2024-03-28 22:48:45, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_130804 3051 bp mRNA linear PRI 12-MAY-2013 DEFINITION Homo sapiens multiple endocrine neoplasia I (MEN1), transcript variant e1F1, mRNA. ACCESSION NM_130804 VERSION NM_130804.2 GI:210031781 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 3051) AUTHORS Cuny,T., Pertuit,M., Sahnoun-Fathallah,M., Daly,A., Occhi,G., Odou,M.F., Tabarin,A., Nunes,M.L., Delemer,B., Rohmer,V., Desailloud,R., Kerlan,V., Chabre,O., Sadoul,J.L., Cogne,M., Caron,P., Cortet-Rudelli,C., Lienhardt,A., Raingeard,I., Guedj,A.M., Brue,T., Beckers,A., Weryha,G., Enjalbert,A. and Barlier,A. TITLE Genetic analysis in young patients with sporadic pituitary macroadenomas: besides AIP don't forget MEN1 genetic analysis JOURNAL Eur. J. Endocrinol. 168 (4), 533-541 (2013) PUBMED 23321498 REMARK GeneRIF: MEN1 mutations were identified in a small percentage of patients with sporadic pituitary macroadenomas. Publication Status: Online-Only REFERENCE 2 (bases 1 to 3051) AUTHORS Oberg,K. TITLE The genetics of neuroendocrine tumors JOURNAL Semin. Oncol. 40 (1), 37-44 (2013) PUBMED 23391111 REMARK GeneRIF: Studies indicate that mutations of the MEN-1 and ATRX/DAXX genes in sporadic pancreatic NETs (PNETs) provided insights into tumor development tumor development and therapy. REFERENCE 3 (bases 1 to 3051) AUTHORS Alvelos,M.I., Vinagre,J., Fonseca,E., Barbosa,E., Teixeira-Gomes,J., Sobrinho-Simoes,M. and Soares,P. TITLE MEN1 intragenic deletions may represent the most prevalent somatic event in sporadic primary hyperparathyroidism JOURNAL Eur. J. Endocrinol. 168 (2), 119-128 (2012) PUBMED 23093699 REMARK GeneRIF: These results suggest that MEN1 alterations, remarkably intragenic deletions, may represent the most prevalent genetic alteration in sporadic parathyroid tumours. Publication Status: Online-Only REFERENCE 4 (bases 1 to 3051) AUTHORS Shi,A., Murai,M.J., He,S., Lund,G., Hartley,T., Purohit,T., Reddy,G., Chruszcz,M., Grembecka,J. and Cierpicki,T. TITLE Structural insights into inhibition of the bivalent menin-MLL interaction by small molecules in leukemia JOURNAL Blood 120 (23), 4461-4469 (2012) PUBMED 22936661 REMARK GeneRIF: Results suggest structural basis to design of inhibitors for effective targeting of the menin-MLL interaction in leukemia. REFERENCE 5 (bases 1 to 3051) AUTHORS Wu,Y., Feng,Z.J., Gao,S.B., Matkar,S., Xu,B., Duan,H.B., Lin,X., Li,S.H., Hua,X. and Jin,G.H. TITLE Interplay between menin and K-Ras in regulating lung adenocarcinoma JOURNAL J. Biol. Chem. 287 (47), 40003-40011 (2012) PUBMED 23027861 REMARK GeneRIF: a previously unknown link between activated K-Ras and menin, an important interplay governing tumor activation and suppression in the development of lung cancer. REFERENCE 6 (bases 1 to 3051) AUTHORS Heppner,C., Kester,M.B., Agarwal,S.K., Debelenko,L.V., Emmert-Buck,M.R., Guru,S.C., Manickam,P., Olufemi,S.E., Skarulis,M.C., Doppman,J.L., Alexander,R.H., Kim,Y.S., Saggar,S.K., Lubensky,I.A., Zhuang,Z., Liotta,L.A., Chandrasekharappa,S.C., Collins,F.S., Spiegel,A.M., Burns,A.L. and Marx,S.J. TITLE Somatic mutation of the MEN1 gene in parathyroid tumours JOURNAL Nat. Genet. 16 (4), 375-378 (1997) PUBMED 9241276 REFERENCE 7 (bases 1 to 3051) AUTHORS Guru,S.C., Agarwal,S.K., Manickam,P., Olufemi,S.E., Crabtree,J.S., Weisemann,J.M., Kester,M.B., Kim,Y.S., Wang,Y., Emmert-Buck,M.R., Liotta,L.A., Spiegel,A.M., Boguski,M.S., Roe,B.A., Collins,F.S., Marx,S.J., Burns,L. and Chandrasekharappa,S.C. TITLE A transcript map for the 2.8-Mb region containing the multiple endocrine neoplasia type 1 locus JOURNAL Genome Res. 7 (7), 725-735 (1997) PUBMED 9253601 REFERENCE 8 (bases 1 to 3051) AUTHORS Agarwal,S.K., Kester,M.B., Debelenko,L.V., Heppner,C., Emmert-Buck,M.R., Skarulis,M.C., Doppman,J.L., Kim,Y.S., Lubensky,I.A., Zhuang,Z., Green,J.S., Guru,S.C., Manickam,P., Olufemi,S.E., Liotta,L.A., Chandrasekharappa,S.C., Collins,F.S., Spiegel,A.M., Burns,A.L. and Marx,S.J. TITLE Germline mutations of the MEN1 gene in familial multiple endocrine neoplasia type 1 and related states JOURNAL Hum. Mol. Genet. 6 (7), 1169-1175 (1997) PUBMED 9215689 REFERENCE 9 (bases 1 to 3051) AUTHORS Chandrasekharappa,S.C., Guru,S.C., Manickam,P., Olufemi,S.E., Collins,F.S., Emmert-Buck,M.R., Debelenko,L.V., Zhuang,Z., Lubensky,I.A., Liotta,L.A., Crabtree,J.S., Wang,Y., Roe,B.A., Weisemann,J., Boguski,M.S., Agarwal,S.K., Kester,M.B., Kim,Y.S., Heppner,C., Dong,Q., Spiegel,A.M., Burns,A.L. and Marx,S.J. TITLE Positional cloning of the gene for multiple endocrine neoplasia-type 1 JOURNAL Science 276 (5311), 404-407 (1997) PUBMED 9103196 REFERENCE 10 (bases 1 to 3051) AUTHORS Bystrom,C., Larsson,C., Blomberg,C., Sandelin,K., Falkmer,U., Skogseid,B., Oberg,K., Werner,S. and Nordenskjold,M. TITLE Localization of the MEN1 gene to a small region within chromosome 11q13 by deletion mapping in tumors JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (5), 1968-1972 (1990) PUBMED 1968641 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AJ297489.1, BE267140.1, U93236.1, BC002664.2 and AA877856.1. On Oct 29, 2008 this sequence version replaced gi:18860856. Summary: This gene encodes menin, a putative tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. In vitro studies have shown menin is localized to the nucleus, possesses two functional nuclear localization signals, and inhibits transcriptional activation by JunD, however, the function of this protein is not known. Two messages have been detected on northern blots but the larger message has not been characterized. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]. Transcript Variant: This variant (e1F1) encodes the same isoform as variant 1. This variant has a distinct 5' UTR from variant 1, but shares some 5' UTR sequence with variant e1E. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## RNAseq introns :: mixed/partial sample support ERS025082, ERS025084 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: full length. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-816 AJ297489.1 1-816 817-1027 BE267140.1 30-240 1028-2268 U93236.1 747-1987 2269-3042 BC002664.2 897-1670 3043-3051 AA877856.1 1-9 c FEATURES Location/Qualifiers source 1..3051 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="11" /map="11q13" gene 1..3051 /gene="MEN1" /gene_synonym="MEAI; SCG2" /note="multiple endocrine neoplasia I" /db_xref="GeneID:4221" /db_xref="HGNC:7010" /db_xref="HPRD:00564" /db_xref="MIM:613733" exon 1..261 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" STS 159..294 /gene="MEN1" /gene_synonym="MEAI; SCG2" /standard_name="REN56552" /db_xref="UniSTS:381352" misc_feature 206..208 /gene="MEN1" /gene_synonym="MEAI; SCG2" /note="upstream in-frame stop codon" exon 262..353 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" variation 344 /gene="MEN1" /gene_synonym="MEAI; SCG2" /replace="a" /replace="t" /db_xref="dbSNP:650277" exon 354..836 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" variation 375 /gene="MEN1" /gene_synonym="MEAI; SCG2" /replace="c" /replace="t" /db_xref="dbSNP:653534" CDS 377..2224 /gene="MEN1" /gene_synonym="MEAI; SCG2" /note="isoform 1 is encoded by transcript variant e1F1; menin" /codon_start=1 /product="menin isoform 1" /protein_id="NP_570716.1" /db_xref="GI:18860857" /db_xref="CCDS:CCDS8083.1" /db_xref="GeneID:4221" /db_xref="HGNC:7010" /db_xref="HPRD:00564" /db_xref="MIM:613733" /translation="
MGLKAAQKTLFPLRSIDDVVRLFAAELGREEPDLVLLSLVLGFVEHFLAVNRVIPTNVPELTFQPSPAPDPPGGLTYFPVADLSIIAALYARFTAQIRGAVDLSLYPREGGVSSRELVKKVSDVIWNSLSRSYFKDRAHIQSLFSFITGWSPVGTKLDSSGVAFAVVGACQALGLRDVHLALSEDHAWVVFGPNGEQTAEVTWHGKGNEDRRGQTVNAGVAERSWLYLKGSYMRCDRKMEVAFMVCAINPSIDLHTDSLELLQLQQKLLWLLYDLGHLERYPMALGNLADLEELEPTPGRPDPLTLYHKGIASAKTYYRDEHIYPYMYLAGYHCRNRNVREALQAWADTATVIQDYNYCREDEEIYKEFFEVANDVIPNLLKEAASLLEAGEERPGEQSQGTQSQGSALQDPECFAHLLRFYDGICKWEEGSPTPVLHVGWATFLVQSLGRFEGQVRQKVRIVSREAEAAEAEEPWGEEAREGRRRGPRRESKPEEPPPPKKPALDKGLGTGQGAVSGPPRKPPGTVAGTARGPEGGSTAQVPAPAASPPPEGPVLTFQSEKMKGMKELLVATKINSSAIKLQLTAQSQVQMKKQKVSTPSDYTLSFLKRQRKGL
" misc_feature 377..2221 /gene="MEN1" /gene_synonym="MEAI; SCG2" /note="Menin; Region: Menin; pfam05053" /db_xref="CDD:191179" misc_feature 1031..1561 /gene="MEN1" /gene_synonym="MEAI; SCG2" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (O00255.4); Region: Interaction with FANCD2" misc_feature 1571..1573 /gene="MEN1" /gene_synonym="MEAI; SCG2" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 2171..2173 /gene="MEN1" /gene_synonym="MEAI; SCG2" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (O00255.4); phosphorylation site" STS 392..646 /gene="MEN1" /gene_synonym="MEAI; SCG2" /standard_name="REN56547" /db_xref="UniSTS:381347" STS 506..757 /gene="MEN1" /gene_synonym="MEAI; SCG2" /standard_name="REN56546" /db_xref="UniSTS:381346" exon 837..1045 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" exon 1046..1174 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" exon 1175..1215 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" exon 1216..1303 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" exon 1304..1440 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" variation 1400 /gene="MEN1" /gene_synonym="MEAI; SCG2" /replace="a" /replace="g" /db_xref="dbSNP:2071312" exon 1441..1576 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" exon 1577..1741 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" variation 1645 /gene="MEN1" /gene_synonym="MEAI; SCG2" /replace="c" /replace="t" /db_xref="dbSNP:2071313" exon 1742..3044 /gene="MEN1" /gene_synonym="MEAI; SCG2" /inference="alignment:Splign:1.39.8" STS 1845..2077 /gene="MEN1" /gene_synonym="MEAI; SCG2" /standard_name="REN56522" /db_xref="UniSTS:381322" variation 2012 /gene="MEN1" /gene_synonym="MEAI; SCG2" /replace="a" /replace="g" /db_xref="dbSNP:2959656" STS 2054..2298 /gene="MEN1" /gene_synonym="MEAI; SCG2" /standard_name="REN56521" /db_xref="UniSTS:381321" STS 2280..2508 /gene="MEN1" /gene_synonym="MEAI; SCG2" /standard_name="REN56520" /db_xref="UniSTS:381320" STS 2474..2703 /gene="MEN1" /gene_synonym="MEAI; SCG2" /standard_name="REN56519" /db_xref="UniSTS:381319" variation 2526 /gene="MEN1" /gene_synonym="MEAI; SCG2" /replace="c" /replace="t" /db_xref="dbSNP:1804849" variation 2531 /gene="MEN1" /gene_synonym="MEAI; SCG2" /replace="g" /replace="t" /db_xref="dbSNP:1804848" STS 2678..2939 /gene="MEN1" /gene_synonym="MEAI; SCG2" /standard_name="REN56518" /db_xref="UniSTS:381318" STS 2755..2994 /gene="MEN1" /gene_synonym="MEAI; SCG2" /standard_name="A007D15" /db_xref="UniSTS:36248" variation 2877 /gene="MEN1" /gene_synonym="MEAI; SCG2" /replace="c" /replace="t" /db_xref="dbSNP:1804850" polyA_site 3044 /gene="MEN1" /gene_synonym="MEAI; SCG2" ORIGIN
tatatttatgtatatgcacatacacacaaaattaggcgggagtggtggcgcacgcctgtgatcacagctactcgggaggctgaggcacgagaatcgcttgagcccgtgaagtcgaggctgcagtgagcccagatcgagccactgcattccagcctgggcgaaagagaaagaccgtgtctcaaaacaaacaaacaaaagctactcttagcacgtgttagagtatctcgcgggcggaagtgggaaacgagtgctgcacacagacaacctgatctttttcctcataacttgccgaccgacccgtgacagcaaaaccggcagaagctcggcgacctcccaccccgagtctgcaggtagccgccgcccaccgcccgccgccatggggctgaaggccgcccagaagacgctgttcccgctgcgctccatcgacgacgtggtgcgcctgtttgctgccgagctgggccgagaggagccggacctggtgctcctttccttggtgctgggcttcgtggagcattttctggctgtcaaccgcgtcatccctaccaacgttcccgagctcaccttccagcccagccccgcccccgacccgcctggcggcctcacctactttcccgtggccgacctgtctatcatcgccgccctctatgcccgcttcaccgcccagatccgaggcgccgtcgacctgtccctctatcctcgagaagggggtgtctccagccgtgagctggtgaagaaggtctccgatgtcatatggaacagcctcagccgctcctacttcaaggatcgggcccacatccagtccctcttcagcttcatcacaggttggagcccagtaggcaccaaattggacagctccggtgtggcctttgctgtggttggggcctgccaggccctgggtctccgggatgtccacctcgccctgtctgaggatcatgcctgggtagtgtttgggcccaatggggagcagacagctgaggtcacctggcacggcaagggcaacgaggaccgcaggggccagacagtcaatgccggtgtggctgagcggagctggctgtacctgaaaggatcatacatgcgctgtgaccgcaagatggaggtggcgttcatggtgtgtgccatcaacccttccattgacctgcacaccgactcgctggagcttctgcagctgcagcagaagctgctctggctgctctatgacctgggacatctggaaaggtaccccatggccttagggaacctggcagatctagaggagctggagcccacccctggccggccagacccactcaccctctaccacaagggcattgcctcagccaagacctactatcgggatgaacacatctacccctacatgtacctggctggctaccactgtcgcaaccgcaatgtgcgggaagccctgcaggcctgggcggacacggccactgtcatccaggactacaactactgccgggaagacgaggagatctacaaggagttctttgaagtagccaatgatgtcatccccaacctgctgaaggaggcagccagcttgctggaggcgggcgaggagcggccgggggagcaaagccagggcacccagagccaaggttccgccctccaggaccctgagtgcttcgcccacctgctgcgattctacgacggcatctgcaaatgggaggagggcagtcccacgcctgtgctgcacgtgggctgggccacctttcttgtgcagtccctaggccgttttgagggacaggtgcggcagaaggtgcgcatagtgagccgagaggccgaggcggccgaggccgaggagccgtggggcgaggaagcccgggaaggccggcggcggggcccacggcgggagtccaagccagaggagcccccgccgcccaagaagccagcactggacaagggcctgggcaccggccagggtgcagtgtcaggacccccccggaagcctcctgggactgtcgctggcacagcccgaggccctgaaggtggcagcacggctcaggtgccagcacccgcagcatcaccaccgccggagggtccagtgctcactttccagagtgagaagatgaagggcatgaaggagctgctggtggccaccaagatcaactcgagcgccatcaagctgcaactcacggcacagtcgcaagtgcagatgaagaagcagaaagtgtccacccctagtgactacactctgtctttcctcaagcggcagcgcaaaggcctctgaactactggggacttcggaccgcttgtggggacccaggctccgcccttagtcccccaactctgagcccatgttctgcccccagcccaaaggggacaggcctcacctctacccaaaccctaggttcccggtcccgagtacagtctgtatcaaacccacgattttctccagctcagaacccagggctctgccccagtcgttagaatataggtctcttctcccagaatcccagccggccaatggaaacctcacgctgggtcctaattaccagtctttaaaggcccagcccctagaaacccaagctcctcctcggaaccgctcacctagagccagaccaacgttactcagggctcctcccagcttgtaggagctgaggtttcacccttaacccaaggagcacaggtcccacctccagcccgggagcctaggaccactcagcccctaggagtatatttccgcacttcagaattccatatcttgcgaatccaagctccctgccccaaataacttcagtcctgctccagaatttggaaatcctagtttcctctccttcgtatcccgagtctgggacacaaaactccgcccccagcctatgagcatcctgagccccgccctcttcctgacgaaactggccccggatcagagcaggacctcccttccgaccctctgggaacctcccagaggtccagcccatctcggagcatcccggaggaaatctgcagagggttaggagtgggtgacaagagcctgatctcttcctgttttgtacatagatttatttttcagttccaagaaagatgaatacattttgttaaaaaaaataaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:4221 -> Molecular function: GO:0000400 [four-way junction DNA binding] evidence: IDA GeneID:4221 -> Molecular function: GO:0000403 [Y-form DNA binding] evidence: IDA GeneID:4221 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA GeneID:4221 -> Molecular function: GO:0003690 [double-stranded DNA binding] evidence: IDA GeneID:4221 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:4221 -> Molecular function: GO:0018024 [histone-lysine N-methyltransferase activity] evidence: IDA GeneID:4221 -> Molecular function: GO:0030674 [protein binding, bridging] evidence: IDA GeneID:4221 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA GeneID:4221 -> Molecular function: GO:0044212 [transcription regulatory region DNA binding] evidence: IDA GeneID:4221 -> Molecular function: GO:0047485 [protein N-terminus binding] evidence: IPI GeneID:4221 -> Molecular function: GO:0070412 [R-SMAD binding] evidence: IPI GeneID:4221 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA GeneID:4221 -> Biological process: GO:0000165 [MAPK cascade] evidence: IDA GeneID:4221 -> Biological process: GO:0001776 [leukocyte homeostasis] evidence: IEA GeneID:4221 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: IDA GeneID:4221 -> Biological process: GO:0002051 [osteoblast fate commitment] evidence: IEA GeneID:4221 -> Biological process: GO:0002076 [osteoblast development] evidence: IGI GeneID:4221 -> Biological process: GO:0006281 [DNA repair] evidence: NAS GeneID:4221 -> Biological process: GO:0006338 [chromatin remodeling] evidence: IEA GeneID:4221 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: TAS GeneID:4221 -> Biological process: GO:0006367 [transcription initiation from RNA polymerase II promoter] evidence: TAS GeneID:4221 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IDA GeneID:4221 -> Biological process: GO:0007050 [cell cycle arrest] evidence: IEA GeneID:4221 -> Biological process: GO:0007179 [transforming growth factor beta receptor signaling pathway] evidence: TAS GeneID:4221 -> Biological process: GO:0007420 [brain development] evidence: IEA GeneID:4221 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IDA GeneID:4221 -> Biological process: GO:0009411 [response to UV] evidence: IDA GeneID:4221 -> Biological process: GO:0010332 [response to gamma radiation] evidence: IDA GeneID:4221 -> Biological process: GO:0010467 [gene expression] evidence: TAS GeneID:4221 -> Biological process: GO:0030097 [hemopoiesis] evidence: IEA GeneID:4221 -> Biological process: GO:0030511 [positive regulation of transforming growth factor beta receptor signaling pathway] evidence: IMP GeneID:4221 -> Biological process: GO:0031062 [positive regulation of histone methylation] evidence: IEA GeneID:4221 -> Biological process: GO:0032092 [positive regulation of protein binding] evidence: IDA GeneID:4221 -> Biological process: GO:0032925 [regulation of activin receptor signaling pathway] evidence: IEA GeneID:4221 -> Biological process: GO:0034968 [histone lysine methylation] evidence: IDA GeneID:4221 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IEA GeneID:4221 -> Biological process: GO:0043280 [positive regulation of cysteine-type endopeptidase activity involved in apoptotic process] evidence: IEA GeneID:4221 -> Biological process: GO:0043433 [negative regulation of sequence-specific DNA binding transcription factor activity] evidence: IDA GeneID:4221 -> Biological process: GO:0045668 [negative regulation of osteoblast differentiation] evidence: IGI GeneID:4221 -> Biological process: GO:0045669 [positive regulation of osteoblast differentiation] evidence: IEA GeneID:4221 -> Biological process: GO:0045736 [negative regulation of cyclin-dependent protein serine/threonine kinase activity] evidence: IMP GeneID:4221 -> Biological process: GO:0045786 [negative regulation of cell cycle] evidence: IDA GeneID:4221 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA GeneID:4221 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: TAS GeneID:4221 -> Biological process: GO:0046329 [negative regulation of JNK cascade] evidence: IDA GeneID:4221 -> Biological process: GO:0046621 [negative regulation of organ growth] evidence: IEA GeneID:4221 -> Biological process: GO:0048704 [embryonic skeletal system morphogenesis] evidence: IEA GeneID:4221 -> Biological process: GO:0051781 [positive regulation of cell division] evidence: IEA GeneID:4221 -> Biological process: GO:0051974 [negative regulation of telomerase activity] evidence: IMP GeneID:4221 -> Biological process: GO:0060021 [palate development] evidence: IEA GeneID:4221 -> Biological process: GO:0060135 [maternal process involved in female pregnancy] evidence: IEA GeneID:4221 -> Cellular component: GO:0000785 [chromatin] evidence: IDA GeneID:4221 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:4221 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS GeneID:4221 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:4221 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA GeneID:4221 -> Cellular component: GO:0005829 [cytosol] evidence: IDA GeneID:4221 -> Cellular component: GO:0016363 [nuclear matrix] evidence: IDA GeneID:4221 -> Cellular component: GO:0032154 [cleavage furrow] evidence: IDA GeneID:4221 -> Cellular component: GO:0035097 [histone methyltransferase complex] evidence: IDA GeneID:4221 -> Cellular component: GO:0035097 [histone methyltransferase complex] evidence: IPI GeneID:4221 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.