GGRNA Home | Help | Advanced search

2018-11-22 02:51:18, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_130804               3051 bp    mRNA    linear   PRI 12-MAY-2013
DEFINITION  Homo sapiens multiple endocrine neoplasia I (MEN1), transcript
            variant e1F1, mRNA.
ACCESSION   NM_130804
VERSION     NM_130804.2  GI:210031781
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3051)
  AUTHORS   Cuny,T., Pertuit,M., Sahnoun-Fathallah,M., Daly,A., Occhi,G.,
            Odou,M.F., Tabarin,A., Nunes,M.L., Delemer,B., Rohmer,V.,
            Desailloud,R., Kerlan,V., Chabre,O., Sadoul,J.L., Cogne,M.,
            Caron,P., Cortet-Rudelli,C., Lienhardt,A., Raingeard,I.,
            Guedj,A.M., Brue,T., Beckers,A., Weryha,G., Enjalbert,A. and
            Barlier,A.
  TITLE     Genetic analysis in young patients with sporadic pituitary
            macroadenomas: besides AIP don't forget MEN1 genetic analysis
  JOURNAL   Eur. J. Endocrinol. 168 (4), 533-541 (2013)
   PUBMED   23321498
  REMARK    GeneRIF: MEN1 mutations were identified in a small percentage of
            patients with sporadic pituitary macroadenomas.
            Publication Status: Online-Only
REFERENCE   2  (bases 1 to 3051)
  AUTHORS   Oberg,K.
  TITLE     The genetics of neuroendocrine tumors
  JOURNAL   Semin. Oncol. 40 (1), 37-44 (2013)
   PUBMED   23391111
  REMARK    GeneRIF: Studies indicate that mutations of the MEN-1 and ATRX/DAXX
            genes in sporadic pancreatic NETs (PNETs) provided insights into
            tumor development tumor development and therapy.
REFERENCE   3  (bases 1 to 3051)
  AUTHORS   Alvelos,M.I., Vinagre,J., Fonseca,E., Barbosa,E.,
            Teixeira-Gomes,J., Sobrinho-Simoes,M. and Soares,P.
  TITLE     MEN1 intragenic deletions may represent the most prevalent somatic
            event in sporadic primary hyperparathyroidism
  JOURNAL   Eur. J. Endocrinol. 168 (2), 119-128 (2012)
   PUBMED   23093699
  REMARK    GeneRIF: These results suggest that MEN1 alterations, remarkably
            intragenic deletions, may represent the most prevalent genetic
            alteration in sporadic parathyroid tumours.
            Publication Status: Online-Only
REFERENCE   4  (bases 1 to 3051)
  AUTHORS   Shi,A., Murai,M.J., He,S., Lund,G., Hartley,T., Purohit,T.,
            Reddy,G., Chruszcz,M., Grembecka,J. and Cierpicki,T.
  TITLE     Structural insights into inhibition of the bivalent menin-MLL
            interaction by small molecules in leukemia
  JOURNAL   Blood 120 (23), 4461-4469 (2012)
   PUBMED   22936661
  REMARK    GeneRIF: Results suggest structural basis to design of inhibitors
            for effective targeting of the menin-MLL interaction in leukemia.
REFERENCE   5  (bases 1 to 3051)
  AUTHORS   Wu,Y., Feng,Z.J., Gao,S.B., Matkar,S., Xu,B., Duan,H.B., Lin,X.,
            Li,S.H., Hua,X. and Jin,G.H.
  TITLE     Interplay between menin and K-Ras in regulating lung adenocarcinoma
  JOURNAL   J. Biol. Chem. 287 (47), 40003-40011 (2012)
   PUBMED   23027861
  REMARK    GeneRIF: a previously unknown link between activated K-Ras and
            menin, an important interplay governing tumor activation and
            suppression in the development of lung cancer.
REFERENCE   6  (bases 1 to 3051)
  AUTHORS   Heppner,C., Kester,M.B., Agarwal,S.K., Debelenko,L.V.,
            Emmert-Buck,M.R., Guru,S.C., Manickam,P., Olufemi,S.E.,
            Skarulis,M.C., Doppman,J.L., Alexander,R.H., Kim,Y.S., Saggar,S.K.,
            Lubensky,I.A., Zhuang,Z., Liotta,L.A., Chandrasekharappa,S.C.,
            Collins,F.S., Spiegel,A.M., Burns,A.L. and Marx,S.J.
  TITLE     Somatic mutation of the MEN1 gene in parathyroid tumours
  JOURNAL   Nat. Genet. 16 (4), 375-378 (1997)
   PUBMED   9241276
REFERENCE   7  (bases 1 to 3051)
  AUTHORS   Guru,S.C., Agarwal,S.K., Manickam,P., Olufemi,S.E., Crabtree,J.S.,
            Weisemann,J.M., Kester,M.B., Kim,Y.S., Wang,Y., Emmert-Buck,M.R.,
            Liotta,L.A., Spiegel,A.M., Boguski,M.S., Roe,B.A., Collins,F.S.,
            Marx,S.J., Burns,L. and Chandrasekharappa,S.C.
  TITLE     A transcript map for the 2.8-Mb region containing the multiple
            endocrine neoplasia type 1 locus
  JOURNAL   Genome Res. 7 (7), 725-735 (1997)
   PUBMED   9253601
REFERENCE   8  (bases 1 to 3051)
  AUTHORS   Agarwal,S.K., Kester,M.B., Debelenko,L.V., Heppner,C.,
            Emmert-Buck,M.R., Skarulis,M.C., Doppman,J.L., Kim,Y.S.,
            Lubensky,I.A., Zhuang,Z., Green,J.S., Guru,S.C., Manickam,P.,
            Olufemi,S.E., Liotta,L.A., Chandrasekharappa,S.C., Collins,F.S.,
            Spiegel,A.M., Burns,A.L. and Marx,S.J.
  TITLE     Germline mutations of the MEN1 gene in familial multiple endocrine
            neoplasia type 1 and related states
  JOURNAL   Hum. Mol. Genet. 6 (7), 1169-1175 (1997)
   PUBMED   9215689
REFERENCE   9  (bases 1 to 3051)
  AUTHORS   Chandrasekharappa,S.C., Guru,S.C., Manickam,P., Olufemi,S.E.,
            Collins,F.S., Emmert-Buck,M.R., Debelenko,L.V., Zhuang,Z.,
            Lubensky,I.A., Liotta,L.A., Crabtree,J.S., Wang,Y., Roe,B.A.,
            Weisemann,J., Boguski,M.S., Agarwal,S.K., Kester,M.B., Kim,Y.S.,
            Heppner,C., Dong,Q., Spiegel,A.M., Burns,A.L. and Marx,S.J.
  TITLE     Positional cloning of the gene for multiple endocrine
            neoplasia-type 1
  JOURNAL   Science 276 (5311), 404-407 (1997)
   PUBMED   9103196
REFERENCE   10 (bases 1 to 3051)
  AUTHORS   Bystrom,C., Larsson,C., Blomberg,C., Sandelin,K., Falkmer,U.,
            Skogseid,B., Oberg,K., Werner,S. and Nordenskjold,M.
  TITLE     Localization of the MEN1 gene to a small region within chromosome
            11q13 by deletion mapping in tumors
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 87 (5), 1968-1972 (1990)
   PUBMED   1968641
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AJ297489.1, BE267140.1,
            U93236.1, BC002664.2 and AA877856.1.
            On Oct 29, 2008 this sequence version replaced gi:18860856.
            
            Summary: This gene encodes menin, a putative tumor suppressor
            associated with a syndrome known as multiple endocrine neoplasia
            type 1. In vitro studies have shown menin is localized to the
            nucleus, possesses two functional nuclear localization signals, and
            inhibits transcriptional activation by JunD, however, the function
            of this protein is not known. Two messages have been detected on
            northern blots but the larger message has not been characterized.
            Alternative splicing results in multiple transcript variants.
            [provided by RefSeq, Oct 2008].
            
            Transcript Variant: This variant (e1F1) encodes the same isoform as
            variant 1. This variant has a distinct 5' UTR from variant 1, but
            shares some 5' UTR sequence with variant e1E.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            RNAseq introns :: mixed/partial sample support ERS025082, ERS025084
                              [ECO:0000350]
            ##Evidence-Data-END##
            COMPLETENESS: full length.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-816               AJ297489.1         1-816
            817-1027            BE267140.1         30-240
            1028-2268           U93236.1           747-1987
            2269-3042           BC002664.2         897-1670
            3043-3051           AA877856.1         1-9                 c
FEATURES             Location/Qualifiers
     source          1..3051
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="11"
                     /map="11q13"
     gene            1..3051
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /note="multiple endocrine neoplasia I"
                     /db_xref="GeneID:4221"
                     /db_xref="HGNC:7010"
                     /db_xref="HPRD:00564"
                     /db_xref="MIM:613733"
     exon            1..261
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     STS             159..294
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /standard_name="REN56552"
                     /db_xref="UniSTS:381352"
     misc_feature    206..208
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /note="upstream in-frame stop codon"
     exon            262..353
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     variation       344
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:650277"
     exon            354..836
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     variation       375
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:653534"
     CDS             377..2224
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /note="isoform 1 is encoded by transcript variant e1F1;
                     menin"
                     /codon_start=1
                     /product="menin isoform 1"
                     /protein_id="NP_570716.1"
                     /db_xref="GI:18860857"
                     /db_xref="CCDS:CCDS8083.1"
                     /db_xref="GeneID:4221"
                     /db_xref="HGNC:7010"
                     /db_xref="HPRD:00564"
                     /db_xref="MIM:613733"
                     /translation="
MGLKAAQKTLFPLRSIDDVVRLFAAELGREEPDLVLLSLVLGFVEHFLAVNRVIPTNVPELTFQPSPAPDPPGGLTYFPVADLSIIAALYARFTAQIRGAVDLSLYPREGGVSSRELVKKVSDVIWNSLSRSYFKDRAHIQSLFSFITGWSPVGTKLDSSGVAFAVVGACQALGLRDVHLALSEDHAWVVFGPNGEQTAEVTWHGKGNEDRRGQTVNAGVAERSWLYLKGSYMRCDRKMEVAFMVCAINPSIDLHTDSLELLQLQQKLLWLLYDLGHLERYPMALGNLADLEELEPTPGRPDPLTLYHKGIASAKTYYRDEHIYPYMYLAGYHCRNRNVREALQAWADTATVIQDYNYCREDEEIYKEFFEVANDVIPNLLKEAASLLEAGEERPGEQSQGTQSQGSALQDPECFAHLLRFYDGICKWEEGSPTPVLHVGWATFLVQSLGRFEGQVRQKVRIVSREAEAAEAEEPWGEEAREGRRRGPRRESKPEEPPPPKKPALDKGLGTGQGAVSGPPRKPPGTVAGTARGPEGGSTAQVPAPAASPPPEGPVLTFQSEKMKGMKELLVATKINSSAIKLQLTAQSQVQMKKQKVSTPSDYTLSFLKRQRKGL
"
     misc_feature    377..2221
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /note="Menin; Region: Menin; pfam05053"
                     /db_xref="CDD:191179"
     misc_feature    1031..1561
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (O00255.4);
                     Region: Interaction with FANCD2"
     misc_feature    1571..1573
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    2171..2173
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphothreonine; propagated from
                     UniProtKB/Swiss-Prot (O00255.4); phosphorylation site"
     STS             392..646
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /standard_name="REN56547"
                     /db_xref="UniSTS:381347"
     STS             506..757
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /standard_name="REN56546"
                     /db_xref="UniSTS:381346"
     exon            837..1045
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     exon            1046..1174
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     exon            1175..1215
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     exon            1216..1303
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     exon            1304..1440
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     variation       1400
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2071312"
     exon            1441..1576
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     exon            1577..1741
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     variation       1645
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2071313"
     exon            1742..3044
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /inference="alignment:Splign:1.39.8"
     STS             1845..2077
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /standard_name="REN56522"
                     /db_xref="UniSTS:381322"
     variation       2012
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2959656"
     STS             2054..2298
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /standard_name="REN56521"
                     /db_xref="UniSTS:381321"
     STS             2280..2508
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /standard_name="REN56520"
                     /db_xref="UniSTS:381320"
     STS             2474..2703
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /standard_name="REN56519"
                     /db_xref="UniSTS:381319"
     variation       2526
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804849"
     variation       2531
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:1804848"
     STS             2678..2939
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /standard_name="REN56518"
                     /db_xref="UniSTS:381318"
     STS             2755..2994
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /standard_name="A007D15"
                     /db_xref="UniSTS:36248"
     variation       2877
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1804850"
     polyA_site      3044
                     /gene="MEN1"
                     /gene_synonym="MEAI; SCG2"
ORIGIN      
tatatttatgtatatgcacatacacacaaaattaggcgggagtggtggcgcacgcctgtgatcacagctactcgggaggctgaggcacgagaatcgcttgagcccgtgaagtcgaggctgcagtgagcccagatcgagccactgcattccagcctgggcgaaagagaaagaccgtgtctcaaaacaaacaaacaaaagctactcttagcacgtgttagagtatctcgcgggcggaagtgggaaacgagtgctgcacacagacaacctgatctttttcctcataacttgccgaccgacccgtgacagcaaaaccggcagaagctcggcgacctcccaccccgagtctgcaggtagccgccgcccaccgcccgccgccatggggctgaaggccgcccagaagacgctgttcccgctgcgctccatcgacgacgtggtgcgcctgtttgctgccgagctgggccgagaggagccggacctggtgctcctttccttggtgctgggcttcgtggagcattttctggctgtcaaccgcgtcatccctaccaacgttcccgagctcaccttccagcccagccccgcccccgacccgcctggcggcctcacctactttcccgtggccgacctgtctatcatcgccgccctctatgcccgcttcaccgcccagatccgaggcgccgtcgacctgtccctctatcctcgagaagggggtgtctccagccgtgagctggtgaagaaggtctccgatgtcatatggaacagcctcagccgctcctacttcaaggatcgggcccacatccagtccctcttcagcttcatcacaggttggagcccagtaggcaccaaattggacagctccggtgtggcctttgctgtggttggggcctgccaggccctgggtctccgggatgtccacctcgccctgtctgaggatcatgcctgggtagtgtttgggcccaatggggagcagacagctgaggtcacctggcacggcaagggcaacgaggaccgcaggggccagacagtcaatgccggtgtggctgagcggagctggctgtacctgaaaggatcatacatgcgctgtgaccgcaagatggaggtggcgttcatggtgtgtgccatcaacccttccattgacctgcacaccgactcgctggagcttctgcagctgcagcagaagctgctctggctgctctatgacctgggacatctggaaaggtaccccatggccttagggaacctggcagatctagaggagctggagcccacccctggccggccagacccactcaccctctaccacaagggcattgcctcagccaagacctactatcgggatgaacacatctacccctacatgtacctggctggctaccactgtcgcaaccgcaatgtgcgggaagccctgcaggcctgggcggacacggccactgtcatccaggactacaactactgccgggaagacgaggagatctacaaggagttctttgaagtagccaatgatgtcatccccaacctgctgaaggaggcagccagcttgctggaggcgggcgaggagcggccgggggagcaaagccagggcacccagagccaaggttccgccctccaggaccctgagtgcttcgcccacctgctgcgattctacgacggcatctgcaaatgggaggagggcagtcccacgcctgtgctgcacgtgggctgggccacctttcttgtgcagtccctaggccgttttgagggacaggtgcggcagaaggtgcgcatagtgagccgagaggccgaggcggccgaggccgaggagccgtggggcgaggaagcccgggaaggccggcggcggggcccacggcgggagtccaagccagaggagcccccgccgcccaagaagccagcactggacaagggcctgggcaccggccagggtgcagtgtcaggacccccccggaagcctcctgggactgtcgctggcacagcccgaggccctgaaggtggcagcacggctcaggtgccagcacccgcagcatcaccaccgccggagggtccagtgctcactttccagagtgagaagatgaagggcatgaaggagctgctggtggccaccaagatcaactcgagcgccatcaagctgcaactcacggcacagtcgcaagtgcagatgaagaagcagaaagtgtccacccctagtgactacactctgtctttcctcaagcggcagcgcaaaggcctctgaactactggggacttcggaccgcttgtggggacccaggctccgcccttagtcccccaactctgagcccatgttctgcccccagcccaaaggggacaggcctcacctctacccaaaccctaggttcccggtcccgagtacagtctgtatcaaacccacgattttctccagctcagaacccagggctctgccccagtcgttagaatataggtctcttctcccagaatcccagccggccaatggaaacctcacgctgggtcctaattaccagtctttaaaggcccagcccctagaaacccaagctcctcctcggaaccgctcacctagagccagaccaacgttactcagggctcctcccagcttgtaggagctgaggtttcacccttaacccaaggagcacaggtcccacctccagcccgggagcctaggaccactcagcccctaggagtatatttccgcacttcagaattccatatcttgcgaatccaagctccctgccccaaataacttcagtcctgctccagaatttggaaatcctagtttcctctccttcgtatcccgagtctgggacacaaaactccgcccccagcctatgagcatcctgagccccgccctcttcctgacgaaactggccccggatcagagcaggacctcccttccgaccctctgggaacctcccagaggtccagcccatctcggagcatcccggaggaaatctgcagagggttaggagtgggtgacaagagcctgatctcttcctgttttgtacatagatttatttttcagttccaagaaagatgaatacattttgttaaaaaaaataaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:4221 -> Molecular function: GO:0000400 [four-way junction DNA binding] evidence: IDA
            GeneID:4221 -> Molecular function: GO:0000403 [Y-form DNA binding] evidence: IDA
            GeneID:4221 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA
            GeneID:4221 -> Molecular function: GO:0003690 [double-stranded DNA binding] evidence: IDA
            GeneID:4221 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:4221 -> Molecular function: GO:0018024 [histone-lysine N-methyltransferase activity] evidence: IDA
            GeneID:4221 -> Molecular function: GO:0030674 [protein binding, bridging] evidence: IDA
            GeneID:4221 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
            GeneID:4221 -> Molecular function: GO:0044212 [transcription regulatory region DNA binding] evidence: IDA
            GeneID:4221 -> Molecular function: GO:0047485 [protein N-terminus binding] evidence: IPI
            GeneID:4221 -> Molecular function: GO:0070412 [R-SMAD binding] evidence: IPI
            GeneID:4221 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
            GeneID:4221 -> Biological process: GO:0000165 [MAPK cascade] evidence: IDA
            GeneID:4221 -> Biological process: GO:0001776 [leukocyte homeostasis] evidence: IEA
            GeneID:4221 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: IDA
            GeneID:4221 -> Biological process: GO:0002051 [osteoblast fate commitment] evidence: IEA
            GeneID:4221 -> Biological process: GO:0002076 [osteoblast development] evidence: IGI
            GeneID:4221 -> Biological process: GO:0006281 [DNA repair] evidence: NAS
            GeneID:4221 -> Biological process: GO:0006338 [chromatin remodeling] evidence: IEA
            GeneID:4221 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: TAS
            GeneID:4221 -> Biological process: GO:0006367 [transcription initiation from RNA polymerase II promoter] evidence: TAS
            GeneID:4221 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IDA
            GeneID:4221 -> Biological process: GO:0007050 [cell cycle arrest] evidence: IEA
            GeneID:4221 -> Biological process: GO:0007179 [transforming growth factor beta receptor signaling pathway] evidence: TAS
            GeneID:4221 -> Biological process: GO:0007420 [brain development] evidence: IEA
            GeneID:4221 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IDA
            GeneID:4221 -> Biological process: GO:0009411 [response to UV] evidence: IDA
            GeneID:4221 -> Biological process: GO:0010332 [response to gamma radiation] evidence: IDA
            GeneID:4221 -> Biological process: GO:0010467 [gene expression] evidence: TAS
            GeneID:4221 -> Biological process: GO:0030097 [hemopoiesis] evidence: IEA
            GeneID:4221 -> Biological process: GO:0030511 [positive regulation of transforming growth factor beta receptor signaling pathway] evidence: IMP
            GeneID:4221 -> Biological process: GO:0031062 [positive regulation of histone methylation] evidence: IEA
            GeneID:4221 -> Biological process: GO:0032092 [positive regulation of protein binding] evidence: IDA
            GeneID:4221 -> Biological process: GO:0032925 [regulation of activin receptor signaling pathway] evidence: IEA
            GeneID:4221 -> Biological process: GO:0034968 [histone lysine methylation] evidence: IDA
            GeneID:4221 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IEA
            GeneID:4221 -> Biological process: GO:0043280 [positive regulation of cysteine-type endopeptidase activity involved in apoptotic process] evidence: IEA
            GeneID:4221 -> Biological process: GO:0043433 [negative regulation of sequence-specific DNA binding transcription factor activity] evidence: IDA
            GeneID:4221 -> Biological process: GO:0045668 [negative regulation of osteoblast differentiation] evidence: IGI
            GeneID:4221 -> Biological process: GO:0045669 [positive regulation of osteoblast differentiation] evidence: IEA
            GeneID:4221 -> Biological process: GO:0045736 [negative regulation of cyclin-dependent protein serine/threonine kinase activity] evidence: IMP
            GeneID:4221 -> Biological process: GO:0045786 [negative regulation of cell cycle] evidence: IDA
            GeneID:4221 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA
            GeneID:4221 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: TAS
            GeneID:4221 -> Biological process: GO:0046329 [negative regulation of JNK cascade] evidence: IDA
            GeneID:4221 -> Biological process: GO:0046621 [negative regulation of organ growth] evidence: IEA
            GeneID:4221 -> Biological process: GO:0048704 [embryonic skeletal system morphogenesis] evidence: IEA
            GeneID:4221 -> Biological process: GO:0051781 [positive regulation of cell division] evidence: IEA
            GeneID:4221 -> Biological process: GO:0051974 [negative regulation of telomerase activity] evidence: IMP
            GeneID:4221 -> Biological process: GO:0060021 [palate development] evidence: IEA
            GeneID:4221 -> Biological process: GO:0060135 [maternal process involved in female pregnancy] evidence: IEA
            GeneID:4221 -> Cellular component: GO:0000785 [chromatin] evidence: IDA
            GeneID:4221 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:4221 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
            GeneID:4221 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
            GeneID:4221 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
            GeneID:4221 -> Cellular component: GO:0005829 [cytosol] evidence: IDA
            GeneID:4221 -> Cellular component: GO:0016363 [nuclear matrix] evidence: IDA
            GeneID:4221 -> Cellular component: GO:0032154 [cleavage furrow] evidence: IDA
            GeneID:4221 -> Cellular component: GO:0035097 [histone methyltransferase complex] evidence: IDA
            GeneID:4221 -> Cellular component: GO:0035097 [histone methyltransferase complex] evidence: IPI
            GeneID:4221 -> Cellular component: GO:0043234 [protein complex] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.