,42727..42732)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    42775..43050
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(42775..42777,42973..42975,43018..43020)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43021..43026,43030..43035)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43099..43353
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43279..43281,43324..43326)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43327..43332,43336..43341)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43384..43653
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    43432..43653
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    43663..43923
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(43663..43665,43858..43860,43903..43905)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(43906..43911,43915..43920)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    43999..44241
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44161..44163,44206..44208)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44209..44214,44218..44223)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44284..44619
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    44320..44619
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    44629..44913
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44629..44631,44830..44832,44875..44877)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(44878..44883,44887..44892)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    44932..45210
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(44932..44934,45127..45129,45172..45174)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45175..45180,45184..45189)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45250..45510
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45427..45429,45472..45474)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(45475..45480,45484..45489)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    45586..45804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    45814..46083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(45814..45816,46006..46008,46051..46053)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46054..46059,46063..46068)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46108..46386
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46108..46110,46306..46308,46351..46353)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46354..46359,46363..46368)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    46468..46707
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    46717..46998
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(46717..46719,46918..46920,46963..46965)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(46966..46971,46975..46980)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47020..47307
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47020..47022,47233..47235,47278..47280)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47281..47286,47290..47295)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47338..47613
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47338..47340,47542..47544,47587..47589)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(47590..47595,47599..47604)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    47704..47949
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    47959..48237
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(47959..47961,48154..48156,48199..48201)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48202..48207,48211..48216)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48259..48555
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48259..48261,48472..48474,48517..48519)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(48520..48525,48529..48534)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    48601..48864
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    48874..49155
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(48874..48876,49072..49074,49117..49119)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49120..49125,49129..49134)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49174..49467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49174..49176,49384..49386,49429..49431)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49432..49437,49441..49446)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49486..49764
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(49486..49488,49684..49686,49729..49731)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(49732..49737,49741..49746)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    49846..50061
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    50071..50346
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50071..50073,50269..50271,50314..50316)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50317..50322,50326..50331)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50374..50655
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(50374..50376,50572..50574,50617..50619)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(50620..50625,50629..50634)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    50749..50937
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    50983..51240
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51157..51159,51202..51204)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51205..51210,51214..51219)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51259..51528
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51259..51261,51457..51459,51502..51504)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51505..51510,51514..51519)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51562..51828
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(51562..51564,51766..51768,51811..51813)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(51814..51819,51823..51828)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    51928..52143
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    52153..52416
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52153..52155,52348..52350,52393..52395)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52396..52401,52405..52410)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52453..52722
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(52453..52455,52645..52647,52690..52692)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(52693..52698,52702..52707)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    52783..53025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    52804..53025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    53035..53316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53035..53037,53233..53235,53278..53280)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53281..53286,53290..53295)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53335..53610
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53335..53337,53530..53532,53575..53577)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53578..53583,53587..53592)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53659..53910
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(53836..53838,53881..53883)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(53884..53889,53893..53898)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    53998..54219
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    54229..54501
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54229..54231,54421..54423,54466..54468)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54469..54474,54478..54483)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54526..54807
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(54526..54528,54724..54726,54769..54771)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(54772..54777,54781..54786)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    54826..55104
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    54877..55104
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    55114..55392
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55114..55116,55309..55311,55354..55356)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55357..55362,55366..55371)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55411..55692
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55411..55413,55609..55611,55654..55656)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55657..55662,55666..55671)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    55714..56010
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(55714..55716,55930..55932,55975..55977)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(55978..55983,55987..55992)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56092..56310
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    56320..56580
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56320..56322,56515..56517,56560..56562)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56563..56568,56572..56577)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56620..56898
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(56620..56622,56818..56820,56863..56865)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(56866..56871,56875..56880)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    56938..57189
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    56968..57189
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    57199..57465
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57199..57201,57397..57399,57442..57444)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(57445..57450,57454..57459)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    57499..57780
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57499..57501,57697..57699,57742..57744)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(57745..57750,57754..57759)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    57796..58080
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(57997..57999,58042..58044)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58045..58050,58054..58059)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58138..58380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    58159..58380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    58390..58668
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58390..58392,58585..58587,58630..58632)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58633..58638,58642..58647)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58687..58956
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58687..58689,58885..58887,58930..58932)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(58933..58938,58942..58947)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    58990..59256
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(58990..58992,59191..59193,59236..59238)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59239..59244,59248..59253)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59326..59574
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    59353..59574
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    59584..59859
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59584..59586,59779..59781,59824..59826)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(59827..59832,59836..59841)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    59875..60141
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(59875..59877,60064..60066,60109..60111)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60112..60117,60121..60126)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60220..60441
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    60451..60732
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60451..60453,60649..60651,60694..60696)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60697..60702,60706..60711)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    60793..61032
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(60949..60951,60994..60996)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(60997..61002,61006..61011)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61048..61326
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61243..61245,61288..61290)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61294..61299,61303..61308)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61426..61632
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    61642..61917
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61642..61644,61837..61839,61882..61884)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(61885..61890,61894..61899)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    61939..62211
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(61939..61941,62137..62139,62182..62184)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62185..62190,62194..62199)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62242..62505
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62242..62244,62443..62445,62488..62490)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(62491..62496,62500..62505)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    62575..62817
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    62602..62817
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    62827..63096
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(62827..62829,63022..63024,63067..63069)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63070..63075,63079..63084)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63118..63393
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63118..63120,63310..63312,63355..63357)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63358..63363,63367..63372)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    63469..63693
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    63700..63981
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(63700..63702,63898..63900,63943..63945)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(63946..63951,63955..63960)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64000..64272
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64000..64002,64198..64200,64243..64245)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64246..64251,64255..64260)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64297..64578
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64492..64494,64537..64539)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(64543..64548,64552..64557)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    64609..64878
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    64660..64878
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    64888..65163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(64888..64890,65086..65088,65131..65133)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65134..65139,65143..65148)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65209..65466
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65386..65388,65431..65433)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65434..65439,65443..65448)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65491..65754
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(65491..65493,65692..65694,65737..65739)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(65740..65745,65749..65754)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    65827..66069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    65854..66069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    66079..66348
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66079..66081,66274..66276,66319..66321)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66322..66327,66331..66336)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66370..66621
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66370..66372,66562..66564,66607..66609)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(66610..66615,66619..66621)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    66667..66936
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    66715..66936
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    66946..67227
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(66946..66948,67144..67146,67189..67191)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67192..67197,67201..67206)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67282..67527
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67444..67446,67489..67491)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67492..67497,67501..67506)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67543..67824
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(67738..67740,67783..67785)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(67786..67788,67792..67794,67798..67803)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    67882..68124
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    67903..68124
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    68134..68415
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68134..68136,68332..68334,68377..68379)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68380..68385,68389..68394)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68434..68703
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68434..68436,68632..68634,68677..68679)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68680..68685,68689..68694)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    68737..69003
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(68737..68739,68938..68940,68983..68985)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(68986..68991,68995..69000)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69100..69315
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    69325..69600
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69325..69327,69520..69522,69565..69567)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69568..69573,69577..69582)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69616..69867
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(69616..69618,69808..69810,69853..69855)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(69856..69861,69865..69867)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    69946..70173
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    69961..70176
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    70192..70473
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70192..70194,70390..70392,70435..70437)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70438..70443,70447..70452)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70492..70773
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70492..70494,70690..70692,70735..70737)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(70738..70743,70747..70752)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    70789..71070
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(70984..70986,71029..71031)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71035..71040,71044..71049)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71110..71370
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    71149..71370
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    71380..71655
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71380..71382,71578..71580,71623..71625)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71626..71631,71635..71640)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71680..71958
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71680..71682,71878..71880,71923..71925)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(71926..71931,71935..71940)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    71983..72249
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(71983..71985,72184..72186,72229..72231)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72232..72237,72241..72246)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72319..72561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    72352..72561
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    72571..72846
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72571..72573,72766..72768,72811..72813)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(72814..72819,72823..72828)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    72862..73113
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(72862..72864,73054..73056,73099..73101)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73102..73107,73111..73113)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73192..73428
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    73207..73428
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    73438..73719
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(73438..73440,73636..73638,73681..73683)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73684..73689,73693..73698)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    73738..74013
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(73738..73740,73936..73938,73981..73983)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(73984..73989,73993..73998)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    74035..74316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(74230..74232,74275..74277)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(74278..74280,74284..74286,74290..74295)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    74395..74619
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    74629..74910
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(74629..74631,74827..74829,74872..74874)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(74875..74880,74884..74889)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    74929..75207
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(74929..74931,75127..75129,75172..75174)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(75175..75180,75184..75189)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    75232..75498
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(75232..75234,75433..75435,75478..75480)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(75481..75486,75490..75495)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    75568..75810
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    75595..75810
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    75820..76089
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(75820..75822,76015..76017,76060..76062)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(76063..76068,76072..76077)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    76111..76362
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(76111..76113,76303..76305,76348..76350)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(76351..76356,76360..76362)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    76408..76677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    76456..76677
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    76687..76932
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(76687..76689,76882..76884,76927..76929)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    77005..77256
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(77182..77184,77227..77229)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(77230..77235,77239..77244)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    77281..77550
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(77476..77478,77524..77526)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(77527..77532,77536..77541)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    77641..77862
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    77872..78153
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(77872..77874,78070..78072,78115..78117)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(78118..78123,78127..78132)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    78172..78450
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(78172..78174,78370..78372,78415..78417)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(78418..78423,78427..78432)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    78475..78750
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(78475..78477,78670..78672,78715..78717)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(78718..78723,78727..78732)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    78805..79047
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    78832..79047
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    79057..79332
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(79057..79059,79252..79254,79297..79299)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(79300..79305,79309..79314)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    79348..79599
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(79348..79350,79540..79542,79585..79587)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(79588..79593,79597..79599)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    79669..79923
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    79702..79923
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    79933..80214
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(79933..79935,80131..80133,80176..80178)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(80179..80184,80188..80193)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    80233..80505
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(80233..80235,80431..80433,80476..80478)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(80479..80484,80488..80493)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    80530..80811
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(80725..80727,80770..80772)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(80776..80781,80785..80790)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    80833..81111
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    80890..81111
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    81121..81402
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(81121..81123,81319..81321,81364..81366)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(81367..81372,81376..81381)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    81421..81699
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(81421..81423,81619..81621,81664..81666)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(81667..81672,81676..81681)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    81745..81990
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(81925..81927,81970..81972)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(81973..81978,81982..81987)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    82060..82311
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    82087..82311
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    82321..82590
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(82321..82323,82516..82518,82561..82563)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(82564..82569,82573..82578)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    82612..82887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(82612..82614,82804..82806,82849..82851)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(82852..82857,82861..82866)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    82963..83145
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    83194..83475
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(83194..83196,83392..83394,83437..83439)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(83440..83445,83449..83454)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    83494..83772
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(83494..83496,83692..83694,83737..83739)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(83740..83745,83749..83754)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    83791..84066
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(83983..83985,84028..84030)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(84031..84033,84037..84039,84043..84048)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    84148..84369
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    84400..84660
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(84577..84579,84622..84624)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(84625..84630,84634..84639)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    84679..84942
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(84679..84681,84880..84882,84925..84927)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(84928..84933,84937..84942)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    84985..85254
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(84985..84987,85183..85185,85228..85230)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(85231..85236,85240..85245)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    85345..85560
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    85570..85824
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(85570..85572,85765..85767,85810..85812)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(85813..85818,85822..85824)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    85861..86127
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(85861..85863,86053..86055,86098..86100)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(86101..86106,86110..86115)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    86215..86436
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    86446..86727
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(86446..86448,86644..86646,86689..86691)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(86692..86697,86701..86706)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    86746..87024
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(86746..86748,86944..86946,86989..86991)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(86992..86997,87001..87006)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    87043..87333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(87247..87249,87292..87294)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(87295..87297,87301..87303,87307..87312)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    87415..87636
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    87646..87924
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(87646..87648,87841..87843,87886..87888)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(87889..87894,87898..87903)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    87943..88227
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(87943..87945,88144..88146,88189..88191)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(88192..88197,88201..88206)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    88249..88521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(88249..88251,88450..88452,88495..88497)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(88498..88503,88507..88512)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    88585..88827
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    88612..88827
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    88837..89112
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(88837..88839,89032..89034,89077..89079)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(89080..89085,89089..89094)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    89128..89409
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(89128..89130,89326..89328,89371..89373)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(89374..89379,89383..89388)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    89461..89709
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    89488..89709
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    89719..89994
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(89719..89721,89917..89919,89962..89964)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(89965..89970,89974..89979)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    90019..90288
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(90019..90021,90217..90219,90262..90264)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(90265..90270,90274..90279)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    90322..90558
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(90322..90324,90520..90522)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    90682..90897
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    90907..91179
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(90907..90909,91105..91107,91150..91152)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(91153..91158,91162..91167)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    91243..91494
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(91411..91413,91456..91458)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(91459..91464,91468..91473)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    91516..91773
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(91516..91518,91714..91716,91759..91761)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(91762..91767,91771..91773)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    91822..92085
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    91873..92076
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    92158..92376
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    92392..92673
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(92392..92394,92593..92595,92638..92640)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(92641..92646,92650..92655)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    92698..92979
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(92698..92700,92896..92898,92941..92943)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(92944..92949,92953..92958)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    93007..93282
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    93058..93273
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    93355..93579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin (Ig)-like domain of titin and
                     similar proteins; Region: Ig_Titin_like; cd05748"
                     /db_xref="CDD:143225"
     misc_feature    93589..93861
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Fibronectin type 3 domain; One of three types of
                     internal repeats found in the plasma protein fibronectin.
                     Its tenth fibronectin type III repeat contains an RGD cell
                     recognition sequence in a flexible loop between 2 strands.
                     Approximately 2% of all...; Region: FN3; cd00063"
                     /db_xref="CDD:28945"
     misc_feature    order(93589..93591,93781..93783,93826..93828)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Interdomain contacts; other site"
                     /db_xref="CDD:28945"
     misc_feature    order(93829..93834,93838..93843)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Cytokine receptor motif; other site"
                     /db_xref="CDD:28945"
     misc_feature    93976..94740
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Serine/Threonine protein kinases, catalytic domain;
                     Region: S_TKc; smart00220"
                     /db_xref="CDD:197582"
     misc_feature    93994..94734
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Catalytic domain of Protein Kinases; Region: PKc;
                     cd00180"
                     /db_xref="CDD:173623"
     misc_feature    order(93994..94008,94018..94020,94057..94059,94063..94065,
                     94147..94149,94195..94206,94216..94218,94222..94224,
                     94336..94338,94342..94344,94348..94353,94357..94359,
                     94396..94398,94405..94407,94450..94461)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="active site"
                     /db_xref="CDD:173623"
     misc_feature    order(93994..94008,94018..94020,94057..94059,94063..94065,
                     94147..94149,94195..94206,94216..94218,94336..94338,
                     94342..94344,94348..94353,94357..94359,94396..94398)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173623"
     misc_feature    order(94006..94008,94216..94218,94222..94224,94336..94338,
                     94342..94344,94348..94350,94405..94407,94450..94461)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173623"
     misc_feature    order(94393..94413,94450..94461)
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173623"
     misc_feature    94978..95190
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    95293..95571
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    95317..95571
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    95608..95880
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    95644..95880
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    97345..97614
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    97366..97614
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    97897..98172
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="M5, fifth immunoglobulin (Ig)-like domain of human
                     titin C terminus and similar proteins; Region:
                     Ig5_Titin_like; cd05747"
                     /db_xref="CDD:143224"
     misc_feature    97909..98175
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    98377..98631
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    98422..98640
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cd00096"
                     /db_xref="CDD:143165"
     misc_feature    98779..99048
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    98800..99048
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    99358..99600
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin; Region: IG; smart00409"
                     /db_xref="CDD:197707"
     misc_feature    99625..99894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    99643..99894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin like; Region: IG_like; smart00410"
                     /db_xref="CDD:197708"
     misc_feature    100210..100485
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin I-set domain; Region: I-set;
                     pfam07679"
                     /db_xref="CDD:191810"
     misc_feature    100279..100485
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     exon            317..520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       381
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647842"
     exon            521..808
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       767
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647843"
     exon            809..894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       889
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647844"
     exon            895..1139
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1140..1470
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1195
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647845"
     variation       1228
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647846"
     exon            1471..1623
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1624..1761
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       1672
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:34337578"
     variation       1717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647851"
     exon            1762..1887
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            1888..2025
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2026..2163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2164..2301
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2298
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72647860"
     exon            2302..2595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            2596..2718
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2657
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:35813871"
     exon            2719..3000
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       2836
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72647861"
     variation       2989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647862"
     exon            3001..3066
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            3067..3325
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3083
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647865"
     exon            3326..3389
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647867"
     variation       3358
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647868"
     exon            3390..3605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             3537..3680
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1574E"
                     /db_xref="UniSTS:150658"
     exon            3606..3748
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3634
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647870"
     exon            3749..3954
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            3955..4188
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       3984
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2291308"
     variation       4109
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1552280"
     exon            4189..4433
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4209
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72647872"
     exon            4434..4705
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       4471
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647875"
     variation       4547
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72647876"
     exon            4706..4870
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             4760..4866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="A008T22"
                     /db_xref="UniSTS:24210"
     variation       4855
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647877"
     exon            4871..5039
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            5040..6733
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       5613
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647878"
     STS             6331..6459
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1524E"
                     /db_xref="UniSTS:45880"
     variation       6473
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="g"
                     /db_xref="dbSNP:72647879"
     exon            6734..7015
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       6885
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647880"
     variation       6998
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647881"
     exon            7016..7282
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7283..7555
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7556..7819
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            7820..8080
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8081..8341
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8342..8605
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            8606..8866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8814
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647883"
     exon            8867..9127
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       8912
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72647884"
     exon            9128..9388
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9163
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647885"
     variation       9375
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647886"
     exon            9389..9530
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9531..9696
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       9584
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72647894"
     exon            9697..9928
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            9929..10213
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10214..10339
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10340..10528
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10529..10585
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10586..10864
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            10865..11428
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       11018
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2742347"
     variation       11103
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742348"
     variation       11191
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648923"
     variation       11313
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648924"
     variation       11363
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648925"
     STS             11422..11663
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1518E"
                     /db_xref="UniSTS:150612"
     exon            11429..11710
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       11477
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648927"
     variation       11508
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648928"
     variation       11671
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648929"
     exon            11711..11989
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            11990..12268
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       12056
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648930"
     variation       12077
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648931"
     variation       12210
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648932"
     exon            12269..12547
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       12282
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648933"
     variation       12343
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:66839174"
     variation       12400
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648934"
     exon            12548..12835
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       12588
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648935"
     variation       12619
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648936"
     variation       12796
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648937"
     exon            12836..13114
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       12940
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648938"
     variation       13022
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648939"
     variation       13039
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648940"
     exon            13115..13396
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            13397..13675
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       13541
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648942"
     exon            13676..13954
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       13717
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648943"
     exon            13955..14233
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            14234..14521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       14299
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648945"
     variation       14482
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648946"
     exon            14522..14800
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             14525..14665
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH44253"
                     /db_xref="UniSTS:31799"
     exon            14801..15082
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15043
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648947"
     exon            15083..15361
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648948"
     variation       15269
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648949"
     exon            15362..15640
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15396
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648950"
     variation       15497
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648951"
     exon            15641..15919
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       15643
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648953"
     variation       15697
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648954"
     exon            15920..16207
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16191
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648956"
     exon            16208..16486
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            16487..16768
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16591
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648957"
     exon            16769..17047
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       16834
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648958"
     exon            17048..17329
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17299..17300
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2742325"
     exon            17330..17608
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17537
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648960"
     variation       17538
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648961"
     variation       17599
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648962"
     exon            17609..17896
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       17666
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648964"
     exon            17897..18175
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            18176..18454
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            18455..18733
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       18509
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648966"
     exon            18734..19021
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            19022..19309
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19127
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648969"
     variation       19279
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648970"
     exon            19310..19591
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            19592..19870
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       19614
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648971"
     variation       19716
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2562831"
     variation       19725
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648972"
     variation       19795
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648973"
     exon            19871..20152
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            20153..20431
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            20432..20719
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20644
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368226720"
     variation       20653
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648976"
     exon            20720..20998
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       20838
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648977"
     exon            20999..21277
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21009
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648978"
     variation       21072
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648979"
     variation       21145
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648980"
     exon            21278..21556
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21313
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648981"
     variation       21373
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648982"
     variation       21402
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648983"
     variation       21466
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648984"
     exon            21557..21844
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21557
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:2627043"
     exon            21845..22132
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       21891
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648986"
     variation       22119
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2562832"
     exon            22133..22414
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22200
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742329"
     exon            22415..22693
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22429
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648987"
     variation       22584
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2562836"
     exon            22694..22975
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22782
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2562838"
     exon            22976..23254
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       22987
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648989"
     variation       23021
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648990"
     variation       23148
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2562839"
     variation       23149
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648991"
     exon            23255..23542
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       23323
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648993"
     variation       23356
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648994"
     exon            23543..23821
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            23822..24100
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24085
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648995"
     exon            24101..24379
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             24103..24208
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1591E"
                     /db_xref="UniSTS:150675"
     variation       24317
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648996"
     exon            24380..24667
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             24462..24577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="SHGC-62013"
                     /db_xref="UniSTS:27408"
     variation       24507
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:200655768"
     variation       24552
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:201024042"
     variation       24624
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648997"
     exon            24668..24955
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       24806
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648998"
     exon            24956..25246
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25155
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2742332"
     variation       25224
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72649000"
     exon            25247..25534
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25314..25315
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2627035"
     variation       25314
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2742338"
     exon            25535..25627
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25621
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72649002"
     exon            25628..25913
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       25671
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72650003"
     exon            25914..26097
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26098..26187
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26188..26455
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       26256
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2742343"
     variation       26292
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2742344"
     variation       26305
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72650006"
     variation       26429
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650007"
     exon            26456..26716
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            26717..26926
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       26767
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650011"
     exon            26927..27004
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27005..27031
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27032..27091
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27092..27175
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27176..27247
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27248..27295
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27296..27700
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27701..27763
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27764..27841
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            27842..27919
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       27892
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650019"
     variation       27915
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650020"
     exon            27920..28006
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28007..28087
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28057
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2042995"
     exon            28088..28171
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28172..28255
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28256..28339
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28340..28420
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28357
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2244492"
     exon            28421..28504
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28505..28588
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28589..28690
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28691..28804
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28747
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650028"
     exon            28805..28885
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28843
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72650029"
     STS             28867..28992
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65366"
                     /db_xref="UniSTS:73247"
     exon            28886..28963
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            28964..29047
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       28973
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650030"
     exon            29048..29131
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29117
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650031"
     exon            29132..29215
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29216..29299
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29236
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72650032"
     exon            29300..29380
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29381..29587
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29546
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650034"
     variation       29552
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650035"
     exon            29588..29665
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29619
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650036"
     exon            29666..29740
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29741..29833
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            29834..29911
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       29909
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72650040"
     exon            29912..30073
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30074..30157
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30158..30235
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30236..30319
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30320..30403
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30404..30487
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30488..30784
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30785..30859
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30860..30934
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            30935..31030
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31031..31108
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       31094
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650052"
     exon            31109..31177
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31178..31252
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31253..31549
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31550..31630
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31631..31708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31709..31798
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31799..31882
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31883..31966
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            31967..32050
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32051..32134
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32075
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650061"
     exon            32135..32218
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32173
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72650062"
     exon            32219..32302
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32303..32386
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32387..32470
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32389
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72650064"
     exon            32471..32548
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32549..32632
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       32627
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72650066"
     exon            32633..32740
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32741..32818
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32819..32929
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32930..32998
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            32999..33079
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33080..33154
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33155..33244
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33245..33307
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33308..33397
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33398..33448
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            33449..33850
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33624
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650077"
     variation       33625
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650078"
     exon            33851..34129
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       33933
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650079"
     exon            34130..34405
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34406..34545
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34546..34672
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            34673..34936
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       34825
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650080"
     exon            34937..35203
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       35068
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72650081"
     exon            35204..35467
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            35468..35607
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             35469..35577
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1881"
                     /db_xref="UniSTS:153573"
     exon            35608..35734
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       35705
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650084"
     exon            35735..36001
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            36002..36268
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            36269..36535
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       36439
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72650088"
     exon            36536..36675
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            36676..36802
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            36803..36945
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       36871
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677216"
     exon            36946..37069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            37070..37336
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            37337..37434
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            37435..37603
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37574
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677221"
     exon            37604..37870
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37794
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677223"
     exon            37871..38137
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       37929
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677225"
     exon            38138..38416
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38259
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303829"
     variation       38281
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677226"
     exon            38417..38825
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38688
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72677227"
     exon            38826..38950
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            38951..39217
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       38972
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72677229"
     exon            39218..39487
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            39488..39790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39712
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677231"
     variation       39769
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677232"
     exon            39791..40093
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       39836
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677233"
     exon            40094..40281
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40244
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677237"
     exon            40282..40396
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            40397..40681
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            40682..40833
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40685
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677238"
     exon            40834..40981
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       40915
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303830"
     exon            40982..41159
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41145
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677240"
     exon            41160..41281
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41248
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677242"
     exon            41282..41569
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41474
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677243"
     variation       41517
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72677244"
     exon            41570..41866
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            41867..42053
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       41927
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72677245"
     exon            42054..42169
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            42170..42469
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42252
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2115558"
     variation       42279
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677247"
     exon            42470..42769
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            42770..42875
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            42876..43072
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       42879
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72677249"
     exon            43073..43378
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43333
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72677250"
     exon            43379..43657
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43630
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78462639"
     exon            43658..43957
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       43778
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632860"
     exon            43958..44260
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       44205
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288566"
     exon            44261..44623
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       44406
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72632861"
     exon            44624..44926
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            44927..45226
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            45227..45523
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       45342
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303831"
     exon            45524..45808
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       45617
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646808"
     variation       45644
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:2303832"
     variation       45713
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646809"
     exon            45809..46102
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            46103..46402
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            46403..46711
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       46521
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646813"
     variation       46710
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303834"
     exon            46712..46902
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            46903..47332
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            47333..47641
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            47642..47790
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       47660
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646819"
     exon            47791..47823
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            47824..47953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       47938
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646822"
     exon            47954..48253
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       48074
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646823"
     exon            48254..48571
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            48572..48868
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       48622
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:1001238"
     STS             48769..48874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1532E"
                     /db_xref="UniSTS:150620"
     exon            48869..49168
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       49050
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646827"
     exon            49169..49483
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             49273..49411
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65766"
                     /db_xref="UniSTS:17479"
     variation       49327
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646828"
     STS             49418..49516
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1570E"
                     /db_xref="UniSTS:150654"
     exon            49484..49632
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            49633..49783
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            49784..50065
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       49852
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646831"
     variation       49983
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646832"
     variation       49985
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646833"
     exon            50066..50368
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            50369..50671
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            50672..50953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       50791
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646837"
     exon            50954..51253
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       50957
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2288569"
     variation       51071
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646838"
     exon            51254..51556
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       51454
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2303836"
     exon            51557..51865
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       51634
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646839"
     variation       51836
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646840"
     exon            51866..52147
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            52148..52447
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       52356
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646842"
     exon            52448..52741
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       52709
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1560220"
     exon            52742..55708
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       53011
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646843"
     variation       53339
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646844"
     variation       53342
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646845"
     variation       53766
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2163009"
     variation       54397
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646846"
     variation       54579
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1560221"
     variation       54699
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646847"
     variation       54906
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646848"
     variation       54953
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646849"
     variation       55544
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646850"
     variation       55547
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646851"
     variation       55686
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646852"
     exon            55709..56029
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       55960
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646853"
     exon            56030..56314
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       56048
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646854"
     variation       56110
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646855"
     exon            56315..56614
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       56553
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646857"
     exon            56615..56917
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       56695
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646859"
     variation       56729
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2042996"
     exon            56918..57193
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            57194..57493
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       57208
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646860"
     exon            57494..57796
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       57613
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646861"
     exon            57797..58096
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            58097..58384
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       58150
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646866"
     variation       58296
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646867"
     exon            58385..58681
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       58607
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646868"
     exon            58682..58984
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            58985..59290
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       59135
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646869"
     variation       59194
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646870"
     exon            59291..59578
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       59413
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646871"
     variation       59560
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303837"
     exon            59579..59869
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       59596
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2303838"
     variation       59620
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646873"
     STS             59808..60208
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_23497-23498:1027358865:1"
                     /db_xref="UniSTS:268713"
     exon            59870..60157
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       60063
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646876"
     variation       60156
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288570"
     exon            60158..60745
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       60480
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646877"
     exon            60746..60850
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            60851..61048
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       60979
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646880"
     exon            61049..61345
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            61346..61933
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61666
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646881"
     variation       61904
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72646882"
     exon            61934..62236
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       61946
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2288572"
     variation       62106
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:67041405"
     variation       62171
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646884"
     variation       62197
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646885"
     exon            62237..79342
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       62781
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646887"
     variation       63001
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646888"
     variation       63172
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646889"
     variation       63198
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646890"
     variation       63353
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646891"
     variation       63385
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646892"
     variation       64461
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646893"
     variation       64554
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646894"
     STS             64730..64855
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1571E"
                     /db_xref="UniSTS:150655"
     variation       65548
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646895"
     variation       65741
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646896"
     variation       66067
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646897"
     variation       67123
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646898"
     variation       67360
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744426"
     variation       67412
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72646899"
     variation       67493
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744427"
     variation       67558
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:744428"
     variation       67595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731743"
     variation       68141
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72646900"
     variation       68158
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72646901"
     STS             68264..68465
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1580E"
                     /db_xref="UniSTS:150664"
     STS             68587..68687
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1593E"
                     /db_xref="UniSTS:150677"
     variation       68864
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813243"
     variation       68934
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72646902"
     variation       69220
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3813244"
     variation       69241
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3813245"
     STS             69426..69766
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="TTN-1"
                     /db_xref="UniSTS:254009"
     variation       69800
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813246"
     variation       70434
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648203"
     variation       70584
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648204"
     variation       71267
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1010407"
     variation       71413
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648205"
     variation       71747
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648206"
     variation       71786
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731745"
     variation       72147
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648207"
     variation       72383
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731746"
     variation       72462
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648208"
     variation       72465
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648209"
     variation       72994
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648210"
     variation       73320
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:3813247"
     variation       73543
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648211"
     variation       73626
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648212"
     STS             74287..74413
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1550E"
                     /db_xref="UniSTS:150635"
     variation       75006
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648213"
     variation       75208
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648214"
     variation       75275
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648215"
     variation       75318
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648216"
     variation       75637
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648217"
     variation       75734
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648218"
     variation       75844
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829746"
     variation       76724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648219"
     variation       76874
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648220"
     variation       77161
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648221"
     variation       77340
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648222"
     variation       77724
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648223"
     STS             77920..78135
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1560E"
                     /db_xref="UniSTS:150645"
     STS             78464..78642
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH48674"
                     /db_xref="UniSTS:32026"
     variation       78490
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648224"
     variation       78523
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648225"
     STS             78563..78674
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1572E"
                     /db_xref="UniSTS:150656"
     variation       79047
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648226"
     exon            79343..79639
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             79387..79468
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1553E"
                     /db_xref="UniSTS:150638"
     exon            79640..80227
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       79933
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648227"
     variation       80132
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648228"
     variation       80190
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648229"
     exon            80228..80530
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       80292
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648230"
     variation       80428
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648231"
     STS             80458..80595
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="MARC_21540-21541:1033053987:1"
                     /db_xref="UniSTS:268573"
     exon            80531..80827
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            80828..81115
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       81017
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648234"
     exon            81116..81415
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       81206
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648235"
     variation       81289
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648236"
     exon            81416..81718
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            81719..82024
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             81758..81871
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1519E"
                     /db_xref="UniSTS:22697"
     variation       81907
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648237"
     variation       81947
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648238"
     exon            82025..83791
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       82229
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648240"
     variation       82428
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648241"
     variation       82962
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648242"
     STS             83310..83452
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65575"
                     /db_xref="UniSTS:58532"
     variation       83594
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648243"
     exon            83792..84085
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            84086..84373
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       84094
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648244"
     exon            84374..84673
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             84428..84566
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH98821"
                     /db_xref="UniSTS:85869"
     variation       84458
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648245"
     variation       84520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648246"
     exon            84674..86740
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       84697
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648247"
     variation       85382
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648248"
     variation       85397
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648249"
     STS             85632..85723
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1540E"
                     /db_xref="UniSTS:150626"
     variation       85687
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648250"
     variation       85764
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731748"
     variation       86045
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648251"
     variation       86114
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648252"
     STS             86163..86264
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1546E"
                     /db_xref="UniSTS:150631"
     exon            86741..87043
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            87044..87349
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       87219
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72648253"
     exon            87350..87640
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       87363
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370821616"
     variation       87364
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648254"
     variation       87367
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648255"
     variation       87372
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648256"
     variation       87568
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648257"
     exon            87641..87937
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       87710..87711
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857280"
     variation       87780
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648258"
     variation       87791
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648259"
     exon            87938..88243
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       88069
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857267"
     variation       88074
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648260"
     variation       88087
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72648261"
     variation       88168
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648262"
     variation       88174
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648263"
     variation       88210..88211
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2857270"
     exon            88244..88549
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       88487
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace=""
                     /replace="a"
                     /db_xref="dbSNP:72648265"
     exon            88550..88831
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            88832..89425
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       88930
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857279"
     variation       89396
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:200676850"
     exon            89426..89713
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       89439
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648266"
     exon            89714..90013
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       89815
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648267"
     exon            90014..90316
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       90134
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3731749"
     exon            90317..90619
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            90620..91204
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       90639
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648269"
     variation       90685
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72648270"
     variation       90693
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648271"
     variation       90763
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648272"
     variation       90815
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:72648273"
     variation       90888
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648274"
     exon            91205..91510
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            91511..91810
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       91676
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648276"
     exon            91811..92386
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            92387..92692
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       92422
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648278"
     variation       92476
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72648279"
     exon            92693..93286
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       92765
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648282"
     variation       92894
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72648283"
     variation       92927
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857264"
     variation       92980
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629779"
     exon            93287..98895
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       93623
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:962659"
     variation       93960
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629781"
     variation       94229
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629782"
     variation       95040
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857265"
     variation       95354
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:3731752"
     variation       95398
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629783"
     variation       95495
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857266"
     variation       95574
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3731753"
     variation       95753
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:72629784"
     variation       95884
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629785"
     variation       96302
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3829747"
     variation       96479
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629786"
     variation       96694
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2857268"
     variation       96898
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:72629787"
     STS             96977..97101
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="RH65621"
                     /db_xref="UniSTS:70042"
     variation       97097
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:68080670"
     variation       97112
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629788"
     STS             97508..97716
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1568E"
                     /db_xref="UniSTS:150652"
     variation       97509
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829748"
     variation       97611
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629789"
     variation       97714
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2857269"
     variation       97733
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:3813249"
     variation       97905
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3813250"
     variation       98103
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:3829749"
     variation       98308
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:67254537"
     variation       98342
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2857271"
     exon            98896..99052
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            99053..99744
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     STS             99257..99435
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S1564E"
                     /db_xref="UniSTS:150649"
     exon            99745..99898
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     exon            99899..100201
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       100097
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629793"
     exon            100202..101520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /inference="alignment:Splign:1.39.8"
     variation       100540
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:72629794"
     variation       100556
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629795"
     STS             101115..101229
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /standard_name="D2S2648"
                     /db_xref="UniSTS:75793"
     variation       101161
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:72629796"
     variation       101239
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629797"
     polyA_signal    101493..101498
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
     variation       101512
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:72629798"
     polyA_site      101520
                     /gene="TTN"
                     /gene_synonym="CMD1G; CMH9; CMPD4; EOMFC; HMERF; LGMD2J;
                     MYLK5; TMD"
ORIGIN      
gagcagtcgtgcattcccagcctcgcctcgggtgtagggattgcatagaaaagcaaaactacacagtcttgactgtgtagttttgtttttaggattagaggctcaccgattcatgtcggagatggtcagaaaaaccaactctccataggacgtcgtttcagaagcaaccttgggcttagtcccaccctttttaggcactcttgagaaatcagagtgcctagaaagatgacaactcaagcaccgacgtttacgcagccgttacaaagcgttgtggtactggagggtagtaccgcaacctttgaggctcacattagtggttttccagttcctgaggtgagctggtttagggatggccaggtgatttccacttccactctgcccggcgtgcagatctcctttagcgatggccgcgctaaactgacgatccccgccgtgactaaagccaacagtggacgatattccctgaaagccaccaatggatctggacaagcgactagtactgctgagcttctcgtgaaagctgagacagcaccacccaacttcgttcaacgactgcagagcatgaccgtgagacaaggaagccaagtgagactccaagtgagagtgactggaatccctacacctgtggtgaagttctaccgggatggagccgaaatccagagctcccttgatttccaaatttcacaagaaggcgacctctacagcttactgattgcagaagcataccctgaggactcagggacctattcagtaaatgccaccaatagcgttggaagagctacttcgactgctgaattactggttcaaggtgaagaagaagtacctgctaaaaagacaaagacaattgtttcgactgctcagatctcagaatcaagacaaacccgaattgaaaagaagattgaagcccactttgatgccagatcaattgcaacagttgagatggtcatagatggtgccgctgggcaacagctgccacataaaacacctcccaggattcctccgaagccaaagtcaagatccccaacaccaccgtctattgctgccaaagcacagctggctcggcagcagtccccatcgcccataagacactccccttccccggtcagacacgtgcgggcaccgaccccatctccggtcaggtccgtgtctccagcagcaagaatctccacatcccccatcaggtctgttaggtctccattgctcatgcgtaagactcaggcatccaccgtggccacaggtcctgaagtgcctcccccttggaagcaagagggctacgtggcctcctcatctgaggctgagatgagagagacaacgctgacaacctctactcagatcaggacagaagagagatgggaagggagatacggtgtccaggagcaagtgaccatcagtggtgctgcgggtgctgccgccagtgtgtcggccagtgctagctacgcagcagaggctgttgccactggtgctaaagaggtgaaacaagatgctgacaaaagtgcagctgttgcgactgttgttgctgccgttgatatggccagagtgagagaaccagtgatcagcgctgtagagcagactgctcagaggacaaccacgactgctgtgcacatccaacctgctcaagaacaggtaagaaaggaagcggagaagactgctgtaactaaggtagtagtggccgccgataaagccaaggaacaagaattaaaatcaagaaccaaagaagtaattaccacaaagcaagagcagatgcacgtaactcatgagcagataagaaaagaaactgaaaaaacatttgtaccaaaggtagtaatttccgcagctaaagccaaagaacaagaaactagaatttctgaagaaattactaagaaacagaaacaagtaactcaagaagcaataagacaggaaactgagataactgctgcatccatggtggtagttgccactgcaaagtccacaaaactagaaacagtcccgggagctcaagaagaaactaccacacaacaagatcaaatgcacctaagttatgaaaagataatgaaggaaactaggaaaacagttgtacctaaagtcatagttgccacacccaaagtcaaagaacaagatttagtatcaagaggtagagaaggcattactaccaaaagagaacaagtgcaaataactcaggagaagatgagaaaggaagccgagaaaactgccttgtctacaatagcagttgctactgctaaagccaaagaacaagaaacaatactgagaactagagaaactatggctactagacaagaacaaatccaagttacccatggaaaggtggacgttggaaaaaaggctgaagctgtagcaacagttgttgctgcagtagaccaggcccgagtcagagagcccagagagcctgggcatcttgaagaatcctatgctcagcagaccactttggagtacggatataaggaacgcatttccgccgcaaaggtagctgagcctccccaacgtccagcctcagaaccccacgttgtccctaaagcagtcaagcctagagtaatccaggctccttctgagactcatatcaaaactactgatcaaaagggaatgcacatatcatcacagatcaagaaaactacagatctaacaacggaaagattagtccatgtggataaacgcccccgcacagctagccctcactttactgtttcaaaaatttctgttcctaagacagaacatggatatgaggcatcaatagccggtagtgctattgccacattacaaaaagagttgtcagccacatcttctgctcagaagatcaccaaatcggtgaaggctcctactgtgaagcccagtgagactagagtaagggcagagcccacacccttgccacagttccccttcgctgacacaccagatacttacaagagtgaagctggcgttgaggtgaaaaaggaagtaggggtgagcatcactggcaccaccgtccgtgaagagcgctttgaagtactgcacggacgcgaagccaaggtaacagaaacagcaagagtaccagcacctgttgaaattcctgttactccaccaactttggtctcgggcttaaaaaatgtgactgtcatagaaggtgaatctgtcaccttggagtgccacatctctggatacccatccccgacagtgacatggtacagggaagactaccaaatcgaaagttccattgacttccagataaccttccagagtggaattgctcgtcttatgattcgcgaagcatttgcggaagacagcgggcgatttacttgcagtgctgtaaatgaggctggaaccgtcagcacatcctgctatctggctgtgcaggtgtcagaagaatttgaaaaggaaaccacagccgtgactgagaaatttactacagaagagaaacgctttgttgagtcaagagatgtggttatgactgatactagcctcacagaggaacaagcagggcctggagaacctgccgcgccttactttattacaaaaccagtggtccagaaactggtggaaggtgggagcgtggtgtttggatgccaagttggcggcaacccaaagccccatgtatactggaaaaaatctggtgttcctctaaccactggatacagatacaaagtgagttacaacaaacaaaccggtgaatgcaagctggtgatttctatgacttttgctgatgatgctggagaatacactattgttgttcgcaataagcatggagaaacttctgcatctgcttccttgcttgaagaagctgattatgagttactgatgaagtcccagcaagaaatgctttatcagacacaagtgactgcatttgttcaagaacctaaagttggagaaacagcacctggatttgtatactctgagtatgaaaaagagtatgaaaaagaacaagccttaattaggaagaaaatggccaaagatactgtagtggtcagaacttatgtagaagatcaggaattccatatttcttcctttgaagagagacttattaaagaaattgaatatagaataataaagactacattagaagaacttcttgaagaagatggagaagaaaagatggcagttgacatttctgaatctgaagctgttgaatcaggatttgattcaagaatcaagaattatagaattcttgaggggatgggtgtcacttttcattgcaagatgtctggatatccattaccaaagattgcttggtacaaagatggcaagcgcatcaaacatggagaaagataccaaatggactttctacaagatggcagagctagtctgcgtatacctgttgttcttccagaagatgaaggaatctacactgcatttgccagcaatattaaaggaaatgcaatttgctcagggaaattgtatgtggagcctgctgcaccacttggagctccgacttacattcccacactagagccagtgagcagaatcagatctctctctccacgttcagtgagcaggtctcctatacgcatgtctcctgcacggatgtcacctgcaaggatgtctcctgcacggatgtcccctgcaagaatgtcccctggacgtaggctggaggagacagatgagtcacaacttgagagactatataaaccagtctttgtgttaaaacctgtttctttcaaatgtttagaagggcaaactgccagatttgacttaaaggttgttggtagacctatgccagagacgttctggtttcatgatggccagcaaattgtcaatgactatacccataaagtagtcattaaagaagatggtactcaatcactaattattgtccctgccacacccagtgattctggggaatggactgtggttgcccaaaacagggcaggcagatcttcaatttcagtgattttaactgtggaagctgtggaacatcaggtaaaaccgatgtttgtagaaaaactgaaaaatgtcaatataaaggaaggttcccgacttgaaatgaaagtcagagctacgggtaaccccaaccctgacattgtatggttgaaaaacagtgacatcattgtgcctcataaatatcccaaaatcagaattgaaggaaccaagggagaagctgcccttaaaatcgattccactgtcagccaagattctgcctggtatactgcgactgctattaataaagctggcagagacactacaagatgcaaagtaaatgttgaagttgagtttgcagagcctgagccagagagaaagttaatcatcccacgggggacatatagagcaaaggagattgcagccccagaactggagcccctccatttgcgatatggccaagagcaatgggaagaaggtgatctctatgacaaagagaaacaacagaaaccatttttcaagaaaaaactcacttccttaagacttaagcgctttgggcctgcccactttgaatgcaggctaacacccattggtgacccaacgatggtggtggagtggctccatgatggaaagccacttgaagcagccaacaggctccgtatgatcaatgaatttgggtactgcagccttgattatggcgttgcatattctagagacagtggtatcattacttgcagagccactaacaaatatggaacagatcacacatctgctacccttattgttaaagatgagaaaagtcttgtggaagaatcccaattgcctgaggggaggaaaggcttacagagaattgaagaattagagagaatggctcatgaaggtgcacttacaggtgtaacaacagatcagaaagaaaagcaaaagccagacattgtcttgtacccagagccagttagagtacttgaaggggagactgcaaggttccgctgcagggtaacaggctaccctcagcccaaagtcaactggtacctcaatggacagctcatccgcaaaagcaaaaggttcagagttcgctatgatggtatccattacctggacatcgtggactgcaaatcatatgacacaggtgaagtgaaggtcaccgcggaaaatcctgaaggtgtgatagagcataaagtgaagcttgagattcaacagagggaagattttaggtctgtccttaggagagctcctgaaccaaggcctgagtttcacgtacatgaaccaggaaagcttcagtttgaagtacaaaaagtggatagacctgttgacaccactgaaaccaaagaagttgtgaagttgaaaagggctgaaagaattacccatgaaaaagtgcctgaagagtcggaagagctgcgcagtaaattcaagcgcagaacagaagagggctattatgaagccattaccgctgtggagctcaagtctcgaaagaaggatgaatcctatgaggaactcctcaggaagacaaaagatgaacttctccactggaccaaagagttaactgaagaggaaaagaaagctcttgccgaagaaggcaaaatcacgattccaacttttaaacctgacaagattgaactaagtcctagtatggaggctccaaaaatcttcgaaagaatccagagccaaacagtgggccaaggatctgatgcacacttccgggtcagagtcgtggggaaaccagaccccgaatgtgaatggtacaaaaatggtgtcaaaattgaacggtctgaccggatctactggtactggcccgaagacaatgtttgtgaattggtcataagagatgtgactgctgaggactctgccagcatcatggtaaaagccatcaacatagctggagaaacctccagtcacgcattcttacttgtccaagccaagcaattgatcactttcacacaggaattacaagatgttgttgctaaggaaaaagacactatggcaacctttgaatgtgaaacttcagaaccatttgtcaaagtgaaatggtataaagatggtatggaggttcatgagggagataaatacaggatgcactctgacagaaaggttcacttcctctccatactgaccattgatacgtctgatgctgaagattacagctgtgtacttgtggaagatgaaaatgtcaaaacgactgctaaacttattgttgaaggtgcagttgttgagtttgtgaaagaacttcaggacatagaagttccagaatcatattcaggagaattagagtgcattgtatccccagaaaatatagaaggaaaatggtatcataatgatgtggagcttaaatccaatggcaaatatacaattacatctcgtcgtggacgtcagaacctcacggtcaaggatgtaaccaaggaggaccagggagaatacagctttgtcatcgacgggaaaaagacaacctgtaaattaaagatgaaaccccgccccattgctatcctacaaggacttagtgaccaaaaagtctgtgagggtgacattgttcagcttgaagttaaagtctccttggaaagtgtggaaggcgtctggatgaaagacggccaagaagtgcagcccagtgacagggttcacattgtgatagacaaacaatctcatatgctgctcattgaagacatgactaaggaagatgctggaaattactctttcaccattccagcccttggcctctccaccagtgggcgtgtctctgtctatagtgtggacgtgataacacctctaaaagatgttaatgtgattgaaggcaccaaggctgtgcttgaatgtaaggtgtcagtccctgatgtgacttctgttaagtggtacttaaatgatgaacaaatcaagcctgatgaccgtgtacaggccattgtgaaaggtactaaacagcgactagtcattaaccgaactcatgcttcagacgaaggaccttacaagctgatagttggcagagttgaaaccaactgtaatctctctgtagaaaaaattaaaattatcagaggtcttcgtgaccttacctgtacagaaactcaaaatgtggtgtttgaggttgagctgtcccactctggaattgatgtcctgtggaattttaaggacaaggaaatcaagcccagttctaaatataaaattgaagcacatggaaaaatatataaattgacagttctaaatatgatgaaagatgatgaaggaaaatacacattttacgcgggagaaaatatgacatctggaaaacttactgtggcaggtggggccatctccaagccactcacagatcagaccgtagctgaatcccaggaagctgtgtttgaatgtgaagttgccaacccagattccaaaggcgaatggttgagggatggcaaacacctaccactgactaacaacatcagaagtgagtctgatggccacaaaaggagacttatcattgctgccaccaaattagatgacattggagaatatacctacaaggtggccacctccaaaacatctgccaaactcaaagttgaagctgtcaaaattaagaagactctgaagaacctcacagtgacagaaacacaggatgctgttttcactgtcgagcttacacaccctaatgtcaaaggtgtccagtggatcaaaaatggagttgtgctggaatccaatgaaaagtatgctatctctgtcaaaggaacaatttactctctgaggattaaaaactgtgccatcgtggatgagtctgtttatggcttcaggcttggaaggcttggagccagtgccagactgcacgtggagactgtcaagatcattaaaaagccaaaggatgtgacagccttggaaaatgccactgttgcctttgaagttagtgtttcccatgacactgttccagtaaaatggttccataagagtgtggaaattaagccaagtgacaaacacagactggtctcagaaaggaaagtccacaagctgatgctgcagaacatctccccctcagatgctggggaatacacagctgtggtcgggcaattggaatgcaaagcaaaactgtttgtggagacattacatattacaaaaaccatgaaaaatatcgaggtgcctgagaccaaaactgcctcttttgagtgtgaggtgtcccacttcaatgtcccttccatgtggctgaagaatggtgtggaaattgagatgagtgaaaagttcaagatagttgtgcagggaaaactccatcagctgatcatcatgaacaccagcacagaggactcggcagaatacacatttgtctgtggcaatgaccaagtcagtgccaccctgacagtcaccccaatcatgattacttccatgctgaaagacatcaacgctgaagaaaaagacactattacttttgaggtgacagtgaactatgaaggcatctcttacaaatggttaaagaatggtgtggaaatcaaatcaactgacaagtgccagatgagaaccaaaaagctcacacactcactgaacatcaggaatgttcactttggggatgctgctgactacacctttgtggctggaaaagcaacatcaacagccacactttatgtggaagctcgtcatatagaatttaggaaacacattaaggacattaaggtactggagaagaagcgagccatgtttgaatgtgaagtttctgaacctgacatcactgtacagtggatgaaagatgaccaggaactgcagatcacagacagaataaagattcagaaggagaaatatgtccaccgccttctgatcccatccacccggatgtctgatgctgggaagtacacagtggtggcaggaggcaacgtgtcaactgcaaaactctttgtagaaggcagagatgttcgcatccgaagtattaaaaaggaggttcaggtcattgagaaacagcgtgctgttgttgaatttgaggtcaatgaagacgatgttgatgcccactggtataaagatggcattgaaatcaatttccaagttcaagaacgacacaaatatgtagtggaaagaagaatccaccgaatgtttatctctgagaccagacagagcgatgcaggagaatacacctttgtggcaggaaggaacaggagttctgtcactctctatgtcaatgctcctgaaccgccccaagttctgcaggagctccagcctgtcactgtgcagtctggcaagcctgcccgcttctgtgccgtgatatccggaagaccacagcccaaaatttcctggtacaaggaagagcagctgctttccactggcttcaagtgcaaatttcttcatgatgggcaagaatacacgcttttgctaattgaagccttcccagaggatgcggcagtctatacctgtgaagccaagaatgactatggtgttgccacaacatcagcttcactctcagtggaagttccagaagttgtgtctcctgatcaggaaatgcctgtttatccacctgccatcatcaccccgcttcaggacactgtcacttctgaagggcagccagcccgttttcaatgccgggtttctggaacagatctaaaagtgtcgtggtacagcaaagacaagaaaatcaagccatctcggttctttagaatgactcaatttgaagacacttatcaactggaaattgccgaagcttatccagaagatgaaggaacttacacgtttgttgctagtaatgctgtaggccaagtatcaagcacagccaacctgagtctggaagctcctgaatcaattttgcatgagaggattgaacaagagattgagatggaaatgaaagctgccccagtgatcaagaggaaaatcgaacccctggaagtagcactgggccacctagccaaattcacctgtgagatccaaagtgctcccaatgtccggttccagtggtttaaagctggccgagaaatttatgagagtgacaagtgttctattcgatcttcaaagtatatctccagccttgaaatcctgagaacccaggtggttgactgcggcgagtatacatgcaaagcttccaatgagtatggcagtgtcagctgtacagccacactaactgtgacagaggcatatccaccaacctttctctccagacctaagtcccttacaacttttgtgggtaaggcagccaagttcatctgcacagtgacagggactcctgtgatagaaaccatttggcagaaagatggtgctgcactctcaccttcacctaactggaggatttccgacgcagaaaacaaacacattttagaactctcaaaccttaccattcaagatagaggagtttattcttgtaaggcttccaacaagtttggagcagacatctgccaagcagagttgatcatcattgataagccacatttcattaaagaattagagcctgtgcagtccgctatcaataagaaggtccaccttgagtgccaagtagatgaagacagaaaagtcacagttacgtggagcaaagatgggcaaaaactccccccagggaaagattataagatctgttttgaagataaaatagcaacacttgagattcctttggccaaactgaaagattcaggaacctatgtctgtacagcttcaaatgaggctggaagcagctcctgctcagccacagtcactgtcagagagccaccatccttcgtgaagaaggtggatccctcttatttaatgctcccaggtgaatcagcacgcctccattgcaagctgaaaggctcacctgtgatccaggttacttggtttaaaaataacaaagaactcagtgaaagtaacacagtccgaatgtattttgtcaattctgaggctatacttgatattacggatgtaaaagttgaagacagtgggagttactcatgtgaagcagtgaatgacgtcggcagtgatagctgcagtactgaaatagttatcaaagaacctccttctttcatcaaaactcttgagcctgcagacatagtgagaggaacaaatgctctacttcagtgtgaagtctcaggcactggaccatttgaaattagctggttcaaagacaagaaacaaattcgaagtagtaaaaaatacagattgttttctcagaagtctcttgtgtgtctggagatcttttcgtttaatagtgcagatgttggtgaatatgaatgtgttgttgctaatgaagtcggcaagtgtggctgcatggcaacccacttactcaaagaacctccaacctttgtaaagaaagtagatgatttgattgcactaggaggacaaaccgttaccctgcaagctgctgtgagagggtcagagcccatttctgtcacatggatgaaaggtcaagaggtcatcagagaagacggaaaaatcaaaatgagcttttccaatggtgttgcagtcttgataatccctgatgttcagattagttttggaggcaaatacacgtgcctggctgaaaatgaagctggaagccaaacatctgttggggaattaatagttaaagaacctgccaaaatcattgagcgagcagaactgatccaggtgacagcaggagatcccgccacactggagtacacagtggcaggcacgccagaactgaagcccaaatggtacaaagatgggagacccttggtcgccagtaaaaaataccgaataagttttaaaaacaatgttgcccagctcaaattttattcagctgagctgcacgacagtggccaatacacatttgagatttccaatgaagtgggcagcagctcctgtgagactacattcactgtattagatcgagacattgctccattttttaccaaacccttgcgcaacgtggatagtgttgttaatggtacctgcagactggactgcaaaattgcaggctccctccccatgagggtgtcctggtttaaggatggcaaagaaatagctgcttctgacagatacaggatagcatttgtggaaggcacagcctctttggagatcatcagagtagacatgaatgatgcagggaatttcacttgtcgagccacaaattccgtgggaagcaaagacagcagtggagccctgattgtgcaagaaccacccagttttgtaactaaacccggctcaaaggatgttctgcctggctcagcagtctgcctgaagagcactttccaaggatctactcctctcacaatcagatggtttaagggcaacaaagagctggtttctggtggaagctgctatattaccaaagaagctttagagagttccctggaactctatttagtaaaaacctctgattcgggcacgtacacatgtaaagtcagcaatgtcgctggaggggtggaatgcagtgcaaacttgtttgtaaaagaacctgccacatttgttgaaaagttagagccatcacagctgttaaagaagggagatgccacccagctagcctgcaaagtaactggtacccctccaattaaaataacatggtttgcaaatgatagagaaattaaggagagcagcaaacacagaatgtcttttgtggagtctactgcagttctaagactgacagatgttggcatcgaagacagtggtgaatatatgtgtgaggcccaaaatgaggctggcagtgaccactgcagtagcattgtaatagtcaaagagtcaccttattttaccaaggaatttaagccaattgaagtcttaaaggagtacgatgtcatgttgctggctgaggtggcaggcactcctccctttgagatcacttggttcaaagataacacaatcctgcgaagtggtagaaagtataagactttcattcaggatcatctggttagcctgcagatcctcaagtttgtagctgcagatgctggcgaataccagtgtcgggtgaccaatgaggtgggcagcagcatctgcagtgccagggtgactttaagagaacccccatccttcataaagaagatcgagagtaccagctccctccggggaggcacagctgccttccaggccactctgaagggctccttgccaattacggtgacttggctaaaagacagcgatgaaatcactgaagacgataatataagaatgacctttgagaacaatgtggccagtttgtacctcagtggcattgaagtcaagcatgatgggaaatatgtctgtcaggccaaaaatgatgcaggaatacaaagatgttctgcattactctcagtaaaagaacctgcaacaatcaccgaggaagctgtgtctatagatgtcacccaaggagacccagccactttgcaggttaaattttcagggactaaggagattacagccaaatggtttaaagatggccaagaactgaccctgggctcaaaatataaaatcagtgtcactgatacagtctcaatactgaagattatttctacagaaaagaaagatagtggagaatatactttcgaggtccaaaatgatgttgggaggagcagctgcaaggctagaattaatgtattagatcttatcatacctccttcattcaccaaaaagctgaagaaaatggacagcattaaaggttctttcattgatttagaatgtatagtggctgggtcacatcccataagcatccagtggttcaaagatgaccaagaaatatcagctagtgaaaagtacaaattctcttttcatgacaatactgccttcttggaaatcagccagctggaaggtacagacagtgggacatacacttgttctgccacaaataaggcagggcacaaccaatgcagtgggcatctgacagtcaaagaacccccttactttgtggaaaagccacagtcacaagatgtcaatcccaacacaagggtacagttaaaggctcttgtgggtggcactgcacccatgacaataaagtggtttaaagataacaaagagttacactcaggagcagcccgctcagtttggaaggatgacacctctaccagtctagagctctttgcagccaaagctaccgattctggaacctacatttgccaactaagcaatgatgttggcacagcaaccagcaaagccactctctttgtaaaagaacctcctcaattcattaagaagcccagtccagtcttagtgctgaggaatggacagtcaacaacatttgaatgccaaataacaggcactcctaaaatccgagtgtcttggtatctagacgggaatgaaataacagccattcagaaacatggcatttccttcattgatggtttagccactttccagatttctggtgccagggtagaaaatagtgggacttatgtgtgtgaagctcgaaatgacgcaggcacggcgagctgcagcattgaactcaaagtgaaagaaccccccacctttatcagagagctgaagcctgtggaggtagtaaaatatagtgacgtggagctggagtgtgaagttacgggaacacctccgtttgaagtcacttggctgaagaataacagggaaattcgaagcagcaaaaaatacacattgaccgacagagtgtctgtgtttaacctccatataaccaagtgtgacccttcagacactggggaataccagtgcattgtatccaatgaaggcggcagctgctcatgcagtactagagttgccctgaaagaaccaccatcattcattaagaagatagaaaataccactactgttttgaaaagttctgccacctttcagagtaccgtggcaggttctcctcctatttctataacctggctaaaggatgatcagattcttgatgaagatgataatgtctatatttcatttgtggacagtgtggccacacttcaaatcagaagtgtggataatggacacagtgggagatatacctgtcaagccaagaatgagtcaggagttgagaggtgttatgctttccttttagtacaagaaccagctcaaatcgtagagaaagctaaatcagttgatgttacggagaaagatcccatgaccttggaatgtgttgtggctggaacaccagaactcaaagtgaaatggcttaaagacgggaaacaaatagttcccagtagatacttttcaatgagttttgaaaataacgtggccagttttagaattcagtcagtaatgaagcaggacagcggtcagtacactttcaaggtggaaaatgacttcggaagcagtagctgtgatgcctacttaagagtgctagatcaaaatattcctccatcattcaccaaaaaattaaccaaaatggataaagttctgggctcttctattcatatggagtgcaaggtgtctggttcacttcccattagtgctcagtggtttaaggatggaaaagaaatatctacaagtgcaaaatacagacttgtgtgccatgagagatctgtgtctctggaagttaataatctggaattagaagatactgcaaattacacatgcaaagtgtcaaatgtagcaggagatgatgcatgcagtggcatcttaactgtgaaagaaccaccaagcttcctagtgaaacctgggcgacagcaagccatacctgattctacagtggaatttaaggcaatactaaaaggaacaccaccatttaaaataaaatggtttaaggatgatgtggaacttgtctcaggtcctaaatgtttcattggcttggaagggtcgactagcttcttaaatctctactcagtggatgcttctaagactggacagtatacttgccatgttaccaatgatgttggtagcgactcttgtactacgatgttgcttgtgacagaaccaccaaagtttgtaaagaaattagaagcctccaaaattgtgaaagcaggtgactcttcacgacttgaatgcaagatagctggatccccagaaatcagagttgtgtggttccgaaatgaacatgaacttccagccagtgataagtacagaatgactttcattgactcagtggccgtcatacagatgaacaatctcagtactgaggacagtggagatttcatttgtgaggctcagaatcccgctggcagcacaagctgcagtaccaaggttatagtaaaagagccacctgtttttagcagcttccctcctatagtagaaacccttaaaaatgctgaagtcagtcttgaatgtgaactttcgggaacaccaccgtttgaggtggtatggtacaaagacaagcggcaactcagaagcagcaagaaatacaagattgcatccaaaaacttccacacaagtattcacattctcaatgtggacacttcagacatcggtgaataccactgcaaagcacagaatgaagtgggaagtgatacttgtgtttgtactgtaaaattgaaagaaccaccaagatttgtctccaaactgaacagcctcactgttgtagccggagagcctgctgaattacaagcatccatagaaggcgcccagcctatttttgtccagtggcttaaagagaaggaagaagtgattagagaaagtgaaaacatcaggattacatttgtggaaaatgttgcaactctacagtttgcaaaagcagagccagctaatgctggaaagtatatctgccaaatcaagaatgatggtggaatgagggagaacatggccacactgatggtcttagagcccgcagtcattgttgagaaggcaggaccgatgacggtgactgtaggagaaacgtgcactctggagtgtaaggtggctggcactccggaactctctgttgaatggtacaaggatggaaagctgttgaccagcagccaaaaacacaaatttagcttctacaacaaaatctcttccttaaggattctctcagttgaaaggcaagatgcaggcacatacactttccaggttcaaaataatgttgggaaaagcagctgcacagctgtggttgatgtttcagaccgagcagttcctccctctttcacacgaagactgaaaaatactggtggggtgttaggtgcttcttgcatcttggaatgcaaagtagctggatcatcacctatttcagttgcctggtttcatgagaaaaccaagattgtcagtggagcaaagtaccaaaccacattttcagataatgtctgcacattgcagttgaattctctggattcctcagatatgggcaattacacatgcgtggctgctaatgtcgctgggtctgatgaatgtcgtgcagtgctaactgtacaagaaccaccctcttttgtgaaagaacctgaacctttggaagtactaccaggcaaaaatgtaaccttcacaagcgttattagaggaacccctccattcaaagtcaactggttcagaggtgccagagaactagtgaaaggagaccggtgcaacatctattttgaagacactgtggcagaactggaattatttaatattgacatatctcagagtggggaatacacctgtgtggtttctaacaacgctggccaagcatcttgcactacccgtctctttgtgaaagaaccagctgcatttttgaagagattaagtgatcattctgtagaaccagggaagtccataattctggagagcacctacactggaacacttccaatttctgtcacttggaaaaaggatggttttaacataactacctctgaaaaatgtaacatagtcacaacagagaaaacttgtatcctggaaattctgaatagcacaaaaagagatgcagggcagtattcctgcgagattgaaaatgaggcaggaagggatgtttgtggagctctggtatctacattagaaccgccttattttgttacggaactggaacctctggaggcagcagttggagattcggtttctttacaatgccaagttgctgggacaccagaaattacagtgtcttggtacaaaggagataccaaattacggccaactcctgaatacaggacctactttacaaacaatgtggccacacttgtttttaataaagtgaacatcaatgacagtggagagtacacatgcaaagcagaaaatagtataggaactgcttcttctaagactgtgttcagaattcaagagcgccaactcccaccttcttttgcaagacaattaaaggacattgaacaaactgtggggttacctgttacactcacttgtcgattaaatggctctgcacccatccaagtgtgctggtatagagatggagtacttttaagagacgatgaaaatctacagacttcatttgtagataatgtggcaactttaaaaattttgcaaactgacttgagtcactctggccagtactcttgctcagcttccaacccacttggaacagcatcttctagtgctagactcacagcaagagaacccaagaaatctcccttctttgacatcaagcctgtatctatagatgttattgctggagaaagtgctgattttgagtgtcatgttactggtgctcaaccgatgcgaatcacttggtcaaaagataacaaggagatccgtcctggaggaaactatacaatcacatgtgtgggaaacactcctcatttgagaattcttaaagtaggcaaaggagactctggtcaatatacttgccaagcaaccaatgatgttggcaaagacatgtgctcagctcagctcagtgtaaaagaacctccaaagtttgttaagaaattagaagcttcaaaagttgcaaagcagggagaatccattcaactggaatgtaaaataagtggctccccagaaatcaaagtttcatggttccgaaatgacagcgaacttcatgaaagttggaaatacaacatgtcattcattaattctgtggcattgcttacgatcaatgaagctagtgctgaagacagcggggactacatttgtgaggctcataatggtgttggtgacgccagctgcagcacagcgttgacagtgaaagcacctcctgttttcacccagaagccttctccagtaggagctcttaaaggttctgatgtgattctccaatgtgaaatttcgggaactcccccatttgaagtagtatgggttaaagatcgaaagcaggttagaaacagcaagaaatttaaaatcacttcaaaacattttgatacaagtcttcatatccttaatcttgaagcctccgatgtcggggaatatcactgcaaagctactaatgaggtgggaagtgacacgtgttcttgctctgtcaagttcaaagaacctccacgattcgtgaaaaagctaagtgacacctcaacccttattggggatgctgttgagttacgggccatagtggagggcttccagccaatttctgttgtctggctgaaagatagaggtgaagtcatcagagagagtgaaaataccaggatttcattcattgataacattgcaaccctccagctggggagtccagaagcatctaattctggaaaatatatatgccaaatcaaaaacgatgctggaatgagagaatgctctgcagtcttgactgtactagaaccagcaagaatcatagagaagcccgaacccatgactgtcactactggaaatccttttgcattagagtgtgtagtgactggaacaccagaactctcagccaagtggttcaaagatggaagagaattgtctgcagacagcaaacatcacattacattcatcaataaagtggcttcccttaaaatcccctgtgccgaaatgagtgacaaaggattatatagctttgaagtgaaaaacagtgttggcaaaagtaactgcactgtatccgtccatgtttctgatcggattgtgcctccttccttcatccgcaagctgaaagacgtgaatgccatcctgggggcctcagttgttttggagtgccgagtctctggctcagccccgatttcagttggctggtttcaggatggaaatgagattgttagtgggcccaaatgtcagtccagcttttcggaaaacgtctgtactttgaatctgagcttgttggagccctccgacacaggcatatacacgtgtgtggctgccaatgtagctggttccgatgagtgctcagcagtcctgactgtgcaagaaccaccatcttttgaacaaacccctgattctgtggaagttttgcctggaatgagcctcacattcaccagtgtcatcagaggcacccctcctttcaaggtcaagtggtttaaaggcagcagggaactggtgcctggggagtcatgcaacatctctctggaagattttgtcacagaactggagttgtttgaggtgcagccattagaaagtggagactattcttgcctcgttacaaatgatgctggcagtgcttcctgtaccacacatctttttgtgaaagaaccagccacctttgtgaaaagattggctgatttcagtgttgagacaggaagccccatagttctcgaggccacatacactggcacacctccaatctcagtgagctggataaaggacgagtatcttatttcacaatctgagagatgcagtattactatgacagaaaaatctaccatactggaaattcttgagagcacaatagaggattatgcacagtacagctgcctgatagaaaatgaggctggtcaagatatctgtgaagctctggtgtctgtcttagaaccaccgtactttattgaacctctggaacatgtggaagcagtcattggagaacctgcaactttacagtgtaaagtggatggaactccagaaattagaatttcttggtataaagaacacacaaagctacgatcagctcctgcatataaaatgcaattcaaaaataacgttgcttccttagtaatcaacaaagtggatcacagtgatgtgggagagtattcatgcaaggcagacaacagtgtgggggcagtcgcttcttcagctgtgcttgttatcaaagcgcgcaaacttccacctttctttgcaagaaaactgaaagacgttcatgagactctaggcttcccagttgcatttgaatgccgcatcaatggctcagaacctcttcaagtgtcttggtacaaggatggggttcttttgaaagatgatgctaatttgcagacatcttttgttcataatgtagcaactcttcagattttacaaactgaccagagccacatagggcagtataattgctctgcttctaatcctcttgggactgcttcatccagtgccaagctcattctctcagagcatgaagtgcctcctttctttgatctaaagcctgtatcagtagatcttgctcttggagaaagtggtacttttaaatgtcatgtaactgggactgcaccaatcaaaatcacttgggccaaagataaccgagagattcgccctggaggcaactacaagatgactttggtagaaaatactgccactctgacagttctcaaagtaggcaaaggcgatgccgggcagtacacctgctatgcaagcaacatcgctggaaaagactcttgttctgctcagctgggtgtacaagaaccacccaggttcattaagaagctagaaccttcaagaattgtgaaacaggatgaattcacaaggtatgaatgcaaaatcggtgggtctccagaaatcaaagttttatggtataaggacgagactgaaattcaagagagcagtaaattcagaatgtcattcgttgactcggtggctgtgctggaaatgcacaatctcagtgttgaagacagtggagactacacctgtgaggcccacaatgcagcaggcagtgccagcagcagcacatccttaaaagttaaagaaccacccattttccgcaaaaagcctcatcctatagagacactgaaaggagctgatgttcaccttgaatgtgagcttcagggcactcccccatttcacgtttcttggtataaagacaagagagaacttaggagcggcaagaagtacaagataatgtctgagaacttcctaaccagtatccacatcctgaatgtcgatgctgcagacattggggaatatcagtgtaaagccacaaatgatgtgggaagcgacacttgcgttggttccatcgctctcaaagcaccaccaagatttgtgaagaagctcagtgacatatctactgtcgttggtaaagaagttcagctgcagactaccattgaaggcgctgaacccatttcagtggtgtggttcaaagataagggagaaatcgttagagaaagtgacaacatatggatttcttattcagaaaacattgcaaccttacagttttcaagagtggaaccagccaatgctggaaaatacacttgtcagatcaaaaacgatgctgggatgcaagagtgcttcgccacgctatccgttctcgagcctgcaacaattgtagaaaagccagaatccataaaagttaccacgggagacacctgtaccttggagtgtacagtagctggcacccctgaactcagtactaagtggtttaaggatggaaaagagctaacaagtgacaacaaatacaaaataagcttcttcaacaaagtatccggccttaagatcatcaatgtagcaccgagtgacagtggggtatacagttttgaggtgcagaaccctgttggcaaagacagctgcacagcttcattgcaggtttcagaccgaaccgttcctccttcattcacaagaaaattgaaagagacaaatggtctatccggctcctcagttgtaatggagtgtaaagtctatgggtcacctccaatctctgtctcctggttccatgaaggaaatgagatcagtagtggaaggaaataccagaccaccctgacagataatacttgtgctttaactgtgaacatgctggaagaatcagacagtggtgactacacatgtatagctactaatatggctggttctgatgaatgtagtgctcctttgactgtgagagaaccaccatcttttgttcagaaacctgatcccatggatgttttaactgggaccaatgtaactttcacaagtatcgtaaaaggaacacctcctttcagtgttagctggttcaaaggtagcagtgaactagtaccaggtgacagatgcaacgtgtctttggaggattcagttgctgaactggagttgttcgatgtagatacatcacaaagtggagaatatacttgcatagttagcaatgaagctggcaaggcttcttgtacaacacatctctacataaaagccccagccaaatttgtgaagaggctgaatgattacagcatagagaaaggaaaacccctgatcctagagggtacattcactggaactcctcccatttcggttacctggaagaaaaatggcataaatgtaactccttctcagaggtgtaatataactacgactgaaaaatcggcaatcctggaaattccaagtagcacagtagaggatgcaggacaatacaactgctacattgaaaatgcctctggaaaagattcctgttcagcacaaatactcatactagaaccaccgtattttgtcaagcagttggagccggttaaggtgtctgttggagattctgcctctctacaatgccagcttgctggaacccctgaaattggggtatcctggtataaaggagatacaaaattgagacccactacgacttacaaaatgcattttaggaataatgttgctacactggttttcaaccaggttgatattaatgatagtggagaatatatctgcaaagctgaaaacagcgtgggagaagtttctgcatcaactttccttaccgttcaagagcaaaaacttccaccatcattttctcgacaattgagagatgttcaagaaacagttggactgccagttgtttttgattgtgccataagtggatcagaacctatctccgtgtcttggtataaagacggcaagccattgaaagacagcccaaatgtacaaacatcatttttagacaatacagccacactcaatatttttaaaactgaccggagccttgcaggccagtattcctgcacagctacaaaccctataggctctgcttcttccagtgccaggctcattctcacagaggggaagaacccacccttctttgacatccgtcttgcccctgtggatgctgtggtgggagaaagtgctgactttgagtgccacgtcacgggcacacaaccgataaaggtcagctgggccaaagacagcagagaaatacgaagtggcggaaagtaccagattagttatctggaaaacagcgcccacctgacagtcctcaaagtagacaaaggagattctggacaatatacctgctatgctgtgaatgaagtgggaaaagactcttgcacagctcagctgaatataaaagagcggctcatcccaccaagtttcactaaaagactctcagagacagtagaagaaacagaagggaattctttcaaacttgagggacgtgtggctggttcccaacctataactgttgcctggtacaaaaataatatagagatacaaccaacttctaactgtgaaataacattcaagaacaacacgttagtgctgcaagtcaggaaagcaggcatgaacgacgctggtttgtacacatgcaaagtgtccaatgatgcaggctctgctctgtgcacgtcttcaatcgtcatcaaagaacctaagaagccacctgtatttgatcagcaccttactccagtaacagtgagtgaaggagaatacgtgcagctcagctgccatgtccagggatctgagccaattaggatccagtggttgaaggctggcagggaaataaagccttcagacagatgcagcttcagctttgctagtgggacagctgtactggaactcagagatgtggctaaagcagattcgggagattatgtgtgtaaagcttcaaatgtggctggaagtgacactaccaaatcaaaagtgaccattaaagacaaaccagctgtggccccagcaaccaagaaagctgcggtagatggaagactcttttttgtgtcagaacctcagagtatcagagtcgtagaaaaaaccactgcgaccttcattgcaaaagttggaggtgacccaatcccaaatgttaaatggacaaaagggaagtggagacagctgaaccaaggaggtcgtgttttcatccaccaaaaaggcgatgaagcaaaactggagattagggacaccacaaaaactgattctgggttataccgatgcgtggcatttaacgaacatggtgaaattgaaagtaatgttaacttacaggtggatgaaaggaagaaacaagagaaaattgaaggcgatcttagagcaatgctgaaaaagactccaatcttaaagaaaggagctggagaagaagaggaaattgatatcatggaacttctcaaaaatgttgatcctaaagaatatgaaaaatatgcccgcatgtatggaatcactgacttccgaggtcttcttcaagcatttgaactgctcaagcaaagccaagaagaagagacacatagactggaaattgaggaaatagagaggtcagagagggacgaaaaggaatttgaggaacttgtatcatttattcagcaaagactgtcacagacagagcctgtcactctgatcaaggacattgaaaatcagacagttttgaaagataatgatgctgtctttgaaattgacattaaaattaattatccagaaatcaagctttcgtggtacaaaggaactgaaaaactggaacccagtgataaatttgaaataagcattgatggtgaccgacatacactcagagtcaaaaactgtcaacttaaagaccagggcaattatcgattggtttgtggtccacacatcgctagcgctaaactaactgtaattgagcctgcatgggaacggcatcttcaggatgtgactctgaaagaaggccagacttgcaccatgacatgccaattttctgtaccaaatgtaaaatctgaatggttcagaaatggcagaatccttaaaccccaaggtagacataaaacagaagtggaacacaaagtccataaattgaccattgcagatgttcgagcagaagaccagggtcagtacacctgcaaatatgaagaccttgaaacttcagcagaactcagaatcgaagctgaaccaattcagtttacaaagcgcatacagaacatcgtggtgagtgagcatcagtctgccacctttgagtgtgaagtgtcctttgatgatgccattgtaacatggtacaaaggaccaacagaactgacagagagccagaaatacaacttcaggaatgatggccgctgccattatatgaccatccacaatgtgaccccagacgatgaaggtgtctactcggtcatcgctcggctggagccaagaggtgaagcaagaagcacggcagagctgtacctaacgacgaaagaaatcaaacttgagctgaagcctcctgatattcctgactccagagttccaatcccaaccatgcctatcagagcagtgccaccagaagaaatccctcctgtggttgctcctcctatcccccttttgctaccaacacccgaagaaaagaaaccaccaccaaaacgtattgaagttaccaaaaaggctgtgaagaaagatgccaaaaaagttgttgcaaagcccaaagagatgacaccacgtgaagagattgtcaagaagcctccacctcctactaccttaattccagcaaaagctcctgaaatcattgatgtatcctctaaagctgaagaagtaaaaataatgactataaccagaaagaaagaggttcagaaagaaaaagaagctgtgtatgagaaaaagcaagcagtccacaaggagaagagagtcttcattgaatctttcgaagaaccttatgacgaactggaggtagaaccatacacagagccatttgaacaaccttattatgaagaaccagatgaagactatgaagagattaaggtagaagctaaaaaagaagttcacgaggaatgggaagaagattttgaagaagggcaagaatactatgaaagggaagaaggctatgacgaaggggaggaagagtgggaagaggcttaccaagaaagggaagtaattcaagttcaaaaggaggtctatgaagaatcacatgagagaaaagttccagccaaagtacctgaaaagaaagcaccaccacctcctaaagttataaagaagccagtaattgaaaaaattgaaaagacttctcgaagaatggaggaagaaaaagttcaagtcaccaaagtacctgaagtttcaaagaagattgttccacaaaaaccttcccggactccagtacaggaagaagttattgaagtgaaagtaccagctgtgcatacaaagaagatggttatttcagaagaaaagatgttctttgcttctcacacagaggaggaggtgtcagtcacagtccccgaggtacaaaaggaaattgttactgaagagaaaattcacgttgccatttccaaaagggttgaaccaccacctaaagtccctgagctacctgagaaaccagctccagaagaagtggcccctgttcctatccctaaaaaagtggagcccccagcaccaaaagttcctgaggttcccaagaaacccgtgccagaggagaaaaagccagttcctgtgcctaagaaggaacctgctgctcccccaaaagtcccagaggtgccaaagaaacctgtccctgaagaaaagattcccgttcctgttgcaaagaaaaaggaagctcccccagctaaagttcctgaagtacagaagggagttgtgacagaagaaaaaataaccattgtaactcaaagagaggaatctccaccaccagcagtgccagaaataccaaagaagaaagttcctgaagaaaggaaacctgttcctcggaaggaggaagaagttccaccaccaccaaaagtgccagctctgcctaagaaacccgtcccagaggagaaagttgcagtgccagttcctgtcgctaagaaagctcctcctccccgagctgaagtctctaagaaaactgttgtagaagaaaagagatttgttgctgaagaaaaactatccttcgcagttcctcaaagagtggaagtcacgcggcacgaagtatctgcagaggaggaatggagttactcagaagaggaggaaggtgtgtccatttcagtttatagagaagaagaaagagaggaggaggaagaagcagaggttacagaatatgaagtgatggaagagcctgaggaatatgttgtggaagaaaagctgcacattatttctaagagagtggaagctgagccagctgaagtgacagagaggcaggagaagaaaattgtactgaaaccaaaaattcctgctaaaatagaggagcctccaccggctaaagttcctgaagcacctaagaaaattgtgccagaaaagaaagttcctgctccagttcctaaaaaggaaaaggtgcccccacctaaagtgccagaagagccaaagaaaccagttccagaaaaaaaggttcctccaaaagtcattaagatggaagaacctctcccagccaaagtgactgagaggcacatgcaaattacccaggaagaaaaagttcttgttgctgtaactaaaaaagaggcgcctccaaaagcaagagtgccagaggaaccgaagagagctgtcccagaagaaaaagttctgaaactcaaacctaaaagagaggaggaaccaccagctaaagtgactgaattcagaaaaagagtggttaaagaagaaaaagtatcaattgaagctccaaaaagagaacctcaacccatcaaagaagtaactataatggaagagaaagaaagggcttataccctagaagaagaagctgtttcagtacaacgggaagaagaatatgaggaatatgaagaatatgattataaagaatttgaggagtatgaaccaacagaagaatatgaccaatatgaagaatacgaggagcgggagtatgaacgatatgaagagcatgaagaatacatcacagaaccagagaagcctatccctgtaaagcctgtcccagaagaaccagttcccacaaaaccaaaggccccaccggctaaagtgctgaagaaagctgtccctgaagaaaaagtaccagtgcccattcctaagaaactcaaacctccaccacccaaagtgcctgaagaaccaaagaaagtttttgaggaaaaaatacgtatttcaattaccaaacgtgaaaaagagcaggtgactgaacccgctgctaaagtgcccatgaagcccaagagggttgtcgcagaagaaaaagtacctgtccctagaaaagaagtagcaccacctgttagagtgccagaagtgcctaaagaacttgaaccagaagaggttgcctttgaagaggaagttgtaacccatgtagaagaatatcttgtagaagaagaagaagagtacattcatgaagaagaggagttcataactgaggaagaagtggtgccagtgataccagtcaaagtgcctgaggtacccaggaaacctgttccagaagagaagaaacctgttcctgttcccaagaagaaggaagctccaccggcaaaagtgcctgaggttcctaagaagccagaggagaaagttcctgtgcttattcctaaaaaggagaagcctccgccagcaaaagttcctgaagtgcccaagaaacctgtgccagaggagaaagtaccagtaccagttcctaaaaaggtggaagctccacctgccaaagtgccagaggtacccaagaagcctgtgcctgagaagaaggtgccagttcctgctcctaagaaagtggaggctccacctgcaaaagtgccagaggtgcccaagaagctcatcccagaagaaaagaaaccaacacctgttccgaaaaaagtggaagcaccaccacccaaagtgccaaagaaacgtgaaccagttccagttcctgtagctctacctcaggaagaggaagttctatttgaagaagaaattgttcctgaagaggaagttctacctgaggaagaggaagttctacctgaggaagaggaagttctacctgaagaagaggaagttctacctgaagaagaggaaattccacctgaggaagaggaagttcctcccgaagaagaatatgtacctgaggaagaagaatttgtacctgaagaagaagtccttccagaagttaaacctaaggtgccagtacctgcaccagtgcctgaaattaagaagaaagtgacagagaagaaagtggtcattcccaagaaagaggaggctccccctgccaaagttcctgaggtgcctaagaaggtggaagaaaaacgaatcattctccctaaagaagaggaagttctaccagttgaagtgactgaggagcctgaagaagagcctatttcagaagaagaaatcccagaagaaccacctagcatagaggaagttgaagaggtggcaccacctagagtgcctgaagtgattaagaaagcagtacctgaagcacctactcctgttcctaaaaaagtggaggcaccaccagctaaagtgtcaaagaaaattcctgaggaaaaagtacctgttcctgttcagaaaaaagaggcacccccagccaaagtgcctgaagtaccaaagaaagtcccagaaaagaaagtccttgtgcctaaaaaggaagctgttcccccagctaaagggagaactgtccttgaagaaaaagtatcagttgccttccgccaagaagtagtagtaaaagaaagactagaattagaagtagtagaagcagaagtggaagaaattccggaagaagaagagttccatgaagttgaagaatattttgaagaaggcgagtttcatgaagtagaagaattcatcaaattagaacaacatagagttgaagaagaacacagagttgaaaaagttcatagggtaatagaagtttttgaggctgaagaagtggaagtatttgaaaaaccaaaagctccacctaaagggcctgagatatctgagaaaatcatccctccaaaaaaaccgcccactaaagttgttcctcgaaaagagccaccagctaaagtaccggaggtgcctaagaaaattgtggtagaagaaaaagtacgtgttcctgaagagcccagagttccaccaactaaagtgcctgaagtgctgccaccgaaggaagtggtcccagaaaagaaagtaccggtgcctcctgccaaaaagccagaagctccacctcctaaagtgcctgaggctcccaaagaagttgttcctgaaaagaaagtgccagtgcctcctcctaaaaagcctgaagtgccacccacaaaagtcccagaggtgccaaaggcagctgtcccagaaaagaaggtgcctgaagctattcctcccaaaccggaaagtcctccccctgaagtgccagaggctccgaaagaagttgttcctgaaaagaaagtgccagcggctcctcctaaaaagcctgaagtcacacctgttaaagtgcctgaggctcccaaagaagttgttcctgaaaagaaagtgccagtgcctcctcctaaaaagcctgaagtgccacccacaaaagtcccagaggtgccaaaggtagctgtcccagaaaagaaggtgcctgaagctattcctcccaaaccggaaagtcctccccctgaagtgttcgaggagcctgaggaagttgccctagaagagcctcctgctgaagttgtggaagagccagagccagcggcgcctccacaagtgaccgtaccacctaagaaacctgtcccagaaaagaaagcacctgctgtcgttgccaaaaaacctgaactaccaccagtgaaagtgcccgaggtgcccaaggaggttgttcctgaaaagaaggtgcctctggtggttcccaaaaagccagaagccccacctgctaaagtgcctgaagttccaaaagaagttgttccagaaaagaaagtagctgttcccaaaaagccagaagtcccaccagcaaaagtgccagaagtgccaaagaaacctgtcttggaagagaaaccagctgttcctgttccagaaagagcggagtctcctcccccagaagtatatgaagaacctgaggaaattgctcctgaagaggaaattgctcctgaagaggaaaagccagttcctgttgcagaagaggaggaaccagaggttccacctccagcagtgcctgaagagcccaagaagatcatcccagagaagaaagttcctgtcatcaaaaaaccagaagcaccgcctcctaaagaacctgaacctgaaaaggttattgagaagccaaaactcaaaccaagacccccacctcctccacctgctccacctaaggaagatgtgaaggagaaaatattccaacttaaagctattccaaagaagaaagttcctgaaaaacctcaggttccagaaaaagtggagcttacacctctgaaagtgcctggaggtgaaaagaaagttcgcaaattacttccggaacgtaaacctgaaccaaaggaagaagttgttctgaaaagcgttctaagaaaaagacctgaagaagaagaacctaaagtagaacctaaaaaactagaaaaagttaaaaaacctgcagtaccagaaccaccacctccaaaacctgttgaagaggttgaagtacctactgttacaaaaagggaaaggaagattcctgaaccaacaaaagtgcctgaaatcaagccagcaatacctctccctgcacctgaaccgaaaccaaagcccgaagcagaagtgaaaacaatcaaaccacctcctgtggaacctgaaccaacccccatcgctgccccagtaacagtgccagtggttggaaagaaagcagaagccaaagcacctaaggaagaggctgccaagccaaaaggtcctatcaaaggtgtacccaaaaagactccttcaccaatagaagccgaaaggagaaagttaaggccaggaagtggtggagagaaacctcctgatgaagccccgttcacctaccagctaaaggctgtgccactgaagtttgtgaaagaaatcaaagacatcatcttgacagaatcagagttcgttggctcttcagcaatctttgaatgtttggtctccccttccactgcaattacaacctggatgaaagacggtagcaatatccgtgagagtcccaagcacaggtttattgcagatggtaaagacagaaagctgcacatcattgatgttcaactttccgatgctggtgaatacacctgtgttttacgtttgggaaacaaagaaaagacctccacggctaaacttgttgtagaagaacttcctgtgcgttttgtaaaaacactggaagaggaagtcacagtggtcaaaggacagccattgtacttgagctgcgagttaaacaaagagcgtgacgtggtctggaggaaggatggcaagattgtggtggagaaacctggccgaattgtgccaggcgtcattggcttgatgcgggctctgaccatcaacgatgcagatgacacagatgctggaacatacacagttactgtggaaaacgccaacaacctggagtgttcatcttgcgtaaaagtagtagaagtcattagagattggctggtgaaacctatacgagaccagcatgtgaaacccaaggggacagctatttttgcctgtgatatagcaaaagatactccaaacattaagtggttcaaaggatatgatgaaatccctgcggaaccaaatgataagactgaaatactgagagatggaaatcatctgtacctcaaaattaagaatgctatgccagaagatattgctgagtatgcagtggaaattgaaggaaaaagataccctgcaaagctgacacttggagagcgtgaagttgaactgcttaaaccaatagaggacgttaccatttatgagaaagaaagtgcaagctttgatgcagaaatctcagaggcagacattcctggacaatggaaactgaaaggagaacttctaaggccctcacctacttgtgaaatcaaagcagaaggtggaaaacgcttcttaactttgcacaaagtcaaactggaccaagctggtgaagtcctctaccaggcccttaatgcaattacaactgccattttgacagtaaaagaaatcgaacttgactttgctgtgcccctgaaggatgtcactgttccagaaaggcgacaggctcgattcgaatgtgtcctcacccgagaggcaaatgttatatggtccaaaggacctgatataattaagtcatctgacaaatttgatatcatcgctgatggaaagaaacatattcttgttattaatgattctcaatttgatgatgaaggggtctatactgctgaggtggagggcaagaagacctcagctcggttgtttgtcacaggtataagactgaaattcatgtcacctcttgaagatcaaacagtaaaagaaggtgaaacagcaacttttgtttgtgaactttctcatgaaaaaatgcatgtagtctggttcaaaaatgatgccaaactccatacaagcagaacagtactcatctcttctgagggcaagactcacaaattggaaatgaaagaagtgacattggatgatatatctcagataaaagctcaagtcaaggagctgagctccacagcacagctgaaggtcttagaggccgatccctacttcactgtgaaattacatgacaaaactgcagtggagaaggatgagattactttgaagtgtgaagtgagcaaagatgtaccagtgaaatggttcaaagatggtgaagagattgtcccttcacccaaatattctatcaaggcagatggcctgcgccgcatcttaaaaatcaaaaaggcggaccttaaagataaaggcgaatatgtgtgtgactgtggcacagacaagaccaaggcaaatgttactgttgaggctcgactaataaaagtggaaaagcctctgtacggagtagaggtgtttgttggtgaaacagcccactttgaaattgaactttctgaacctgatgttcacggccagtggaagctgaaaggacagcctttgacagcttcccctgactgtgaaatcattgaggatggaaagaagcatattctgatccttcataactgtcagctgggtatgacaggagaggtttccttccaggctgctaatgccaaatctgcagccaatctgaaagtgaaagaattgcctcttatcttcatcacacctctcagtgatgttaaagtcttcgagaaagatgaggctaagtttgagtgtgaagtatccagggagcccaaaacattccgttggctaaaaggaacccaggaaatcacaggtgatgacagatttgagcttataaaggatggcactaagcattcaatggtgatcaagtcagctgcttttgaagatgaagcaaaatacatgtttgaagctgaagataagcacacaagtggcaaactgatcattgaaggaatccggctcaaattcctcacccctctcaaagatgtaactgccaaagagaaggaaagtgctgtatttactgtggagttatctcatgataacatccgagttaaatggttcaagaatgaccagcgcctacacaccaccaggtcggtctcaatgcaagacgaagggaaaactcattcgatcacattcaaagacctgtctattgatgacacctcccaaattagagtagaagctatggggatgagttcagaagctaaactcactgtgcttgagggagacccatattttacaggaaaacttcaagattatactggtgtagagaaagatgaagttattctacagtgtgaaattagcaaagcagatgcaccagtgaaatggtttaaggatgggaaggaaataaagccatccaaaaatgctgttattaaggcagatggcaagaaacgcatgctaatcctaaagaaagccttgaaatcagatattggacagtacacctgtgactgtgggacagataagacctcaggaaaacttgacattgaggatcgggaaattaaactggtgcgacccctgcacagtgtggaggtgatggagactgagacagcacgctttgaaaccgaaatctctgaagatgatatccacgccaactggaaactcaagggagaggccctactccaaacacctgattgtgaaattaaggaagaaggcaaaatacactcccttgttttgcacaactgtcgcctggaccagacgggtggggtggatttccaagctgccaatgttaaatctagtgcccacctccgagttaagccacgagtaattggtcttctgaggcctttaaaggatgtcaccgtgactgcaggggaaacagccaccttcgactgcgagctctcctacgaagatatcccagtggaatggtatctcaaagggaagaaactagagcccagcgataaggtggtcccacgttcagaaggaaaagttcatacacttactctgagggatgtaaagttagaagatgctggggaagtccaactaacagcaaaagatttcaaaactcacgccaacctctttgtgaaagaacccccagttgaattcactaagcctcttgaggaccagacggtcgaagagggagccactgcagtgctggagtgtgaagtctccagagaaaatgctaaggtgaaatggttcaaaaatgggacagaaatcctcaaaagcaagaagtatgaaattgttgctgatggcagggtcagaaaacttgttatacatgactgtaccccagaggatattaaaacatacacttgtgatgctaaggattttaagacttcctgtaacctgaatgtcgtgcctcctcatgtggaattcttaagaccactcaccgaccttcaagttagagaaaaagaaatggctcgatttgagtgtgaactttcccgagaaaatgctaaggttaagtggtttaaagatggtgctgaaattaaaaagggcaaaaaatatgacatcatatccaagggagcagtgcgcattcttgtcatcaacaaatgtctactggatgatgaagctgaatattcctgtgaagtaaggacagcgagaacttctggcatgctgacagttctggaagaagaagctgtctttaccaaaaatcttgccaacattgaagttagtgaaacagacactataaaactggtttgtgaagtctccaaacctggcgcagaagtgatttggtataaaggggatgaggagatcattgaaacaggaagatatgaaatactgactgaaggacggaagagaatcctggtcattcagaacgctcaccttgaggatgctggcaactacaactgtcgactcccaagctctcgaaccgatggcaaagtcaaagtacatgaactggctgctgaatttatctcaaagcctcaaaaccttgaaatacttgaaggagaaaaggctgaatttgtctgctctatatcaaaagaaagctttccagtccagtggaagagggatgataagacacttgaatctggagataaatatgacgttattgctgatggtaaaaagagggtcctagttgtgaaagatgccacattacaagatatgggcacttacgttgtcatggtaggggccgccagagcagcagctcacttgacagtcattgaaaaactcaggatcgtagttcctcttaaggacacccgggtgaaggaacaacaggaagttgtcttcaactgtgaagtcaatactgaaggtgccaaagccaaatggttcagaaatgaagaagctatatttgatagttcaaaatacatcattctccaaaaagacctagtctacaccctcagaattagagatgcacacttagatgaccaagccaactataatgtgtctttgaccaatcacagaggtgaaaatgttaaaagtgcagccaatctaatagtagaagaggaagaccttaggattgttgagcctcttaaagatattgaaacaatggagaagaaatctgtcacattctggtgcaaggtgaatcgtctcaatgtaacactgaagtggaccaaaaatggtgaagaagtgccttttgacaaccgtgtctcatacagagttgataagtacaagcacatgttaaccattaaagactgtggcttcccagatgaaggtgaatacattgtcactgctggacaagataaatctgttgctgagcttctcatcatagaagccccgacagaatttgtggaacacttggaagatcagacagtcactgagttcgatgacgctgtcttctcctgccagctctccagagagaaagccaatgtaaaatggtacagaaatgggagagaaatcaaagaaggcaaaaaatacaaatttgaaaaagatggaagtatacacagactcattataaaagattgcaggctggatgatgagtgtgaatatgcttgcggggtagaagacaggaagtctcgtgctagactttttgtggaagaaattcctgttgagatcatcaggcctccacaagatattcttgaagcccctggtgctgatgttgtctttttagcagaactcaataaagataaggtggaagtccaatggctaagaaataacatggttgttgtccagggtgataaacaccagatgatgagtgaaggaaagatacatcgactacagatttgtgatattaagccccgtgaccagggtgaatacagatttattgccaaagacaaagaagccagagctaagcttgaactggcagctgcaccaaaaatcaagacagctgaccaagaccttgtggttgatgttggcaagcctctgacaatggtggtgccatatgatgcctaccccaaagcagaagctgaatggtttaaagaaaatgaacctttatctacaaaaaccattgatactacggctgaacaaacttctttcagaattttagaagccaagaaaggagacaaagggaggtataaaattgtgcttcagaacaaacatggaaaagcagaaggattcatcaatttaaaagttattgatgttcctgggccagtacgtaacttagaagtgacagaaacatttgatggtgaagtgagccttgcttgggaagaacctttaactgatggtggaagcaaaatcataggttacgttgttgaaagacgtgacattaagagaaagacctgggttctggccacagaccgtgcagagagttgtgagtttactgtcactggtctacagaaaggaggagttgagtacctattccgtgtgagtgcaagaaacagagttggcactggtgagccagtagaaactgacaatcctgtagaagcaaggagtaaatatgatgttccaggccctcctttgaatgtaaccatcactgatgtgaatcgatttggtgtctcactgacatgggaaccaccagagtatgatggaggtgctgagatcacaaactacgtcattgaattaagagacaagacttctatcaggtgggatactgccatgactgtgagagctgaagacctgtctgcaactgttactgatgtggtagaaggacaggagtacagtttccgagtgagagcccaaaatcgaattggagttggaaaaccaagtgcagccacacccttcgtcaaagttgctgatccaattgagagaccaagtcctcctgtaaacctaacttcctcagatcagactcagtcatcagttcagctcaaatgggaacctcctctgaaagatggaggaagcccaatattaggctatataattgagcgatgcgaagaaggaaaagataattggattcgttgcaatatgaaacttgtccctgaactgacttacaaggttaccggattggaaaaaggaaataaatatttatatagagtatctgcagaaaataaagctggtgtttcagatccatctgaaattcttggtcctctcaccgctgacgatgcatttgttgaaccaacaatggatttaagtgcatttaaagatggtctggaagttattgtcccaaatcctatcacgatcctggttccaagtacaggctatccaaggccaactgcaacctggtgttttggagataaagtactagaaacaggggaccgggtgaaaatgaagaccttgtctgcctatgccgaacttgtcatttctccaagtgaacgttcagacaagggcatttatacactgaaattagaaaaccgtgtgaaaacaatttctggggaaattgatgtcaatgtaattgctcgcccaagtgcacccaaagaattgaaatttggtgatataaccaaggactcagtacatttgacttgggaaccacctgatgatgatggaggaagtccgttaactggatacgttgttgaaaaacgagaagtcagccggaaaacatggactaaagttatggactttgtgactgatctagaattcacagttcctgatcttgttcaaggaaaagagtacttatttaaagtttgtgctcgtaacaaatgtggccctggagaacctgcatatgttgatgaacctgtaaatatgtcaactcctgcaacggtacctgacccaccagagaatgttaaatggagagatcgaacagccaatagcatcttcttaacatgggatccacctaaaaatgatggtggttcacgcatcaaaggatatatagttgaaagatgtccacgtggttctgataaatgggttgcctgtggagaacctgttgcagaaacaaaaatggaagtgacaggtcttgaggaaggcaaatggtatgcctaccgcgtgaaggccttaaacaggcagggtgctagcaaaccaagcagacccacagaggaaatccaggctgtggacacacaagaggccccagaaatcttcctcgatgtgaagctccttgctggtctcactgtaaaagctgggaccaagattgaacttcctgccaccgtaaccggaaaacctgaacctaaaataacttggacaaaggctgatatgattctgaagcaggacaaaagaattaccattgaaaatgtccctaagaaatccacagtgactattgttgatagtaagagaagtgacactggcacatatatcattgaggctgtgaatgtgtgtggccgggccactgctgtggtggaagtgaacgtcttagataaacccggaccaccagctgcctttgacatcacagatgtaaccaatgagtcatgtcttctaacatggaacccaccacgcgatgatggtggatctaagatcacaaactatgttgtggagagacgagcaactgatagtgaagtgtggcacaagctctcatccaccgtcaaggatacaaacttcaaggccaccaaattaatccccaataaagagtacatcttcagagttgctgcagaaaacatgtatggtgttggtgaaccagttcaggcctctccaataacagccaaatatcagtttgatccacctggtcctccaactcgcctagaaccttctgatatcactaaagacgcagtgactctcacatggtgtgagccagatgatgatggtggcagcccaatcacaggatactgggttgaaagactggatcctgatacagataaatgggttagatgcaataagatgccagtaaaggacacaacatacagagtgaaaggtctcactaataagaaaaaatacagattccgtgtgttggctgaaaatcttgctggacctggaaaaccaagcaaatcaactgaaccaatcttaataaaggatcccatagatcctccatggccccctggaaaaccaactgtaaaagatgtaggcaaaacatcagtaaggttgaattggacaaaaccagaacatgatggaggtgcaaagattgagtcttatgtcattgaaatgctgaagactggaacagatgagtgggtcagagtggcggaaggggttcccaccactcagcacttgctcccagggctcatggaaggacaggaatactcattccgagttagagctgtgaataaggctggggaaagtgaacccagtgaacccagtgaccctgtgctttgccgggagaagctatatcctccatcaccaccacgctggcttgaagttattaatatcacaaaaaatacagcagacctaaaatggacagttcctgagaaagatggagggtcccccatcaccaactacattgtggaaaagagagacgtcaggcgaaaaggctggcaaacagtggataccactgtcaaggacaccaagtgcacagtcaccccactgactgagggctctttatatgtgttccgagttgctgcagaaaatgctataggacaaagcgactacaccgaaattgaggactctgtgctggccaaagacacctttaccactcctggaccaccctacgccctggcagtggttgatgtgacaaaacgacatgttgacctaaagtgggagccacctaaaaatgatggtggaagaccaatacagagatatgtcattgagaagaaagaaaggttaggtacccgttgggtgaaagctggaaagactgcaggacctgactgtaacttcagagtaactgatgtcatcgaaggaacagaggtccagtttcaggttcgggctgaaaatgaagctggagttggccacccaagtgaacccacagaaatcctatccattgaagatccaacaagtcctccctcaccaccccttgacctacatgtgactgatgctgggagaaaacacattgccattgcttggaagcctccagagaaaaatggtggaagtcctatcataggataccatgttgaaatgtgtccagtaggcactgagaaatggatgagagttaattctcgcccaataaaggacttgaaattcaaggttgaagaaggtgttgttcctgacaaagaatatgtcctgagagtgagagcagtcaatgctattggtgtcagcgagccatctgaaatctctgaaaatgtggttgccaaagacccagactgcaagccaacaattgacctggagactcatgacattattgttattgaaggtgaaaagttaagcattcctgttcccttcagagctgtcccagttccaactgttagttggcataaagatggcaaagaagttaaagcaagtgatagattaacaatgaagaatgatcacatctctgcacaccttgaagttcccaagagtgtccgtgcagatgccggaatttataccattacactggagaataagctcggctcagcaacagcctcaatcaatgtcaaagtcataggcctacctggaccatgcaaagatattaaagcaagtgacattaccaagagttcttgtaagttaacttgggaacctccagaatttgatggtggaaccccaattcttcattatgtcctggagcgcagagaagctgggaggagaacatatataccagtcatgtctggtgagaacaaactgtcatggactgtgaaggatctcataccaaatggtgaatacttcttccgtgttaaagcagtcaacaaggttggtggaggagaatatattgaactgaaaaatccagtcattgctcaagatccaaagcaaccccctgatccacctgtagatgtagaggttcataatcctacagcggaggcaatgactattacatggaagccacctttgtatgatggagggagcaagataatgggctacatcatagagaagattgctaagggtgaagaaaggtggaagagatgcaatgaacacctggtaccaatcctgacctatacagcaaaaggacttgaagaggggaaagagtaccaattccgtgtgcgagcagagaacgccgcgggtattagtgaaccttctcgggctactcctccaaccaaagctgtagatcccattgatgcccccaaagtcattctgagaacaagcctagaagtgaaacgaggtgatgaaatagcacttgatgcaagtatttctggatcaccttacccaactattacatggataaaggatgaaaatgttattgtaccagaggaaattaagaagcgtgcagcacccttggttaggagaaggaagggtgaagttcaagaagaagaaccatttgtcctgcctctgacacagcgtttgagtattgacaacagcaaaaagggagaatctcagctacgcgtccgagattctctccgacctgaccatggtctgtatatgatcaaagttgaaaatgaccacggtattgcaaaagctccttgtactgtcagtgtgttagatacaccgggaccaccaatcaactttgtatttgaagatatcagaaagacctcagtcctttgtaaatgggaaccaccccttgatgatggtggcagtgaaatcataaactacactttggaaaagaaagacaagacaaaacccgactcagaatggattgttgtcacttcaacacttagacattgcaaatattcagtaacaaaactgattgaaggaaaagagtacctcttccgtgtaagagctgaaaacagatttgggccaggtccaccatgtgtttcaaagccacttgtggctaaagatccatttggaccacctgatgcaccagataagcccattgtggaagatgttaccagcaacagtatgctagtgaaatggaatgaaccaaaagataatggaagccccattttgggttactggcttgaaaaacgtgaagttaacagtacacattggtctcgtgtcaacaaaagccttctgaatgccttgaaagccaatgtagatggcttattagaaggactcacctatgtcttcagagtatgtgctgaaaatgcagctggacctggaaagttcagtccaccttcagatcccaaaacagcacatgatccaatctctcctcctgggccacctatcccaagagtcactgacacaagctctacaactattgaactagaatgggaacccccagctttcaatggtggtggggaaattgttggctattttgttgataagcagttggttggcacaaatgaatggtcacgctgcacagagaagatgatcaaggtccgtcagtacaccgtcaaagaaatccgagagggtgctgattacaaacttcgggtgagtgctgtcaatgccgcaggggaaggaccgcctggagaaacacaacctgttactgtggctgaaccacaagagcctccagctgtggaactggatgtttctgtcaagggtggaatacaaataatggctgggaagactcttagaattccagctgtggtgactggtcgccctgtacctacaaaagtatggaccaaagaagaaggggagctggataaagaccgtgttgtaatagacaacgttggaaccaaatctgaactaattatcaaggatgcactgcgaaaagaccatggcagatatgtgattacagctacaaatagctgtggttccaaatttgcagcagccagggtagaagtttttgatgtccctggtccagttcttgacttaaaacctgttgtaacaaacagaaaaatgtgtctacttaactggtctgatccagaagatgatggaggaagtgaaataacaggctttatcattgaaagaaaagatgccaagatgcatacttggagacaaccaatagagactgagagatctaaatgtgacatcacaggtctgcttgagggacaagaatataagttccgtgttattgccaagaacaagtttggctgtggccctcctgttgaaataggaccaattcttgcagttgatccactaggtcctccaacatctccagagaggctcacatacactgaaaggacaaagtccactatcacacttgactggaaagagccccgcagtaatggtggcagtcccatccaaggatatatcattgaaaaacggcgtcatgacaaacctgactttgaaagagttaacaagcgactctgcccaaccacatcttttctggttgaaaatcttgatgaacaccaaatgtatgagttccgtgtcaaagctgtcaatgaaattggtgaaagtgaaccatccctacctcttaatgtagtcatacaagatgatgaagtgcctccaactattaagttgcgtctgagtgttcgaggagacactatcaaagttaaggcaggagagcctgtccacatccctgcagatgtgacaggccttccaatgcctaagattgaatggtccaaaaatgaaactgtaattgaaaaacccactgatgcacttcagataaccaaggaagaggtatcccgaagtgaggcaaaaactgagcttagcattcccaaagcggtccgggaggacaaaggcacttacacagttactgcttccaatcgccttggctcagtgttccgaaatgttcacgttgaagtatatgaccgcccatccccaccaagaaatcttgctgttactgacattaaagctgaatcttgctacttgacatgggatgcccctcttgataatggtggcagtgaaatcacccattatgttattgacaaacgtgatgcaagtaggaagaaagcagaatgggaggaagtcaccaacactgctgtagagaaaagatatgggatctggaaacttatccccaatggtcagtatgagttccgagtcagggcagtgaataaatatggaatcagtgatgagtgcaaatcagataaagtagtcattcaagatccttatcgccttcctggacctccaggaaaaccaaaagttttggcacgcaccaaaggatcaatgctagtgagctggactcctcctttggacaatggtggctctccaattactggctactggctggagaaaagagaagagggaagtccttattggtcacgtgttagccgagcaccaataaccaaagtgggattgaaaggcgtggaatttaatgttcctcgtttgcttgaaggcgttaaataccagttcagagccatggcaataaatgctgcaggaattggtcctcccagtgaaccatcagatccagaggttgcaggagatcccatatttccaccggggccaccttcttgcccagaagttaaagataaaacgaagtcaagcatctcactaggatggaaacctccagccaaagatggtggcagcccaatcaaaggatacattgtagaaatgcaagaagaaggtactactgactggaaaagagtaaatgaaccagacaaacttataactacctgtgaatgtgtggtgcctaatctgaaagagctcaggaagtacagattcagagtgaaagctgtcaatgaagctggtgaatctgaaccaagtgatacaactggggagatccctgccactgatattcaagaggaaccagaagttttcattgacattggagcacaggactgtctggtttgtaaagctggctcacagattaggattcctgctgtcatcaagggacgcccaacaccaaaatcatcttgggaatttgatggaaaggcaaagaaagcaatgaaggatggagttcatgacatacccgaagatgcacagctggagactgctgaaaactcctcagtaattattattccggagtgtaaacgatctcatacaggcaaatacagcatcacagccaagaataaagcaggacaaaagactgcaaattgcagagttaaagtcatggatgtaccaggcccacccaaagatctgaaagtcagtgatatcacaaggggtagttgcagactttcatggaagatgccagacgacgatggaggagacaggatcaaaggctatgttattgagaagaggactattgatggaaaagcctggaccaaagtcaatccagactgtggaagcaccacatttgtagtgcctgatctcctctctgaacagcaatatttcttccgtgtgcgagcagaaaaccgttttggtattggcccacctgtggaaaccattcagaggaccactgccagagatccgatatatcctcctgatcctcctattaaactcaagattggcctcatcacaaagaacacagtgcatctgtcatggaaacccccgaagaatgatgggggctcccctgttacccactatattgttgagtgccttgcatgggaccctactgggacaaagaaagaagcctggaggcagtgcaataagcgtgatgtggaagaactgcaatttactgttgaagacctagtagagggtggggaatatgaattccgagtcaaagctgtcaatgctgcaggagtcagcaagccttcagccactgttggccctgtgactgtcaaagaccagacatgcccaccatcaattgatctaaaagaattcatggaggttgaagaaggaaccaatgttaacattgtggccaaaattaaaggtgtgccattcccgacactaacctggtttaaagctcctccaaagaagcctgataacaaagaacctgttctctatgacacccatgtcaacaaactggtggtagatgatacttgcactttagttattccgcagtctcgcaggagtgacactggcttatataccatcacagctgtaaataatctgggaacagcatcaaaggagatgagactgaatgtcctgggtcgtcctggccctccagtgggacccataaaatttgaatctgtttcagcagatcaaatgacactatcttggtttccacctaaagatgatggtgggtctaagattacaaactatgtaattgagaaaagagaagctaacaggaagacatgggtccatgtctccagtgaacctaaggagtgcacgtacacgattcccaaattgctagaaggccatgaatatgtattccgaatcatggcccagaataaatatggcattggagaacctcttgacagtgaacctgaaacagcaagaaacctcttctctgtccctggagcaccagataaaccaacagttagcagcgtgactcgtaactccatgactgtcaactgggaagagccagaatatgatggaggctctcctgtgacagggtactggctggaaatgaaagacaccacttcaaagagatggaagagagttaaccgagatcctatcaaagccatgactttgggtgtttcttataaagtgactggtcttattgaaggttccgactatcaattccgggtatatgcaatcaatgctgctggcgtgggtccagcaagtctgccatcagacccagcgactgctagagatccaattgcccctcctggtcctccatttcccaaagtgacagattggactaaatcatctgcagatctggagtggtctcccccactaaaagatggtggatccaaagtaactggatacatcgttgaatataaagaagaaggaaaagaagaatgggaaaagggtaaagataaagaagtgagaggaacaaagcttgttgtgacaggattaaaggaaggagcattctacaaatttagagttagagcagtcaacattgctggcattggagaacctggagaggtcacagatgtcattgaaatgaaggacagacttgtttcacctgaccttcagctagatgccagtgtcagagatagaattgttgtccatgctggaggggtgatccgaatcattgcctatgtgtctggaaagcctcctccaaccgtcacctggaacatgaatgaaagaaccttacctcaagaagccaccattgagaccacagccattagctcatccatggtcatcaagaactgccagaggagccatcaaggcgtctattctcttcttgccaaaaatgaagccggagaaagaaagaagacaattattgttgatgtattagatgttccaggtcccgttggaacaccattcctagctcacaacctaaccaatgagtcctgcaaactgacatggttttctccagaagatgatggaggctctccaatcaccaattatgtcattgaaaagcgtgaatctgaccgcagagcatggaccccagtgacatatacagttacccgacaaaatgctactgtccagggtctcattcaaggaaaagcctactttttccgaattgcggctgaaaatagtattggcatgggtccatttgttgagacatcagaggcacttgttatcagagagccaataactgtaccagagcgtcctgaagacctggaagtcaaagaagttactaaaaatactgtaactttgacttggaatcctcctaagtatgatggtgggtcagaaattattaactatgtcctagaaagtcggctcattgggactgagaagttccacaaagttacaaatgacaacttgcttagcagaaaatacactgttaaaggcttaaaagaaggtgatacctatgagtaccgtgtcagtgctgtcaacattgttggacaaggcaaaccatcattttgcaccaaaccaattacttgcaaggatgagctggcacccccaacgcttcacctcgacttcagagataagctcacgattcgagttggtgaagcttttgccctcactggccgttactcaggcaaaccaaagcctaaggtttcctggttcaaagatgaagctgatgtgctggaagatgatcgcactcatataaagactacaccagcaacacttgctttagagaagatcaaggccaaacgttcagattccggcaaatactgtgtggttgtggagaacagtacaggctctaggaaaggtttctgtcaagttaatgttgttgaccgtcctggaccaccagtaggaccagttagttttgatgaggtgaccaaagattacatggttatctcttggaagcctcctttagatgatggaggcagtaaaatcaccaattatattattgagaagaaggaagtgggtaaagacgtctggatgccagtgacatctgcaagtgctaaaacaacatgcaaagtttctaaactacttgaaggaaaagattatattttccggatacatgctgaaaatctgtatggaataagtgatcctctggtgtctgattcaatgaaagccaaagatcgtttcagggttcctgatgcacctgatcagccaattgttacagaagttaccaaagactctgcattagtaacctggaataagccacatgatggaggaaaacccatcacaaactacatcctggaaaagagagaaactatgtctaaacgatgggctagagttaccaaagatcctattcatccatacactaaatttagggttcctgatcttctagaaggatgtcagtatgaattccgggtttctgcagaaaatgaaattggtattggagatccaagcccaccatccaaaccagtctttgctaaagatccaattgctaaaccaagtccacctgttaatcctgaagcaatagatacaacatgcaattcagtcgatctaacttggcagccaccacgtcatgatggtgggagcaagattctgggttatattgttgagtaccagaaagttggagatgaagagtggagaagagccaatcacacccctgagtcatgtcctgaaactaaatataaagtcaccggtcttcgggacggtcaaacctataagtttagagtgttagcagtcaatgcagctggtgaatcagatccagctcatgttccggagccagtcctagtaaaagacaggcttgaaccccctgagttgattcttgatgccaacatggcaagagaacaacacattaaagttggtgatactctaagacttagtgccatcatcaaaggagtgccattcccaaaagtaacttggaaaaaagaagacagagatgctccaactaaagcaagaattgatgtgactccagttggtagcaagcttgaaattcgtaatgctgcccatgaagatggtggaatttattctttaacagtggagaatccagctggttcaaaaactgtctcagtaaaagtacttgtattagataaacctgggccacctagagatctggaagtcagtgaaattaggaaagattcatgttaccttacttggaaagaaccactggatgatggtggttctgttattaccaattatgtggttgagaggagagatgttgccagcgcccagtggtcacctctctcagctacatcaaagaaaaagagtcacttcgctaagcatctgaatgaaggcaaccagtacctcttccgagtagctgcggagaaccagtatggacgtggtccttttgttgaaacaccaaaaccaatcaaggctttggatcctctccatcccccagggccacccaaggacctgcaccatgtagatgttgacaagactgaagtctccctagtctggaataagccggatcgtgatggtggttctccaatcactggatatttggtagaatatcaagaagaaggcacccaggactggattaaatttaagactgtgacaaacttagagtgtgtggttactggactacaacaaggaaagacctatagattccgtgtaaaagctgaaaacattgtgggtcttggtctccctgacacaactatcccgatagaatgtcaagaaaaactagtgcctccatccgtggagctagatgtgaaattaattgaaggtcttgtggtaaaggctggaaccacagtcagattccctgctattataagaggtgtgcctgttcctactgcaaagtggacaaccgatgggagtgagattaaaaccgatgagcactacacagttgaaacagacaacttctcatcagtacttaccattaagaactgcttaaggagagacactggggaatatcaaatcacagtttccaatgcagccggtagcaaaacagtagccgtacatcttactgttcttgatgttcctgggccaccaacaggtcctattaatattctggatgttactcctgaacacatgactatctcatggcagccacctaaggatgatggaggaagccctgtgataaattatattgttgagaaacaagatacaaggaaagacacgtggggtgttgtctcttccggaagcagtaagacaaagctgaaaatcccacatctgcagaagggctgtgaatatgttttccgagttagagcagagaataagataggtgttggtcctccccttgactccacacctactgttgctaagcataaatttagtcctccgtctcctcctggtaaaccagtggttactgacattactgaaaatgcagcaacagtgtcttggaccctgccaaaatctgatggtggcagtccaataactggctactatatggaacgtcgagaagtaactggcaaatgggtgagggtcaacaaaacacctatcgctgacctgaagttcagagtgactggactctatgaaggaaatacatatgagtttagagtttttgctgaaaatcttgcaggactaagcaaaccatccccaagttctgatccaataaaagcttgccggcccatcaaaccacctggaccacctattaatcctaaactgaaagacaagagcagagaaacagctgatttggtgtggacaaagcctctcagtgatggtggtagccccattctaggatatgtagtggaatgtcagaaacctggcacagcacaatggaacaggattaataaagatgaactcattaggcaatgtgcctttagggtacctggactaattgaaggaaatgagtacagattccgtataaaggcagctaatattgtaggagagggtgagccaagagaactagcagaatctgtgattgcaaaagatatccttcatcctccagaagtagaacttgatgttacttgtcgtgatgttattaccgtgagagtaggccaaactatccgcattctagctcgagtcaaaggcagacctgaaccagacataacttggactaaggaaggcaaagtattggtccgagaaaagagggtggaccttattcaggatctacctcgtgttgagttacaaattaaagaagctgttagagctgatcatggcaagtatatcatctcagctaagaacagcagtggacatgcccaaggttcagccatcgttaacgtccttgacagacctgggccttgccagaatttgaaggttaccaatgtaaccaaagagaactgtacaatttcttgggaaaacccactagataatggtggctcagaaataacaaacttcatagtagaatatcgcaaaccaaaccagaaaggctggtcaattgttgcatcagatgtcactaaacgattaatcaaggccaaccttttagccaacaatgaatactatttccgagtttgtgcagagaataaagtaggtgttgggccaaccatcgaaacaaaaactcccattctggctattaaccctattgacagaccaggtgagcctgaaaaccttcacattgcagataaaggaaagacatttgtctatctaaagtggcggaggcctgactatgatggtggcagtccaaatctgtcatatcatgttgagagaaggcttaagggctccgatgactgggaaagagtgcataaaggaagcattaaagaaactcactacatggttgacagatgtgttgaaaaccagatttatgagttcagagtgcaaacaaagaatgaaggtggggaaagtgactgggtgaagacagaggaagttgttgtgaaagaagacttacaaaaaccagtacttgatctgaaattaagtggggtcctaactgtcaaagcaggggacaccattaggcttgaggcaggggttagaggcaaaccattcccagaagttgcatggaccaaggacaaagacgctacagacttaacaagatcaccaagggtcaagattgatacccgtgctgattcatctaaattttctcttactaaagcaaagcgaagtgatgggggtaaatatgtagttacggcaactaacacggctggcagttttgtggcctatgccactgtcaatgttttagataagcctggtcctgtgagaaatctgaaaattgttgatgtgtccagtgataggtgtactgtttgctgggatccaccagaagatgatggtggctgtgaaatccaaaattatattctagaaaaatgtgagacaaagcgaatggtttggtctacctattctgctactgtcttgacacctggtactacagtaacacgtctcatagaaggaaatgaatatattttcagagtccgtgcagaaaataaaataggcacagggcctccaacagaaagtaaaccagtcatagccaaaaccaagtatgataaacctggtcgccctgatcccccagaagtcactaaagtaagcaaagaagagatgactgtggtttggaatccacctgaatatgatggtggaaagtctataactggatactttttggagaaaaaggaaaagcattcaacacgatgggtccctgtcaacaagagtgcaatccctgagagacgtatgaaagtacagaatctcctcccagaccatgaatatcagttccgtgtcaaggcagaaaatgaaattggaattggagaaccaagcttgccttcaagaccggtggtggcaaaagaccccatagagccacctggtccaccaaccaatttcagagtggttgatacaaccaaacattccataactcttgggtggggaaaaccagtctatgatggtggtgcaccgatcattggatatgttgtggaaatgagaccaaaaatagcagatgcgtctcctgatgaaggctggaaacggtgtaatgctgcagcacagcttgtacgcaaggaattcactgttaccagcttggatgaaaaccaggaatatgagttcagggtgtgtgcccaaaaccaagttggtattgggcgccctgcagagctaaaggaagctatcaaacctaaagaaatactagaacctccggagattgatttggatgccagcatgaggaaactggtcatagtgagagcaggatgccctattcgtctctttgctatagtgagaggacgaccagcccctaaagtcacttggcgaaaagttggcattgataatgtggtcagaaaaggacaagttgatctggttgacactatggccttccttgtcatccccaattctacccgtgatgactcaggaaaatattccttaacacttgtgaacccagcaggagaaaaggctgtattcgtaaatgtcagagtattagacactcctgggcctgtgtctgatttaaaagtttcagatgtcactaaaacatcatgccatgtgtcctgggcccctcctgaaaacgacggtgggagccaagtgacacattatatcgtggagaaacgtgaggcagacagaaagacatggtcgaccgttaccccagaagttaagaaaacaagcttccatgtaaccaatcttgtccctgggaatgagtattacttcagagtaactgctgtcaacgaatatggccctggcgtcccaacagatgtcccaaaaccagtgcttgcatcagatcctctaagtgagccggatcccccaaggaaattagaagtgactgaaatgaccaagaacagtgccaccttagcctggttacctcccctacgtgatggaggtgctaaaatcgatggctacatcactagttacagagaagaagagcagcctgcagatcgctggacagagtactcagtggtaaaagatctgagccttgttgtcactggcctaaaggaaggaaagaaatacaaatttagagtagcggccagaaatgctgttggagtcagtttgccaagagaagctgaaggagtgtatgaagccaaagaacaactgttgccaccaaagatccttatgccagagcaaataactatcaaagctgggaaaaaactccgaattgaagcccatgtgtatggaaagcctcatcccacctgtaaatggaaaaaaggagaagatgaagttgtcacatccagccacctggcagtgcataaagcagacagctcttcaattctgatcataaaagatgtgactaggaaagacagtggttactacagcctcacagcagagaacagttctgggacagacactcagaaaatcaaagttgtagtcatggatgcccccggcccccctcagcctccatttgacatttctgatatagacgctgatgcttgctccctgtcatggcacatccctctggaggacggaggcagtaacatcaccaattatatagtggagaagtgtgatgtaagccgaggtgactgggtcacggctctagcttcagtcacaaaaacttcctgcagggttggaaagctgatcccaggccaggagtacatcttccgggtccgtgctgaaaaccgatttggcatttcagagcctctcacatctccaaagatggttgcgcagttcccatttggtgttcctagtgaaccaaagaatgcacgagtcaccaaagtcaacaaggactgtatttttgttgcttgggacagaccagatagtgatggagggagccccattattggttatctgattgaacgcaaggaaagaaacagtttgctgtgggtgaaagccaatgatactcttgtccggtcaactgaatatccttgtgctggccttgtagaaggtcttgagtattcattcagaatctatgccctaaacaaagctggatccagcccacccagcaaacccacagaatatgtaactgcaagaatgccagttgatcctcctgggaaacctgaggttattgatgtcaccaagagtactgtatctctgatctgggctcgtccaaagcatgatggaggcagtaaaattattggctatttcgtagaagcttgcaaacttcctggtgataaatgggtacggtgcaatactgcacctcaccagattccccaggaagagtacacagctactggcctagaagagaaagctcagtatcaatttagagctattgccaggaccgcggtaaacattagcccaccttctgaaccttctgatccagtgactatcctcgcagaaaatgtccctcccaggatagacctgagtgtggctatgaaatctttgcttactgtgaaagctggaactaatgtctgcttggatgctactgtttttggtaaaccgatgccaacagtttcttggaaaaaagatggcacactgctaaaaccagcagaaggcataaagatggccatgcagcggaatctgtgcaccttggagctattcagcgtgaaccggaaggactcaggagactataccattactgctgaaaattcaagtggttctaaatcagccaccattaagcttaaagtgttagataaaccgggtcctccagcatctgttaaaatcaacaaaatgtattcagatcgtgctatgctttcttgggaaccgcctcttgaagatggaggctcagaaatcaccaactatattgttgacaaacgtgaaacaagcaggcccaactgggctcaagtctctgcaactgtgcctatcaccagctgcagcgtggagaaacttatagagggccatgagtatcagttccgtatttgtgctgaaaataaatatggagtaggcgatccagtcttcactgaaccagcaattgccaaaaacccatatgacccaccaggacgctgtgatcctcctgttattagcaacataaccaaagatcacatgacagtcagctggaagccaccagcagatgatgggggctcacccatcactggctatttgcttgaaaagcgggaaacccaggctgttaactggactaaggtcaacagaaaacctattatagaaagaacattaaaagcaacaggtcttcaagaaggtaccgaatatgagttccgtgttacagctataaataaagctggaccaggcaaacccagtgacgcatccaaggccgcttatgctcgggaccctcagtatcctcctggcccaccggctttccctaaagtatatgatacaactcgcagctctgtgagtctatcttggggcaagccagcctatgacggcggcagccctatcattggttatctcgttgaagtaaaacgggctgactccgataactgggtgaggtgcaacttaccacagaatctacagaaaacccgctttgaggttactggcctgatggaagacacacaatatcaattccgtgtgtatgccgttaataagattggatacagtgaccccagtgatgtgccagataaacactatcccaaggacatcttaattccacctgagggagaacttgatgcggacttaaggaagacactcatattacgtgctggagttactatgagactatatgtaccagtaaaaggacgcccacctccaaagattacttggtctaaaccaaatgtcaatctaagagacaggattggactggacataaagtcaactgactttgacactttcttgcgctgtgaaaatgtgaacaaatatgatgcaggaaaatatatcttaaccctggagaacagctgtggtaaaaaggaatataccattgttgtgaaagtgcttgatactcctgggccacctgtcaatgtgactgttaaggaaatatccaaagactctgcttatgttacctgggagcctcccattattgatggcggaagccccatcataaactatgtggtacaaaaacgtgatgcagagaggaaatcctggtctacagtgacaactgagtgctccaaaacaagcttcagagtagctaatttggaggagggaaaatcctacttcttccgagtgtttgctgaaaatgagtatggcattggtgatcccggtgaaactcgtgatgctgtcaaagcttcccaaactcctggaccagttgtggacctgaaagtgaggtctgtatctaagtcatcctgtagcattggctggaaaaagcctcacagtgatggtggaagtcggattattggatatgtagttgatttcctgactgaagaaaataagtggcaacgagttatgaaatccttaagcctacagtactctgcaaaagatttgactgaagggaaggaatataccttcagagtgagtgctgagaatgaaaatggagaaggaaccccaagcgaaatcactgttgtggcaagggatgatgttgtggctcctgatcttgacttaaagggtctacctgatttgtgctacttggctaaagaaaacagcaacttccggcttaagatccccataaaaggcaagccagctccatcagtctcctggaagaaaggggaagatcctctagcaactgacactagagtcagtgttgagtcatctgcggttaacacaactcttatagtgtacgattgccaaaaatctgatgctggaaaatacacaatcacacttaagaatgttgctggcaccaaggaaggaactatctccataaaggttgttggcaagcctggcatccccactggaccaatcaaatttgatgaagtcacagcagaagccatgaccttaaagtgggctcctccaaaggatgatggaggttctgaaatcaccaactatatcctagagaagagggattctgtgaacaacaagtgggtgacgtgcgcctcagctgtccagaaaaccacctttagagtaaccagacttcatgagggcatggaatataccttcagggtcagtgccgaaaataaatatggtgtaggggaaggcctgaaatcggagccaattgttgcgagacatccatttgatgtgcctgatgctcccccacctcccaatattgtggatgtcagacacgattcagtatctctaacttggactgaccccaagaaaactggtggttctccaattacagggtatcatctcgagttcaaggaaagaaacagccttttgtggaagagagctaacaagactccgataaggatgagagactttaaagtgacaggattaactgaaggtcttgaatatgaattccgagttatggcaatcaatttagcaggtgtgggcaagccaagcctaccatcagagcctgttgtggcactggacccaattgatcctcctggaaaacctgaggttattaacataacaaggaattcagtgactctcatttggactgaacctaaatatgacggtggtcataagttaactggatatatagtggagaagcgagatctaccttcgaagtcttggatgaaagccaaccatgttaatgtcccagaatgtgcctttactgtaactgaccttgttgagggtggaaaatatgaattcagaattagagcaaagaatacagcaggtgctatcagtgctccatcagaaagtacagaaaccattatttgcaaggatgaatacgaggcaccaacaattgtccttgatcccacaataaaagatgggctaacaattaaagcaggggataccattgttttgaatgccattagcattcttggcaaaccccttccaaaatcaagttggtccaaggcaggaaaagacattagaccatcagatatcactcagataacttcaaccccaacatcttccatgcttactatcaagtatgccactagaaaagatgcgggtgaatataccatcactgctaccaatccttttggcacgaaggtggaacatgtgaaggtaacagtccttgatgtacctggtcccccaggtcctgttgaaatcagtaatgtttctgctgaaaaagcaacacttacatggacacctcccttggaagatggcggctcaccaattaagtcctatatacttgaaaagagagaaaccagccgacttttgtggacagtggtttctgaagatattcagtcttgcaggcatgtggcaaccaaacttatccaaggaaatgagtacatcttccgggtctcagctgtaaaccactatggcaaaggagaacctgtacagtctgaacctgtcaaaatggtagacagatttggtccccctggccctcctgaaaaaccagaggtatcaaatgtcactaagaacactgccactgtcagctggaaaaggccagtggatgatggtggcagcgaaattacaggatatcatgtagaaaggagagaaaagaaaagcctgcgatgggtgagagcaataaaaacaccagtttccgatctcaggtgcaaagtaacaggactgcaagaaggaagcacctacgaattccgtgtcagtgcagaaaacagagcaggaattggtccacccagtgaggcttcagattctgttctgatgaaagatgcagcatatcctccaggaccaccttcaaatccgcatgtcactgatactaccaagaaatctgcttctttggcatggggcaagcctcattatgatggtggacttgaaatcactggctatgtcgtggagcatcaaaaagtaggagacgaggcctggataaaagataccacaggaaccgccctcagaatcactcagttcgttgttcctgatcttcagactaaagaaaaatacaacttcagaatcagtgccatcaacgatgcaggtgttggggagccagcggtgattccagatgttgaaatcgtagaacgggagatggctcctgattttgaactagatgccgagcttcgaagaacacttgttgttagagcaggactcagtattaggatatttgtgccaattaaaggtcgtcctgctcctgaagtgacatggaccaaagataacatcaacctgaaaaaccgagccaacattgaaaatacggaatcatttactcttctgattatcccagaatgtaacagatatgataccggtaaatttgtcatgaccattgaaaacccggctgggaagaaaagtggctttgtgaacgtcagagtcttggacacgccaggcccagtcctcaacctgcggcctacagacatcacaaaggacagtgtcaccctgcactgggacctccctctgatagatggaggctcacgtataacaaactacattgtagagaaacgtgaagcaacacggaaatcttattccacagccaccactaagtgccataaatgcacatataaagttaccggcttgtctgaagggtgtgaatatttcttcagagtgatggcagagaatgaatatggaattggtgagccaacagaaactacagagcccgtaaaagcctctgaagcaccatctccaccagacagccttaacatcatggacataactaagagcaccgtcagcctggcatggcctaagcccaaacacgatggtggcagcaagatcactggctatgtgattgaagcccaaagaaaaggctctgaccagtggacccacatcacaaccgtgaaagggttagaatgtgttgtgaggaatctaactgaaggagaggaatataccttccaagtgatggcagtgaacagcgcggggagaagtgcccctagagaaagcagacccgtcattgtcaaggagcagacaatgcttccagagctggatctccgtggcatctatcagaaactggtcattgccaaagctggtgacaacatcaaagttgaaattccagtgctcggtcgaccgaagcccacagtgacatggaaaaaaggagaccaaattcttaaacagacacagagagttaattttgaaaccacagcgacttcaaccattttaaatatcaatgagtgtgtcagaagtgatagtgggccctatccattaacagcaaggaacattgtaggagaggttggtgatgtcatcaccattcaagtccatgatatcccagggccacctactggaccaatcaaatttgatgaagtttcatctgattttgtaaccttctcttgggacccacctgagaacgatggtggtgtaccaataagcaactatgtagtggaaatgcggcagactgacagtactacctgggttgagttagcaaccaccgttatacgtactacctataaagccacccgccttactactggattagagtatcagttccgtgtaaaagctcagaatagatatggagttggaccaggcatcacatcagcatgcatagttgccaactatccatttaaggttcctggacctcctggtacccctcaggtaactgcagttaccaaggattcaatgacaattagctggcatgagccactttctgatggtggaagccccattttaggatatcatgttgaaagaaaagaacgaaatggtattctctggcagactgtgagcaaagctttagtaccaggcaacattttcaaatcaagtggacttacagatggtattgcttatgagttccgggtgattgcagaaaacatggcaggcaaaagtaagccaagcaagccatcagaacctatgttggctctggatcccattgacccacctggaaaaccagtacctctaaatattacaagacacacagtaacacttaaatgggctaagcctgaatatactgggggctttaaaattaccagttatatcgttgaaaagagagaccttcctaatggacggtggctgaaggccaacttcagcaacattttggagaatgaatttacagtcagtggcctaacagaagatgctgcatatgaattccgtgtgatcgccaaaaatgctgcaggtgccatcagtccaccatctgagccatctgatgctatcacttgcagggatgatgttgaggcaccaaagataaaggtggatgttaaatttaaggacacggttatattaaaagcaggtgaagcattcagactggaagctgatgtttcaggccgcccacctccaacaatggaatggagcaaagatggaaaagagctggaaggcacagcaaagttagaaataaaaattgcagatttctctactaatctggtaaacaaagattcaacaagaagggatagtggtgcctatacccttacagcgactaatcctggtggctttgctaaacacattttcaatgtcaaagttcttgacagaccaggcccacctgaaggacctttggctgtaactgaagtgacatcagaaaagtgtgtactatcatggttccctccactggatgatggaggtgccaaaattgatcattacatagtacagaaacgtgaaaccagcagattggcatggacaaatgtagcctcagaagtccaagtaacaaagctaaaggtcactaaactcttgaaaggcaatgaatacatattccgtgtcatggctgtaaataaatatggagtgggagagccactggaatcagagcctgtgcttgcagtgaatccttatggaccccctgatccgcccaaaaaccctgaagtgacaactattactaaagattcgatggttgtctgctggggacatcctgattctgatggtggaagtgaaatcatcaattatattgtggaacggcgtgataaagctggccaacgctggattaaatgcaacaaaaaaactcttactgatttaagatataaagtgtctggactgacagaaggacatgaatatgagttcaggattatggctgaaaatgctgctggaattagtgcaccaagtcctaccagtccattttacaaggcttgtgacactgtgtttaaacctggaccaccaggtaacccacgtgttctggatacaagcagatcatccatttcaatcgcttggaataaacctatctatgatggtggttcagaaatcactgggtatatggttgagattgccctgccagaggaagatgaatggcagattgtcactccaccagcaggactcaaggcaacttcgtatactatcactggcctcacagagaatcaggaatataagatccgcatctatgccatgaattccgaaggacttggggaacctgcccttgttcctggaactccaaaggctgaagacagaatgctgcctccagaaattgaactggatgctgacctgcgcaaagttgttactataagggcctgctgcaccctgagactttttgttcccatcaaaggaaggcctgcacctgaggtgaagtgggcccgggaccatggagaatctttagataaagctagcatcgaatccacaagctcttacaccctgcttattgttggaaatgtaaacagatttgacagtggcaaatatatactaactgtagaaaatagttcaggcagcaagtctgcatttgtcaatgttagagttctcgatacaccaggccccccacaggatctgaaggtaaaagaggtcactaagacatctgtcacactcacatgggacccacctctccttgatggaggttcaaaaatcaagaactatattgttgaaaagcgggaatcaacaagaaaagcatattcaactgttgcaacaaactgccacaagacttcctggaaggtagaccagcttcaagaaggctgtagctactatttcagggttctcgcagaaaatgaatatggcattgggctgcctgctgaaaccgcagaatctgtgaaagcatcagaacgacctcttcctccaggaaaaataactttgatggatgtcacaagaaatagtgtgtcactctcttgggagaaaccagagcatgatggaggcagccgaattctaggctacattgtggagatgcagaccaaaggcagtgacaaatgggccacgtgtgccacagtcaaggtcactgaagccactatcactggattaattcagggtgaagaatactctttccgtgtttcagctcagaatgaaaagggcatcagtgatcctagacaactgagtgtgccagtgatcgccaaagatcttgtcattccaccagccttcaaactcctgttcaatactttcactgtactggcaggtgaagacctaaaagttgatgttccattcattggccgccctaccccagctgtaacctggcataaagataatgtaccactgaagcagacaactagagtaaatgcagagagcacagaaaataattcactactgacaataaaggacgcctgccgagaagatgttggccattatgtggttaaactgactaactcagctggtgaagctattgaaacccttaatgttatcgttcttgacaaaccagggcctccaactggaccagttaaaatggatgaagtgacagctgatagtattactctttcctggggcccacccaagtatgatggtggaagttctatcaataattacattgttgagaaacgggacacttccacaaccacctggcaaattgtatcagctacagttgcaaggacaacaataaaggcttgcagactgaagactggatgtgaatatcagtttagaattgcagctgaaaacagatatgggaagagtacctacctcaattcagagcctactgtagcccaatatccattcaaagttcctggtcctcctggcactccagttgtcacactgtcctccagggacagcatggaagtacaatggaatgagccaatcagtgatggaggaagtagagtcattggctatcatctagaacgcaaggaaagaaatagcatcctctgggttaagttgaataaaacacctattcctcaaaccaagtttaagacaactggccttgaagaaggtgttgaatatgaatttagagtctctgcagagaacatcgtgggcattggcaagccgagtaaagtatcagaatgttatgtggctcgtgacccatgtgatccaccaggacggccagaggcaatcattgtcacaaggaattctgtgactcttcagtggaagaaacccacctatgacggtggaagcaagatcactggttatattgttgagaagaaagaattacctgagggccgttggatgaaagccagttttacaaatattattgacactcattttgaagtaactggcctagttgaagatcacagatatgagttccgggttatagcccgaaatgccgcaggagtgtttagtgagccttcagaaagcacaggagcaataacagctagagatgaggtagatccaccacgaataagtatggatccaaaatacaaagacacaatcgtggttcatgctggtgaatcattcaaggttgatgcagatatttatggcaaaccaataccaaccattcagtggataaaaggtgatcaggagctttcaaacacagctcgattagaaataaagagcaccgactttgccaccagtctcagtgtaaaagatgcagtacgtgtcgacagtggaaattacatactgaaggccaaaaatgttgcaggagaaagatcagttactgtgaatgtcaaggttcttgacagaccagggccacctgaaggacctgttgttatctcaggagttacagcagaaaaatgcacactagcttggaaacccccacttcaggatggtgggagtgacatcataaattatattgtggaaaggagagaaaccagccgcttagtttggactgtggttgatgccaatgtgcagactctcagctgcaaggttactaagcttcttgaaggcaatgaatatactttccgtataatggcagtaaacaaatatggtgttggtgaacctcttgaatctgagccagtagttgccaagaatccatttgtagtaccagatgcaccaaaagctccagaagtcacaacagtgaccaaggactcaatgattgttgtatgggaaagaccagcatctgatggtggtagtgaaattcttggatatgttcttgagaaacgggataaagaaggcattagatggacaagatgccataagcgtctgattggagagttgcgcctgagagtaactggactcatagaaaatcacgattatgagttcagagtttctgctgagaatgctgctggacttagtgaaccaagccctccttctgcttaccaaaaggcttgtgatcctatttataaaccaggacccccaaacaaccccaaagtcatagacataaccagatcttcagtattcctttcttggagcaaaccaatatatgatggtggctgtgaaattcaaggatacattgttgaaaaatgtgatgtgagtgttggtgaatggacaatgtgcactccaccaacaggaattaataaaacaaacatagaagtagagaagctgttggaaaagcatgaatacaacttccgtatctgtgctattaataaagctggagttggagaacatgctgacgtccctggacctattatagttgaagaaaaattagaagcaccagacattgatcttgacctagaactaaggaaaatcataaatataagggcaggtggctccttaaggttatttgttcctataaaaggtcgtcctacaccagaagttaaatggggaaaggtggatggtgaaatccgagatgcagctataattgatgtcactagcagtttcacctctcttgttcttgacaatgtcaaccgatatgatagtggaaaatatacgcttacattagaaaacagcagtggaacaaagtctgcctttgttactgtgagagttctggacacgccaagtccacctgttaacctgaaagtcacagaaatcaccaaagactcagtatcaattacatgggaacctcctttgttggatgggggatccaaaataaaaaattacattgttgagaaacgtgaagccacaagaaaatcatatgctgctgttgtaactaactgccataagaattcttggaaaatcgatcagctccaagaaggttgcagttattactttagagtcacagctgagaatgagtatggtattggccttcctgcccagactgctgatccaattaaggttgcagaagtgccacaacctcctggaaaaataactgtggatgatgtcaccagaaacagtgtctctctgagttggacaaaacctgaacatgatggtggcagtaaaatcattcagtatattgtggaaatgcaagctaaacacagtgagaaatggtcagagtgtgctcgagtaaagtctcttcaggcagtaattaccaacctaactcaaggggaagaatatctttttagagttgttgctgtaaatgaaaaggggagaagtgatcctcggtcccttgcagttccaatagttgccaaagatctggtaattgagccagatgtaaaacctgcattcagtagttacagtgtacaggttggccaagatttgaaaatagaagtgccaatttctggacgtcctaagccaaccattacctggactaaagatggtctcccactgaagcagaccacaagaatcaatgttaccgattcactggatctcaccacactcagtattaaagaaactcataaggatgatggtggacaatatggaatcacagttgccaatgttgttggtcagaagacagcatccatcgaaattgtaactctagataaacctgatcctccaaaaggacctgttaaatttgatgacgtcagtgctgaaagtattacattatcttggaaccctccattatatacagggggctgccaaatcaccaactacattgttcagaaaagagatacaaccaccacagtatgggatgttgtttctgctactgttgctagaactacactcaaagtgaccaaactgaaaactggtacagaataccaatttagaatatttgccgaaaacagatatggacaaagctttgccttagagtctgatccaattgtagctcaatatccctacaaagaaccaggccctccaggtacaccatttgccacagccatttccaaagactccatggtcatacagtggcatgaaccagtcaacaatggtggaagccccgtcataggttaccacctggagagaaaagaaagaaacagtattttgtggacaaaggtcaacaaaactattattcatgacacccaattcaaagcacagaatcttgaagaaggcattgaatatgaattcagagtgtatgctgaaaatattgttggtgtaggcaaagcaagcaagaattctgaatgctatgtagccagagatccctgtgacccaccaggaaccccagaaccaataatggttaaaagaaatgaaatcactttacagtggaccaaacctgtgtatgatggtggaagtatgattacaggctacattgtagagaaacgtgatttgcctgatggtcgttggatgaaagctagctttacaaatgtcattgaaactcaatttactgtgtcaggtcttactgaagatcaaagatatgaattcagagtcattgcaaagaatgcagctggtgcaataagtaaaccctctgacagtactggaccaataactgccaaggatgaggttgaactcccaagaatttcaatggatccaaaattcagagacacaattgtggtaaatgctggagaaacattcagacttgaggctgatgtccatggaaagcccctacctaccattgagtggttaagaggagataaggaaattgaagaatctgctagatgtgaaataaagaacacagatttcaaggctttacttattgtaaaagatgcaattagaattgatggtgggcagtatattttaagagcttccaatgttgcaggttctaagtcattcccagtaaatgtaaaagtattagatagaccaggacctccagaagggccagtccaggttactggagtcacttctgaaaaatgctctttaacatggtctccaccacttcaagatggtggcagtgacatttctcactatgttgttgaaaagcgagaaaccagtcgacttgcctggactgttgttgcttcagaagttgtgaccaattctctgaaagttaccaaactcttagaaggtaatgaatatgttttccgtataatggctgtcaacaaatatggtgttggagagcctttggaatctgcaccagtactaatgaaaaatccatttgtgcttcctggaccaccaaaaagcttggaagtcacaaatattgccaaagactccatgaccgtctgttggaaccgtccagatagtgatggtggaagtgagattattggttacattgtagagaaaagagacagaagtggcattcgatggataaaatgtaataaacgccgcattacagatttgcgtctaagagtgacaggattaacagaagatcatgagtatgaattcagggtctctgcagaaaatgctgctggagttggggaaccaagtccagctacagtttattataaagcctgtgatcctgtgttcaaacctggcccacctaccaatgcacacattgtagacaccactaaaaattcaatcacacttgcctggggtaaacccatctatgatggcggcagtgagatcttgggatatgtagtagaaatctgtaaagcagatgaagaagaatggcaaatagttactccacagactggcctgagagtcactcgatttgaaatttcaaaactcactgaacaccaagagtataaaatacgagtctgtgccctcaacaaagttggtttaggtgaggctacatcagttcctggtactgtgaaaccagaagataaacttgaagcacctgaacttgaccttgactccgaattaagaaaaggaattgttgtaagagctggtggatctgccagaattcacattccattcaaaggtcgtccaacgcctgagatcacttggtctcgagaggaaggtgaattcacagataaggtccaaattgaaaagggagtaaactatacccaactatcaatagataactgtgatagaaatgatgctggaaaatacattcttaagttggaaaacagcagtggatcaaagtctgcttttgtaactgtgaaagttcttgacactccaggaccaccacagaatttggcagtcaaagaagtgagaaaagattctgccttcctggtatgggagccacccatcattgatggaggggcaaaggtcaagaactatgtgattgacaaacgtgagtcaaccagaaaagcgtatgctaatgtgagtagtaaatgcagcaaaacaagttttaaagtggaaaaccttacagaaggagccatttattacttcagagtcatggctgaaaatgaatttggagttggtgttccagtggaaactgttgatgccgtgaaagctgctgaacctccttccccaccaggaaaggttacactcactgatgtgtcccagaccagtgcatcacttatgtgggagaaacctgaacatgatggcggtagcagagtcctggggtacgttgttgaaatgcagcccaaaggaactgaaaaatggagcattgtggctgaatccaaagtctgtaatgcagttgttactggtttgagttctggacaagaatatcagttccgtgtcaaggcttataatgagaaaggaaaaagcgatccaagagtgttgggtgttcctgtcatagccaaggacttgactatacagcctagtttaaagttaccatttaacacatatagtatccaagctggagaagatcttaaaatagaaattccagttataggccgaccaagacctaacatttcttgggtcaaagatggtgagcctcttaaacagacaacaagagtaaacgttgaagaaacagctacctcaactgttttgcacattaaagaaggtaacaaagatgactttggaaaatacaccgtaacggcaacaaatagtgcaggcacagcaacagaaaatctcagtgttatcgttttagaaaagcctggacctccagttggcccagttcggtttgatgaagttagtgcagactttgtagtcatatcttgggaacctccagcctatactggtggctgccaaataagcaactacattgtagagaagcgagatacaaccaccaccacttggcacatggtatcagcaacagttgcaagaacaacaattaaaataaccaaactgaaaacaggcacggagtaccagtttagaatttttgctgaaaacaggtatggaaaaagtgccccactggattctaaggcagttattgtacaatatccatttaaagaacctggaccacctggaactccttttgtgacatcaatctcaaaagatcagatgcttgtgcaatggcatgagccagtgaatgatggaggcaccaaaattattggctaccatcttgaacagaaagaaaagaacagtattttatgggtcaagttaaataagacccccattcaggacaccaaattcaaaacaactgggcttgatgagggccttgagtatgagttcaaagtttctgctgaaaatattgttggcattggcaagcctagcaaagtgtcagaatgctttgttgctcgtgatccatgtgacccacctggtcgccctgaagccattgttattacaagaaacaatgtcacactgaaatggaagaaacctgcctatgatggtggtagcaaaataacaggttatattgtagaaaagaaagatctacctgatggccgctggatgaaagccagctttaccaacgtattagaaactgaatttacagtgagtggacttgtagaagaccaaagatatgaatttagagtaattgcaagaaatgcagctggaaactttagtgaaccatctgatagtagtggtgccattactgcaagagatgaaattgatgcaccaaatgcctctctggatccaaaatataaagatgtcatcgttgttcatgcaggagagacttttgttcttgaagccgacatccgtggcaaacctatacctgatgttgtttggtcaaaagatggaaaagaacttgaagaaacagctgctagaatggaaattaaatctactattcagaaaacaactcttgttgtcaaagactgtatacggactgatggaggacaatatattctgaaactcagcaatgttggtggtacaaagtctatacccatcactgtaaaggtacttgacaggccagggcctcctgaagggcctctgaaagttactggagttactgcggaaaaatgttacctggcatggaacccacctttgcaagatggtggtgctaatatttcacattacatcattgaaaagagggagacaagccgactctcttggacccaggtttcaactgaggtacaggcccttaactacaaagttactaaacttcttcctggtaatgagtacattttccgtgtcatggctgtgaataaatatggaattggagagcccttggaatctgggcctgttacggcctgtaatccttataagccaccaggtcctccctcaacacctgaagtctcagcaatcaccaaagattctatggtagtaacatgggcacgcccagtagacgacggaggtaccgaaattgagggctacattcttgaaaaacgagataaggaaggcgttagatggaccaagtgcaacaagaaaacattaacggatctgcggctcagggtaactggtcttaccgaaggccattcctatgaattcagagttgctgctgaaaatgcagctggtgtgggagaacctagtgagccatctgttttctaccgtgcgtgtgatgccttgtatccaccaggtcccccaagcaatccaaaagtgacggacacttccagatcttctgtctccctggcatggagtaagccaatttatgatggtggcgcacctgttaaaggctatgttgtagaggtcaaagaagctgctgcggatgaatggacaacctgcactccaccaacaggattacaaggaaagcagttcacagtgaccaagcttaaagaaaacactgaatataacttccgtatttgtgccatcaattctgaaggtgtaggtgaacctgcaactctacctggctcagtggttgctcaggagaggatagagccaccagaaatagaactcgatgctgatctcagaaaggtggtcgttctgcgtgcaagtgctactttacgcttatttgtcactatcaaaggtcgaccagaacccgaagttaaatgggaaaaggcagaaggcattctcactgacagggctcagatagaggtgaccagctcatttacaatgttggtgattgataatgttaccagatttgacagtggtcggtataatctgacattagaaaataatagtggctccaaaacagcttttgttaacgtcagagttcttgactcaccaagtgcccctgtgaatttgaccataagagaagtgaagaaagactcagtgacgttgtcctgggaaccaccacttattgatggtggagctaagattacaaactacattgtcgaaaaacgagaaactacaagaaaagcctatgctaccattacaaataattgcactaaaactactttcagaattgaaaatctacaagaaggatgttcttactacttccgagtcttggcttccaatgaatatgggattggtttgccagctgaaacaacagaacccgttaaagtgtctgaaccacccctcccacctggaagagtaactcttgttgatgtgacccgtaatacagctacaattaagtgggagaaaccagaaagtgatggtggcagcaaaattactggttatgtggttgaaatgcagactaaagggagtgaaaagtggagcacctgcacacaagttaagactctagaagcaactatatctggcttaactgcaggagaagagtatgtcttcagggtagctgcagttaacgaaaagggaagaagtgatccaagacaacttggagtgccagtaattgcaagggatattgaaataaagccttcagttgagcttcctttccatactttcaatgtaaaggctagagaacaacttaagattgatgtgccattcaaaggaagacctcaagctactgtgaactggagaaaagatggtcagactcttaaagagacaactagagtcaatgtttcttcttcaaagactgtaacatcactatctattaaggaagcttcaaaggaagatgttggaacttatgaattatgtgtttcaaacagtgctggatccataacagttcctattactataattgtccttgacagaccaggacctccaggtcctatacgtattgatgaggttagttgtgacagcataaccatttcttggaatcctccagaatatgatggtggctgccaaattagcaattacattgttgaaaagaaagaaaccacctctacaacatggcacatagtttcacaagcagttgcaagaacatccattaaaatagttcgcctgacaacaggaagtgagtatcagttccgtgtttgtgcagaaaaccgctatggaaagagctcctacagtgaatcttcagctgttgttgcagagtatccattcagtcccccaggtcctcctggtactcctaaagttgtgcatgccacaaaatctaccatgcttgtaacctggcaagtgccagttaatgatggaggaagtcgagtaattggctatcatcttgagtataaagaaagaagcagcattctttggtcaaaagcaaataaaatcctcattgctgatactcaaatgaaagtctccggccttgatgaaggactgatgtatgagtatcgtgtatatgctgaaaatattgctggaattggtaaatgcagtaaatcttgtgaaccagtccctgcaagagatccttgtgaccctcctggacaacctgaagtcacaaatatcacaagaaaatcagtgtcacttaaatggtctaaaccacattatgatggtggagctaagatcacaggatacattgttgaacgcagagaactaccagatggccggtggctgaagtgcaattatactaatatacaagaaacatactttgaagtaactgaacttactgaagatcagcgttatgaattccgggtttttgcaaggaatgctgctgactcagttagtgagccatctgaatccactgggcctattatagttaaagatgatgttgagcctccaagagttatgatggatgtcaagttccgagacgttattgttgtcaaagctggagaggtccttaagataaatgcagacattgcagggcgacctctgccagtaatttcctgggccaaggatggtatagaaattgaagaaagagcaagaacagaaatcatctcaacagacaatcatactttgttaacagttaaagactgtataagacgagacactgggcaatatgtactaacactgaagaatgttgccggcactcggtctgtggccgttaattgcaaagtacttgataagcctggtccaccagcaggaccacttgaaataaatggcctcactgctgagaaatgctctctttcctggggacgtccccaagaagatggtggtgcagatatcgactattacatcgtagaaaaacgtgaaacaagccaccttgcatggacaatatgtgaaggagagttacagatgacatcctgtaaagtaaccaagttactcaaaggcaatgaatatatatttagagtaactggtgttaataaatatggtgttggtgagcccctagagagtgtagctataaaggcactagatccatttacagttccaagtccacccacgtctttggaaattacttctgtgaccaaagaatctatgacactttgctggtcaagacccgagagtgatggaggtagtgaaatatctggatatataattgaaaggcgagagaaaaatagcctaagatgggtgcgtgtaaacaaaaaaccagtttatgatctaagagtgaaatcaacaggacttcgggaaggatgtgaatatgaatatcgtgtttatgcagaaaatgctgctggcctaagtcttccaagtgaaacctctcccttaattagggcagaagatccagtgttcctaccatctcctccatccaaacccaaaattgtggactcaggcaagacaactataactattgcctgggttaagccgctgtttgatggtggggccccgataactggatatactgtagaatacaaaaaatctgatgacactgactggaaaacttccattcagagcttacgagggacagaatatacaataagcggactaacaacaggagctgaatatgttttcagagtaaaatctgtcaataaggttggtgctagtgaccccagtgatagctctgaccctcagatagcaaaggaaagagaagaagaacctttatttgatattgacagtgaaatgaggaagaccttgattgtcaaggctggtgcctcatttaccatgactgtgcctttccgaggaagaccagtacccaatgtcttgtggagtaagccagacactgacctccgtactagagcttatgttgataccacagactctcgtacatcactgaccattgaaaatgccaacagaaatgactctggaaagtacacattaacaattcagaatgttttgagtgctgcttcactgaccttagttgtcaaagttttagataccccaggtcctccaaccaacattactgtgcaagatgtaaccaaagagtctgcagtgttatcctgggatgttcctgaaaacgatggtggagcaccagtgaagaattaccacatagaaaaacgtgaggccagcaagaaagcatgggtctctgtgaccaacaactgtaaccgcctctcctacaaagttaccaatttacaagaaggagctatctattacttcagagtctctggagaaaatgagtttggtgttggtataccagctgaaacaaaggaaggagtaaaaataacagaaaaaccaagcccacctgaaaaacttggagtaacaagtatatccaaagacagtgtttccctgacctggctgaagcctgaacatgatggcggaagcagaattgtacactatgtcgttgaagcactagaaaaaggacagaaaaactgggttaaatgtgcagtggcaaagtcaacccatcacgttgtttccggtctgagagagaattctgaatactttttccgagtgtttgctgaaaatcaagctggcctgagtgacccgagagagcttctgcttcctgttcttattaaggagcaactagaaccacctgaaattgatatgaagaatttcccaagtcacactgtatatgttagagctggttcaaaccttaaagttgacattccaatctctggaaaaccacttcccaaagtgaccttatcaagagatggtgtcccccttaaggcaaccatgagatttaataccgaaattactgctgagaacctgaccatcaatctcaaagaaagtgttacagctgacgctgggagatatgaaatcactgctgccaactccagtggtacaaccaaagctttcattaacattgttgtgctagacaggcctggtcctccaactggccctgttgttattagtgatataactgaagaaagtgtgactctcaaatgggagccacctaagtatgacggtggaagtcaagttaccaactacattctactcaaaagagaaacaagtactgcagtgtggactgaagtgtctgcaacagttgcaagaaccatgatgaaagtcatgaaactgaccacaggagaagaataccaattccgcatcaaggcagaaaaccgctttggcatcagtgatcatatagattcagcttgtgtgactgtcaaactaccatacacaacacctggaccaccatctacaccatgggtcactaatgttactcgagaaagcatcactgtgggctggcatgaaccagtgtcaaatggaggcagtgcagtcgtaggctatcacctggaaatgaaagacagaaacagtattttatggcaaaaagccaacaaactggtcatccgcacaactcacttcaaagtcacaacaatcagtgctggacttatttatgaattcagggtgtatgcagaaaatgctgctggagttggaaaacctagccatccttctgaaccagtcttggcaattgatgcttgtgaacccccaagaaatgttcgtatcactgatatttcaaagaactctgtcagcctttcatggcaacaaccagctttcgatggaggtagcaagattacaggctacattgttgagagacgtgaccttccagatggcagatggaccaaggccagcttcaccaatgttactgaaactcaattcatcatctctggcttgactcagaattcccagtatgaattccgtgtctttgctaggaatgctgttggttccattagcaatccatctgaggttgtagggcccattacttgcatcgattcttatggtggtcctgtaattgatttgcctctagaatatacagaagttgtcaaatacagagcaggtacatctgtgaagctcagagctggcatttctggcaaacctgcgcctactattgagtggtataaagatgataaagaattacaaaccaatgcactggtgtgtgttgaaaataccacggacctcgcatctatactcatcaaagatgccgatcgccttaatagtggatgctatgaattaaaactaaggaatgccatgggctcagcctcagccaccatcagagtacagatccttgacaaaccaggcccacctggtggaccaattgaatttaagactgtaactgctgagaagatcacccttctctggcggcctccagctgatgatggtggtgcaaaaatcactcactacattgtggaaaagcgtgagacaagccgcgttgtgtggtctatggtgtctgaacatttggaagagtgcatcattacaaccaccaaaattatcaaaggaaatgaatacatcttccgggtccgagccgtgaacaaatatggaattggcgagccactggaatctgattccgttgtagccaagaacgcatttgttacacctgggccaccaggcataccagaagtgacaaagattaccaagaattcgatgactgttgtatggagcaggccaattgcagatggcggtagtgatataagtggctatttccttgaaaaacgagacaagaagagcctaggatggtttaaagtactaaaagagactatccgtgacaccagacaaaaagtaacaggactcacagaaaacagtgactatcaatacagagtttgtgctgtaaacgctgctggacagggtccattttctgaaccatctgaattctacaaagctgctgatcctattgatcctccaggtccacctgctaagataagaatcgcagattcaaccaagtcatccatcacccttggctggagtaagcctgtctatgatgggggcagtgctgttactgggtatgttgtcgagataagacaaggagaggaagaggaatggactactgtctctaccaaaggagaggtcagaactacagaatatgtggtatccaacctgaaacctggagtcaattactacttccgggtatctgctgtaaactgtgctggacaaggagaacctatagaaatgaatgaacctgtacaagctaaagatatacttgaggcaccagagattgacctggatgtggctctcagaacttctgttattgccaaagctggtgaagatgtacaagtgttgattccctttaaaggcagacctccacctactgtcacatggagaaaagatgagaagaatcttggcagtgatgccagatacagcattgaaaacactgattcatcctcattactcaccattcctcaagttactcgcaatgatacaggaaaatatattctcacaatagaaaatggagttggtgaacctaagtcttcaactgtgagtgttaaagtgcttgacacaccagctgcctgccagaaactacaggttaaacatgtttctcgaggcacagtcactttgctctgggatcctcctctcattgatggaggatctccaataattaattatgtcattgaaaagagagatgccaccaagagaacatggtctgtcgtgtcacacaaatgttctagcacatccttcaagctaatagatttgtcggagaagactccattcttcttcagagttcttgcagaaaatgaaattggaattggggaaccctgtgaaactacagagccagtgaaggctgctgaagtaccagctcctatacgtgatctctcaatgaaagactcaacaaagacatctgtcatcctcagctggaccaaacctgactttgatggtggtagcgtcatcacagaatatgttgtagaaaggaaaggtaaaggtgaacagacgtggtcccacgctggcataagtaagacatgtgaaattgaggttagccaacttaaggagcagtcagtcctggagttcagagtgtttgccaaaaatgagaaaggactgagtgatcctgtcactattgggccaattacagtgaaagaacttattattacacctgaagttgacctgtcagatatccctggggcacaagtcactgtgagaattgggcacaatgtgcaccttgaattaccttataagggaaaacccaaaccatccatcagttggctgaaagatggcttgccactgaaagaaagtgaatttgttcgcttcagtaaaactgaaaacaaaattactttgagtattaagaatgccaagaaggagcatggaggaaaatacactgttattcttgataatgcagtgtgtagaattgcagtccccattacagtcatcacccttggcccaccatcaaagcccaaaggacccattcgatttgatgaaatcaaggctgatagtgtcatcctgtcatgggatgtacctgaagataatggaggaggagaaattacttgttacagcatcgagaagcgggaaacttcacaaactaactggaagatggtgtgttcaagtgttgccagaacgactttcaaagttcctaatctagtcaaagatgctgagtaccagtttagagtgagagcagaaaacagatacggagtcagccaaccacttgtctcaagcattattgtggcaaaacaccagttcaggattcctggtcccccaggaaagccagttatatacaatgtgacttctgatggcatgtcactaacttgggatgctccagtttatgatggtggttcagaagttactggattccatgttgaaaagaaagaaagaaatagcatcctctggcaaaaagttaatacatcaccaatctctggaagagaatatagagccactggactggtagaaggtctggattaccaattccgtgtatatgctgaaaattctgctggcctaagctcacctagtgacccaagcaaatttaccttagctgtttctccagtagacccacctggcactcctgactacattgatgtcacccgggaaaccatcacacttaaatggaacccaccattgcgtgatggaggcagtaagattgtgggctatagcattgagaaacggcaaggaaatgaacgctgggtgagatgcaactttactgacgtcagtgaatgtcagtacacagttacaggactcagtcctggggatcgctatgagttcagaataattgcaagaaatgctgttggaactataagcccgccctcacagtcttctggcattattatgacaagagatgaaaatgttccaccaatagtagagtttggccctgaatactttgatggtctcattattaagtccggagagagccttagaattaaagctttggtacaaggaagaccagtgcctcgagtaacttggttcaaagatggagtggaaatcgaaaagaggatgaatatggaaataaccgacgtacttggatccaccagcctatttgttagagatgctactcgggaccatcgtggtgtatacacagtggaagccaaaaatgcatctggttctgcaaaagcagaaattaaagtgaaagtacaagatacaccaggaaaagtagttgggccaataagattcaccaatattactggggagaagatgactctgtggtgggatgccccactcaatgacggttgtgctcccataacccactacatcattgaaaaacgggaaaccagcagacttgcctgggcactaattgaggataaatgtgaagcccaaagttacactgccattaaactaataaacggcaatgaataccaattccgtgtttctgcagttaacaagtttggtgttggcaggccacttgattctgatccagtggttgctcaaatacaatatactgttcctgatgcccctggcattccagaacctagcaacataacaggcaacagcattaccctgacatgggcaaggccagaatcagatggtggcagtgaaattcaacagtatatccttgaaagaagagaaaagaaaagcacaagatgggtaaaagtgatcagcaaacgaccaatctctgaaacaagattcaaagtcactggtctgacagaaggcaatgagtatgaattccatgtcatggctgaaaatgctgcaggagttggacctgcaagtggcatctcaagactcattaaatgtagagagcccgtcaacccaccaggtcctcccacagtggtcaaagtaacagacacatcaaagacaactgtgagcttagaatggtccaaaccagtgtttgatggtggcatggaaataattgggtatattattgaaatgtgtaaggccgacttaggagactggcacaaggtgaatgcagaggcatgtgtgaaaacaagatatacagtcactgatctacaagcaggtgaagaatacaaattccgagttagtgctatcaatggtgctggaaaaggcgacagctgtgaagtgactggcacaattaaagcagttgaccggttaacagctcctgagttagacatagatgcaaacttcaaacagactcatgttgttagagctggggccagtattcgcctcttcattgcctaccaaggtagacctactcctacagctgtgtggagcaaaccagactctaaccttagccttcgggctgatatccatacaacagattccttcagcaccctcactgtggaaaactgcaacagaaatgatgcagggaaatatacccttactgtggaaaacaacagtggtagtaagtcaatcacattcaccgtgaaagtgctagacactccaggcccacctggcccaattaccttcaaagatgtgacccggggatctgctacattgatgtgggatgcccctcttcttgacggtggtgcccgaatccatcattatgtggtagagaaacgagaggcaagtcgccgtagttggcaggttatcagtgaaaaatgcactcgtcagatcttcaaggtcaatgacctggccgaaggtgttccgtactatttccgtgtttctgcagtaaatgagtatggtgttggtgagccctatgaaatgccagaaccaattgtagccacagaacagcctgctccacctaggagacttgatgttgttgatactagcaaatcctccgcagtcttagcttggcttaaacctgaccacgatggaggcagccggatcactggctacctgcttgaaatgagacaaaagggatctgacttctgggttgaagctggtcacaccaaacagctaactttcacagtagagcgtcttgttgagaaaactgaatatgaattccgtgtgaaggccaagaatgatgctggctatagtgaacccagagaagccttctcttctgtcatcattaaggagcctcaaatcgagcccactgctgacctcactggaattaccaatcagcttataacttgcaaagcaggaagcccatttaccattgacgtaccaatcagtggtcgtcctgcccccaaagtaacatggaaactggaagaaatgagacttaaagagacagatcgagtgagcattacaacaacaaaagacagaaccacactgactgtaaaggacagcatgagaggtgactctggaagatacttcttgaccctggaaaatacagctggtgttaaaacatttagcgtcacagttgtggtcattggaaggccaggtccagtaaccggccccattgaggtctcatctgtctcagctgaatcgtgtgtcctgtcatggggagaacctaaagatggaggaggcactgaaattactaattacatagttgaaaagcgtgaatcgggtacaacagcttggcagcttgtcaattccagtgtcaagcgcactcaaattaaagtcactcatctcacaaaatacatggaatattctttccgtgtcagttcagagaacagatttggtgtcagcaaacctctagaatcagcaccaataattgctgaacatccatttgtcccaccaagcgctcctaccagacctgaggtctaccatgtgtctgccaatgccatgtctattcgttgggaagaaccctaccacgatggtggcagtaaaatcattggctactgggttgagaagaaagaacgtaatacaattctttgggtgaaagaaaacaaagtgccatgcttagagtgcaactacaaagtaactggtttagtagaaggactggaatatcagttcagaacttatgcactcaatgctgcaggtgttagcaaggccagcgaagcttcaagacctataatggctcaaaatccagttgatgcaccaggcagaccagaggtgacagatgtcacaagatcaacagtatcactgatttggtctgccccagcgtatgatggaggcagcaaggttgtgggctacatcatagagcgtaagccagtcagtgaggtaggagatggtcgctggctgaagtgcaactacaccattgtatctgacaatttcttcaccgtgactgctctcagtgaaggagacacttatgagttccgtgtgttagccaagaatgcagcaggcgtaattagcaaagggtctgaatctacaggccctgtcacttgccgagatgaatacgctccacccaaagccgaactggatgcccgattacacggtgatctggttaccatcagagcaggttctgatcttgttctggatgctgcagttggtggcaaacctgaacccaaaattatctggaccaaaggagacaaggagctagatctctgtgaaaaagtctctttgcagtatactggcaaacgagcaactgctgtgatcaagttctgtgacagaagtgacagtggaaaatacactttaacagtgaaaaatgccagcgggaccaaggccgtgtctgtcatggtcaaagtgcttgattcccctggcccatgtggaaagctcaccgtcagcagagtaacacaggagaagtgcactttagcctggagccttccgcaggaagacggaggagcagaaatcactcactacatcgtggaaagacgcgagactagcaggctcaactgggtgattgttgaaggcgaatgcccaaccctatcctatgtcgttaccaggctcatcaagaacaatgagtacatattccgagtgagggcagtaaacaaatatggccctggtgtgcctgttgaatcagagccaattgtagccagaaactcattcactattccatcaccacccggcatacctgaagaagttgggactggcaaagagcatatcatcattcagtggacaaaacctgaatctgatggtggcaatgaaatcagcaactacctagtagacaaacgtgagaagaagagcctgcgctggacacgtgtcaacaaagactatgtggtgtatgataccaggctgaaggtgaccagcctgatggagggttgtgattaccagttccgggtgaccgcagtgaatgcagctggtaacagtgagcccagcgaagcttccaacttcatctcatgcagagaaccatcatatacccctggaccaccttctgctccaagagttgtggataccaccaaacacagcattagtttggcatggaccaaacccatgtacgatggtggtactgacattgtaggatatgttctggaaatgcaagagaaggacactgatcagtggtaccgagtgcataccaatgccacaataagaaatactgaattcactgtgccagaccttaaaatgggccagaaatattccttcagagttgctgccgtgaacgtgaagggtatgagcgaatacagcgaatcaattgctgaaattgagcccgtggaaagaatagaaataccagatcttgagcttgcagatgatctaaagaagactgtgaccatcagggctggggcctccttgcgcttgatggtgtctgtatctggaagaccacctcctgtcataacgtggagcaagcagggcattgaccttgcaagccgggcaattattgacaccactgagagctactcattgctaatagtggacaaagttaatcggtacgatgctggaaaatacacaattgaagctgaaaaccaatctggcaagaaatcagcaacagtccttgttaaagtctatgatactcctggtccctgtccttcagtgaaagttaaggaagtatcaagagattctgtgactataacttgggaaattcccacgattgatggtggagctccagtcaacaattacatcgttgagaagcgtgaagctgctatgagagcattcaaaacagtaactaccaaatgcagcaagacactttacagaatttctggacttgtagaaggaaccatgtactatttcagagtgctgccagaaaatatttatggcattggagaaccttgtgaaacatctgatgcagtactggtctcagaagtgcctttggtgcctgcaaagctagaagtggtcgatgtcaccaaatccactgttacccttgcctgggaaaaaccactctacgatggtggtagccgactcactggatatgttctcgaggcctgcaaagctggcacagagagatggatgaaggttgtcaccttaaaacccacagtcctagagcacactgttacttccttaaatgaaggtgaacaatacttatttagaataagggcacaaaatgagaaaggtgtgtcagaaccaagagagactgtcacagccgtgactgtacaagacctcagagtgttgccaacaatcgatctttctacaatgcctcagaagaccatccatgtcccagctggcagaccagtagagctggtgatacctattgctggccgtccacctcctgctgcttcctggttctttgctggttctaaactgagagaatcagagcgtgtcacagttgaaactcacactaaagtagctaaattaaccatccgtgaaaccactatcagagatactggagaatacacacttgaattgaagaatgttaccggaactacttcagaaaccattaaagttatcattcttgacaagcctggtccaccaacaggacctattaagattgatgaaattgatgctacatcaattaccatttcctgggaaccacctgaattggacggtggtgctccactgagtggttatgtggtagaacaacgtgacgctcatcgtccaggatggctgcccgtttctgaatcagtgactaggtccacgtttaagtttaccagactcaccgaaggaaatgagtatgtgttccgtgtggctgcaacaaaccgcttcgggattggctcttacttgcagtctgaggtcatagagtgtcgcagcagcatccgtattcctggacccccagaaacattacagatatttgatgtttcccgtgatggcatgacacttacttggtacccaccagaggatgacggtggctcccaagtgactggatatattgtggagcgcaaagaagtgagagcagatcgatgggtccgtgtaaataaagtacctgtgacaatgacacggtaccgctccactggccttactgaaggcttagaatatgaacaccgtgtcacagccattaatgcaagagggtctgggaaaccaagtcgtccttccaaacccatcgttgccatggatccaattgctcctccaggaaagccacaaaacccaagagttactgatacaacaaggacatcagtctccctggcctggagtgttccagaagatgaaggaggatctaaagtcacaggctacttgattgaaatgcaaaaagtagatcaacatgaatggaccaagtgtaacaccactccaaccaagattcgagagtatactctaacacacctacctcagggtgcagaatacaggttccgcgtcctagcttgtaatgctggtggacctggtgagcctgctgaggtaccaggaacagtcaaagtcactgaaatgcttgaatatcctgattatgaacttgatgaaagataccaagaaggtatctttgtaaggcaaggtggcgtcatcagacttaccataccaatcaaaggaaaaccattcccaatatgtaaatggaccaaggaaggccaggatattagtaagcgtgccatgattgcaacatctgaaacacacactgagcttgtgatcaaagaagcagacaggggtgattctggcacttatgacctggttctggaaaataaatgtggcaagaaggctgtctacatcaaggtcagggtgataggaagtcccaacagtccagaagggccactggaatatgatgacatccaagtccgctctgtgagggtcagctggagacctcctgctgatgatggtggtgctgacatcttaggctacatcctcgagagacgagaagtgcctaaagccgcctggtataccattgattccagagtccgaggtacatctctggtggtaaaaggcctcaaagagaatgtagaataccatttccgtgtttcagcagaaaaccagtttggcataagcaaacccttgaaatctgaggaaccagtcacaccaaaaacaccattgaatcctccagaacctccaagcaatcctccagaagtactcgatgtaaccaagagttctgttagcttgtcctggtcccggcccaaagatgatggtggttctagagtcacaggctactacatcgaacgcaaagagacatccactgacaagtgggtcagacacaacaagactcagatcaccaccacaatgtacactgtcacagggcttgttcccgatgctgagtatcagttccgcatcatcgcacagaatgatgttggcctgagtgagaccagccctgcttctgaaccagttgtttgcaaagatccatttgataaaccaagccaaccaggagaacttgagattctttcaatatccaaagatagtgtcactctacagtgggagaaacctgaatgtgatggtggtaaagaaattcttggatactgggttgaatatagacagtctggagacagtgcctggaagaagagcaataaggaacgtattaaggacaagcaattcacaataggaggtttgctggaagctactgagtatgaattcagggtttttgctgagaatgagactgggctgagcagacctcgcagaactgctatgtctataaagactaaactcacatctggagaggccccaggaatacgcaaagaaatgaaggatgttaccacaaaattgggtgaagctgctcaactctcatgccagattgttggaaggcctcttcctgacattaaatggtacagatttggtaaagagctcatacaaagccggaaatacaaaatgtcttcagatggacgcacacacactcttacagtaatgacagaggaacaggaagatgaaggtgtttatacctgcatagccaccaatgaggttggagaagtagaaaccagtagtaagcttctcctgcaagcaacaccgcagttccatcctggttacccactgaaagagaaatattatggagctgtgggttccacacttcggcttcatgttatgtacattggtcgtccagtacctgccatgacttggttccatggtcagaaacttttgcaaaactcagaaaacattactattgaaaacactgagcactatactcatcttgtcatgaagaatgtccaacgtaagactcatgctgggaaatacaaagtccagctcagcaatgtttttggaacagttgatgccatccttgatgtggaaatacaagataaaccagacaaacctacaggaccaattgtgatcgaagctctattgaagaactccgcagtgatcagctggaaaccacccgcagatgacggaggctcctggatcaccaactatgtggtggaaaaatgtgaggccaaggagggggctgaatggcaattggtgtcttcagccatctcagtgacaacctgtagaattgtgaacctcacagaaaatgctggctattacttccgggtttcagctcagaacactttcggcatcagtgaccctctagaagtgtcctcagttgtgatcattaagagtccatttgaaaagccaggtgctcctggcaaaccaactattactgctgtcacaaaagattcttgtgttgtggcctggaagccacctgccagtgatggaggtgcaaagattagaaattactaccttgagaagcgtgagaagaagcagaataaatggatttctgtgacaacagaagaaattcgagaaactgtcttttcagtgaaaaaccttattgaaggtcttgaatacgagtttcgtgtgaaatgtgaaaatctaggtggggaaagtgaatggagtgaaatatcagaacccatcactcccaaatctgatgtcccaattcaggcaccacactttaaagaggaactgagaaatctaaatgtcagatatcagagcaatgctaccttggtctgcaaagtgactggtcatccaaaacctatcgtcaaatggtacagacaaggcaaagaaatcattgcagatggattaaaatataggattcaagaatttaagggtggctaccaccagctcatcattgcaagtgtcacagatgatgatgccacagtttaccaagtcagagctaccaaccaagggggatctgtgtctggcactgcctccttggaagtggaagttccagctaagatacacttacctaaaactcttgaaggcatgggagcagttcatgctctccgaggtgaagtggtcagcatcaagattcctttcagtggcaaaccagatcctgtgatcacctggcagaaaggacaagatctcattgacaataatggccactaccaagttattgtcacaagatccttcacatcacttgttttccccaatggggtagagagaaaagatgctggtttctatgtggtctgtgctaaaaacagatttggaattgatcagaagacagttgaactggatgtggctgatgttcctgacccacccagaggagtcaaagttagtgatgtctcacgagattctgtcaacttaacatggactgagccagcctctgatggtggcagcaaaatcaccaactacattgttgaaaaatgtgcaactactgcagaaagatggctccgtgtaggacaggcccgagaaacacgttataccgtgatcaacttatttggaaaaacaagttaccagttccgggtaatagctgaaaataaatttggtctgagcaagccttcagagccttcagaaccaaccataaccaaagaagataagaccagagctatgaactatgatgaagaggtagatgaaaccagggaagtctccatgactaaagcatctcactcttcaaccaaggaactctatgagaaatatatgattgctgaagatcttgggcgtggtgagtttggaattgtccatcgttgtgttgaaacatcctcaaagaagacatacatggccaaatttgttaaagtcaaagggactgatcaggttttggtaaagaaggaaatttccattctgaatattgctaggcatagaaacatcttacacctccatgaatcatttgaaagcatggaagaattagttatgatctttgagtttatatcaggacttgacatatttgagcgcattaacacaagtgcttttgaacttaatgaaagagaaattgtaagttatgttcaccaggtctgtgaagcacttcagtttttacacagtcataatattggacactttgacattagaccagaaaatatcatttaccaaaccagaagaagctctaccattaaaatcatagaatttggtcaagcccgtcagctgaaaccaggggacaacttcaggcttctattcactgccccagaatactatgcacctgaagtccaccagcatgatgttgtcagcacagccacagacatgtggtcacttggaacactggtatatgtgctattgagtggtatcaacccattcctggctgaaactaaccaacagatcattgagaatatcatgaatgctgaatatactttcgatgaggaagcattcaaagagattagcattgaagccatggattttgttgaccggttgttagtgaaagagaggaaatctcgcatgacagcatcggaggctctccagcacccatggttgaagcagaagatagaaagagtcagtactaaagttatcagaacattaaaacaccggcgttattaccacaccctgatcaagaaagacctcaacatggttgtgtcagcagcccggatctcctgtggtggtgcaattcgatctcagaagggagtgagtgttgctaaagttaaagtggcatccattgaaattggcccagtttctgggcagataatgcatgcagttggtgaagaaggaggacatgtcaaatatgtatgcaaaattgaaaattatgatcagtctacccaagtgacttggtactttggcgtccgacagctggagaacagtgagaaatacgaaatcacctacgaagatggagtggccatcctctatgtcaaagacattaccaaattagatgatggtacctacagatgcaaagtagtcaatgactatggtgaagacagttcttatgcagagctatttgttaaaggtgtgagagaagtctatgactattactgccgtagaaccatgaagaaaattaagcgcagaacagacacaatgagactcctggaaaggccaccagaatttaccctgcctctctataataagacagcttatgtaggtgaaaatgtccggtttggagtaactataactgtccacccagagcctcatgtaacatggtataaatcaggtcagaaaatcaaaccaggtgacaatgacaagaagtacacatttgagtcagacaagggtctttaccaattaacaatcaacagtgtcactacagatgatgacgctgaatatactgttgtggcaaggaacaaatatggtgaagacagctgtaaagcaaagctgacagtaaccctacacccacctccaacagatagtaccttaagacccatgttcaaaaggttactggcaaatgcagaatgccaagaaggccaaagtgtctgctttgagatcagagtgtctggcatccccccaccaacattaaaatgggagaaagatggtcagccactgtccctcgggcctaacattgaaattatccatgaaggcttggattattatgctctgcacatcagggacactttgcctgaagacacgggttattatagagtcacagccactaacacagctgggtccaccagctgccaggctcacctacaagtggaacgcctgaggtacaagaaacaggaattcaagagtaaggaggagcatgagcgacacgtacaaaaacaaattgacaaaaccctcagaatggctgaaattctttctggaactgaaagtgtaccactgacacaggtagctaaagaggctctgagagaagctgctgtcctttataaaccggctgtaagcaccaagactgtaaaaggggaattcagacttgagatagaagaaaagaaggaggagagaaaactccggatgccttatgatgtaccagagccacgcaagtataagcagactaccatagaagaagaccaacgcatcaagcagttcgtgcccatgtctgacatgaagtggtataaaaagatacgtgatcagtatgaaatgcctgggaaacttgacagagttgtacagaaacgacccaagcgcatccgcctttcaagatgggaacagttctatgtgatgcctcttccacgcattacagatcaatacagacctaaatggcgtattcctaaactgtcccaagatgatcttgagatagtgagaccagcccgccggcgtacaccttctcctgattatgacttttactaccgacctagaagacgttctcttggggacatctctgatgaagaattactcctccccattgatgactacttagcaatgaaaagaacagaggaagagaggctgcgtcttgaagaagagcttgagttaggtttttcagcttcacccccaagtcgaagccctccacactttgagctttctagcctacgttactcttcaccacaagctcatgtcaaggtggaggaaacaagaaaagacttcaggtattcaacctatcacatcccaacgaaggctgaagctagtacaagttatgcagaactgagggaacggcatgcccaggctgcgtacagacagccaaagcaacggcaaagaatcatggctgagagggaggatgaagagttgcttcgcccagttacgaccacccagcatctctcagaatacaaaagcgaacttgacttcatgtcaaaggaggaaaagtctagaaagaaatcaaggcgacaaagagaagtgacagaaataacagaaattgaggaagaatacgaaatctcaaaacatgctcaaagagaatcatcctcatctgcgtctagactactgagacgacggcgctccctgtctccaacttatattgagttaatgaggccagtgtctgagctgatccggtcacgtccacaaccggctgaggaatacgaagatgacacagaaagaaggtcacctactccagagagaactcgcccacgatcccccagccctgtgtctagtgagagatcactctcgagatttgagaggtctgcaagatttgatatcttttccaggtatgagtccatgaaagctgctttaaaaactcagaagacatcagaaaggaagtatgaagttttgagtcagcagcctttcacactggaccatgcccctcgaatcacactgagaatgcgctcgcacagggtaccatgtggccaaaatacacgttttattttaaatgttcagtctaagccaactgccgaggttaaatggtaccacaatggtgtggaactccaagaaagcagtaagattcattacaccaacacgagtggagtcctcaccctggaaattctggactgtcatactgatgacagtggaacctaccgtgctgtgtgcaccaactacaagggcgaagcttctgactatgcaacgttggacgtgacaggaggggattataccacctatgcttcccaacgcagagatgaagaggtccccagatctgttttccctgagctgacaagaacagaggcgtatgctgtttcatcatttaagaaaacatctgagatggaagcttcgtcttctgtcagggaagtgaaatcacagatgacggagacaagggaaagtctctcctcatatgaacactctgcatctgcagaaatgaaaagtgctgcattagaagaaaagtcactggaagaaaaatccacaaccagaaagatcaagacgactttggcagcaagaattctaacaaagccacggtccatgaccgtctacgagggcgagtctgcaaggttttcttgtgacaccgatggtgagccggtaccaactgtgacctggctgcgtaaaggacaagtgctaagtacttctgcccgccaccaagtgaccaccacaaagtacaaatcaacctttgagatctcttcagtccaggcttccgatgagggcaattacagcgtggtggtagaaaacagtgaagggaaacaagaagcagagttcactctgactattcaaaaggccagggtaactgaaaaggctgtgacatcaccaccaagagtcaaatccccagagcctcgggtgaaatccccagaagcagttaagtctccaaaacgagtgaaatctccagaaccttctcacccgaaagccgtatcacccacagagacaaaaccaacaccaacagagaaagttcagcacctcccagtctctgccccaccaaagattactcagttcctgaaagcagaagcttctaaagagattgcaaaactgacctgtgtggttgaaagcagtgtattaagggcaaaagaggtcacctggtataaagatggcaagaaactgaaggaaaatgggcatttccagtttcattattcagcagatggtacctatgagctcaaaatcaataacctcactgaatctgatcaaggagaatatgtttgtgagatttctggtgaaggtggaacgtctaaaaccaacttacaatttatggggcaagcctttaagagtatccatgagaaggtatcaaaaatatcagaaactaagaaatcagatcagaaaaccactgagtcaacagtaaccagaaaaactgaaccaaaagctcctgaaccaatttcctcaaaaccagtaattgttactgggttgcaggatacaactgtttcttcagacagtgttgctaaatttgcagttaaggctactggagaaccccggccaactgccatctggacaaaagatggaaaggccattacacaaggaggtaaatataaactctctgaagacaagggagggttcttcttagaaattcataagactgatacttctgacagtggactttatacttgtacagtaaaaaattcagctggatctgtgtcctctagctgcaaattaacaataaaagctataaaagatactgaggcacagaaagtctctacacaaaagacttctgaaattacacctcagaagaaagctgttgtccaagaggaaatttcccaaaaagccctaaggtctgaagaaattaagatgtcagaggcaaaatctcaagaaaagttagccctcaaagaggaagcttcaaaggttctgatttctgaagaagtcaagaaatcagcagcaacctccctggaaaaatccattgtccatgaggaaatcactaaaacatcacaggcatcagaagaagtcagaactcatgctgagattaaagcattttctactcagatgagcataaacgaaggtcaaagactggttttaaaagccaacattgctggtgccactgatgtgaaatgggtactgaatggcgtagagcttaccaactctgaggagtaccgatatggtgtctcaggcagcgatcagaccctaaccatcaagcaagccagtcacagagatgaaggaatcctcacctgcataagcaaaaccaaggaaggaatcgtcaagtgtcagtatgatttgacactgagcaaagaactctcagatgctccagccttcatctcacagcctagatctcaaaatattaatgaaggacaaaatgttctctttacttgtgaaatcagtggcgagccatcccctgaaatcgaatggtttaaaaacaacctgccaatttctatttcttcaaatgtcagcataagccgctccagaaatgtatactcccttgaaatccgaaatgcatcagtcagcgacagtggaaagtacacaattaaggccaaaaatttccgtggccagtgttcagctacagcttccttaatggtccttcctctagttgaagaaccttccagagaggtagtattgagaacaagtggtgacacaagcttgcaaggaagcttctcgtctcagtcagtccaaatgtctgcctccaagcaggaggcctccttcagcagtttcagcagcagcagtgctagcagcatgactgagatgaaatttgcaagcatgtctgcccaaagcatgtcctccatgcaagagtcctttgtagaaatgagttccagcagctttatgggaatatctaatatgacacaactggaaagctcaactagtaaaatgcttaaagcaggcataagaggaattccgcctaaaattgaagctcttccatctgatatcagcattgatgaaggcaaagttctaacagtagcctgtgctttcacgggtgagcctaccccagaagtaacatggtcctgtggtggaagaaaaatccacagtcaagaacaggggaggttccacattgaaaacacagatgacctgacaaccctgatcatcatggacgtacagaaacaagatggtggactttataccctgagtttagggaatgaatttggatctgactctgccactgtgaatatacatattcgatccatttaagagggcctgtgcccttatactctacactcattcttaacttttcgcaaacgtttcacacggactaatctttctgaactgtaaatatttaaagaaaaaaaagtagttttgtatcaacctaaatgagtcaaagttcaaaaatattcatttcaatcttttcataattgttgacctaagaatataatacatttgctagtgacatgtacatactgtatatagccggattaacggttataaagttttgtaccatttattttatgacattttacaatgtaagttttgaaactaactgttggtaggagaaagtttcttatggaacgaataccctgctcaacatttaatcaatctttgtgcctcaacatactgttgatgtctaagtatgcctcagtgggttgagaaaatccccattgaagatgtcctgtccacctaaaagagaatgatgctgtgcatatcacttgatatgtgcaccaatacctactgaatcagaaatgtaaggcattggtgatgtttgcatttaccctcctgtaagcaacactttaacgtcttacattttctctgatgatgtcacacaaaattatcatgacaaatattaccagagcaaagtgtaacggccaacactttgttcgctcattttacgctgtctctgacataaggagtgcctgaatagcttggaaaagtaacatctcctggccatcccttcatttaaccaagctattcaagtattcctatgccagagcagtgccaactcttggaggtcccagagtgcagccaatgcctttgtgtggtagttctaaattttaattgcacctgaaaaacctgggcacctaagcaatgagccacagcaaaaagtaaagaacaacaacaaaataaagctgttgttaaattttaaacaatattactaattgcccaaaatgtcaatttgatgtagttcttttcatgcaagtataaattcaattgttagttataattgttggacctccttgagatagtaacaacaaaataaagcaagctatctgcacctcaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:7273 -> Molecular function: GO:0002020 [protease binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0003676 [nucleic acid binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0004713 [protein tyrosine kinase activity] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0005509 [calcium ion binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0005516 [calmodulin binding] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0005524 [ATP binding] evidence: IEA
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: IMP
            GeneID:7273 -> Molecular function: GO:0008307 [structural constituent of muscle] evidence: TAS
            GeneID:7273 -> Molecular function: GO:0019899 [enzyme binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0031433 [telethonin binding] evidence: ISS
            GeneID:7273 -> Molecular function: GO:0042802 [identical protein binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0042805 [actinin binding] evidence: IPI
            GeneID:7273 -> Molecular function: GO:0043621 [protein self-association] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051015 [actin filament binding] evidence: IDA
            GeneID:7273 -> Molecular function: GO:0051371 [muscle alpha-actinin binding] evidence: IPI
            GeneID:7273 -> Biological process: GO:0001701 [in utero embryonic development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0002576 [platelet degranulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0003300 [cardiac muscle hypertrophy] evidence: IMP
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: NAS
            GeneID:7273 -> Biological process: GO:0006936 [muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0006941 [striated muscle contraction] evidence: TAS
            GeneID:7273 -> Biological process: GO:0007076 [mitotic chromosome condensation] evidence: IEP
            GeneID:7273 -> Biological process: GO:0007512 [adult heart development] evidence: IEA
            GeneID:7273 -> Biological process: GO:0007596 [blood coagulation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030049 [muscle filament sliding] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030168 [platelet activation] evidence: TAS
            GeneID:7273 -> Biological process: GO:0030240 [skeletal muscle thin filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0030241 [skeletal muscle myosin thick filament assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0035995 [detection of muscle stretch] evidence: TAS
            GeneID:7273 -> Biological process: GO:0043056 [forward locomotion] evidence: IEA
            GeneID:7273 -> Biological process: GO:0045214 [sarcomere organization] evidence: IMP
            GeneID:7273 -> Biological process: GO:0045859 [regulation of protein kinase activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048739 [cardiac muscle fiber development] evidence: IMP
            GeneID:7273 -> Biological process: GO:0048769 [sarcomerogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0050790 [regulation of catalytic activity] evidence: IMP
            GeneID:7273 -> Biological process: GO:0051592 [response to calcium ion] evidence: IDA
            GeneID:7273 -> Biological process: GO:0055003 [cardiac myofibril assembly] evidence: IMP
            GeneID:7273 -> Biological process: GO:0055008 [cardiac muscle tissue morphogenesis] evidence: IMP
            GeneID:7273 -> Biological process: GO:0060048 [cardiac muscle contraction] evidence: IMP
            GeneID:7273 -> Cellular component: GO:0000794 [condensed nuclear chromosome] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005576 [extracellular region] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005794 [Golgi apparatus] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0005829 [cytosol] evidence: TAS
            GeneID:7273 -> Cellular component: GO:0005865 [striated muscle thin filament] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0030018 [Z disc] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IDA
            GeneID:7273 -> Cellular component: GO:0031430 [M band] evidence: IEA
            GeneID:7273 -> Cellular component: GO:0031674 [I band] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_596869 -> EC 2.7.11.1

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.