Home |
Help |
Advanced search
2024-04-19 16:25:31, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_130802 3172 bp mRNA linear PRI 12-MAY-2013
DEFINITION Homo sapiens multiple endocrine neoplasia I (MEN1), transcript
variant e1D, mRNA.
ACCESSION NM_130802
VERSION NM_130802.2 GI:210031715
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 3172)
AUTHORS Cuny,T., Pertuit,M., Sahnoun-Fathallah,M., Daly,A., Occhi,G.,
Odou,M.F., Tabarin,A., Nunes,M.L., Delemer,B., Rohmer,V.,
Desailloud,R., Kerlan,V., Chabre,O., Sadoul,J.L., Cogne,M.,
Caron,P., Cortet-Rudelli,C., Lienhardt,A., Raingeard,I.,
Guedj,A.M., Brue,T., Beckers,A., Weryha,G., Enjalbert,A. and
Barlier,A.
TITLE Genetic analysis in young patients with sporadic pituitary
macroadenomas: besides AIP don't forget MEN1 genetic analysis
JOURNAL Eur. J. Endocrinol. 168 (4), 533-541 (2013)
PUBMED 23321498
REMARK GeneRIF: MEN1 mutations were identified in a small percentage of
patients with sporadic pituitary macroadenomas.
Publication Status: Online-Only
REFERENCE 2 (bases 1 to 3172)
AUTHORS Oberg,K.
TITLE The genetics of neuroendocrine tumors
JOURNAL Semin. Oncol. 40 (1), 37-44 (2013)
PUBMED 23391111
REMARK GeneRIF: Studies indicate that mutations of the MEN-1 and ATRX/DAXX
genes in sporadic pancreatic NETs (PNETs) provided insights into
tumor development tumor development and therapy.
REFERENCE 3 (bases 1 to 3172)
AUTHORS Alvelos,M.I., Vinagre,J., Fonseca,E., Barbosa,E.,
Teixeira-Gomes,J., Sobrinho-Simoes,M. and Soares,P.
TITLE MEN1 intragenic deletions may represent the most prevalent somatic
event in sporadic primary hyperparathyroidism
JOURNAL Eur. J. Endocrinol. 168 (2), 119-128 (2012)
PUBMED 23093699
REMARK GeneRIF: These results suggest that MEN1 alterations, remarkably
intragenic deletions, may represent the most prevalent genetic
alteration in sporadic parathyroid tumours.
Publication Status: Online-Only
REFERENCE 4 (bases 1 to 3172)
AUTHORS Shi,A., Murai,M.J., He,S., Lund,G., Hartley,T., Purohit,T.,
Reddy,G., Chruszcz,M., Grembecka,J. and Cierpicki,T.
TITLE Structural insights into inhibition of the bivalent menin-MLL
interaction by small molecules in leukemia
JOURNAL Blood 120 (23), 4461-4469 (2012)
PUBMED 22936661
REMARK GeneRIF: Results suggest structural basis to design of inhibitors
for effective targeting of the menin-MLL interaction in leukemia.
REFERENCE 5 (bases 1 to 3172)
AUTHORS Wu,Y., Feng,Z.J., Gao,S.B., Matkar,S., Xu,B., Duan,H.B., Lin,X.,
Li,S.H., Hua,X. and Jin,G.H.
TITLE Interplay between menin and K-Ras in regulating lung adenocarcinoma
JOURNAL J. Biol. Chem. 287 (47), 40003-40011 (2012)
PUBMED 23027861
REMARK GeneRIF: a previously unknown link between activated K-Ras and
menin, an important interplay governing tumor activation and
suppression in the development of lung cancer.
REFERENCE 6 (bases 1 to 3172)
AUTHORS Heppner,C., Kester,M.B., Agarwal,S.K., Debelenko,L.V.,
Emmert-Buck,M.R., Guru,S.C., Manickam,P., Olufemi,S.E.,
Skarulis,M.C., Doppman,J.L., Alexander,R.H., Kim,Y.S., Saggar,S.K.,
Lubensky,I.A., Zhuang,Z., Liotta,L.A., Chandrasekharappa,S.C.,
Collins,F.S., Spiegel,A.M., Burns,A.L. and Marx,S.J.
TITLE Somatic mutation of the MEN1 gene in parathyroid tumours
JOURNAL Nat. Genet. 16 (4), 375-378 (1997)
PUBMED 9241276
REFERENCE 7 (bases 1 to 3172)
AUTHORS Guru,S.C., Agarwal,S.K., Manickam,P., Olufemi,S.E., Crabtree,J.S.,
Weisemann,J.M., Kester,M.B., Kim,Y.S., Wang,Y., Emmert-Buck,M.R.,
Liotta,L.A., Spiegel,A.M., Boguski,M.S., Roe,B.A., Collins,F.S.,
Marx,S.J., Burns,L. and Chandrasekharappa,S.C.
TITLE A transcript map for the 2.8-Mb region containing the multiple
endocrine neoplasia type 1 locus
JOURNAL Genome Res. 7 (7), 725-735 (1997)
PUBMED 9253601
REFERENCE 8 (bases 1 to 3172)
AUTHORS Agarwal,S.K., Kester,M.B., Debelenko,L.V., Heppner,C.,
Emmert-Buck,M.R., Skarulis,M.C., Doppman,J.L., Kim,Y.S.,
Lubensky,I.A., Zhuang,Z., Green,J.S., Guru,S.C., Manickam,P.,
Olufemi,S.E., Liotta,L.A., Chandrasekharappa,S.C., Collins,F.S.,
Spiegel,A.M., Burns,A.L. and Marx,S.J.
TITLE Germline mutations of the MEN1 gene in familial multiple endocrine
neoplasia type 1 and related states
JOURNAL Hum. Mol. Genet. 6 (7), 1169-1175 (1997)
PUBMED 9215689
REFERENCE 9 (bases 1 to 3172)
AUTHORS Chandrasekharappa,S.C., Guru,S.C., Manickam,P., Olufemi,S.E.,
Collins,F.S., Emmert-Buck,M.R., Debelenko,L.V., Zhuang,Z.,
Lubensky,I.A., Liotta,L.A., Crabtree,J.S., Wang,Y., Roe,B.A.,
Weisemann,J., Boguski,M.S., Agarwal,S.K., Kester,M.B., Kim,Y.S.,
Heppner,C., Dong,Q., Spiegel,A.M., Burns,A.L. and Marx,S.J.
TITLE Positional cloning of the gene for multiple endocrine
neoplasia-type 1
JOURNAL Science 276 (5311), 404-407 (1997)
PUBMED 9103196
REFERENCE 10 (bases 1 to 3172)
AUTHORS Bystrom,C., Larsson,C., Blomberg,C., Sandelin,K., Falkmer,U.,
Skogseid,B., Oberg,K., Werner,S. and Nordenskjold,M.
TITLE Localization of the MEN1 gene to a small region within chromosome
11q13 by deletion mapping in tumors
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (5), 1968-1972 (1990)
PUBMED 1968641
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from AJ297487.1, AP001462.3,
BE267140.1, U93236.1, BC002664.2 and AA877856.1.
On Oct 29, 2008 this sequence version replaced gi:18860852.
Summary: This gene encodes menin, a putative tumor suppressor
associated with a syndrome known as multiple endocrine neoplasia
type 1. In vitro studies have shown menin is localized to the
nucleus, possesses two functional nuclear localization signals, and
inhibits transcriptional activation by JunD, however, the function
of this protein is not known. Two messages have been detected on
northern blots but the larger message has not been characterized.
Alternative splicing results in multiple transcript variants.
[provided by RefSeq, Oct 2008].
Transcript Variant: This variant (e1D) encodes the same isoform as
variant 1. This variant has a unique 5' UTR different from that of
variant 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
RNAseq introns :: single sample supports all introns ERS025082
[ECO:0000348]
##Evidence-Data-END##
COMPLETENESS: full length.
PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP
1-100 AJ297487.1 1-100
101-101 AP001462.3 94916-94916 c
102-464 AJ297487.1 102-464
465-937 AJ297487.1 466-938
938-1148 BE267140.1 30-240
1149-2389 U93236.1 747-1987
2390-3163 BC002664.2 897-1670
3164-3172 AA877856.1 1-9 c
FEATURES Location/Qualifiers
source 1..3172
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="11"
/map="11q13"
gene 1..3172
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/note="multiple endocrine neoplasia I"
/db_xref="GeneID:4221"
/db_xref="HGNC:7010"
/db_xref="HPRD:00564"
/db_xref="MIM:613733"
exon 1..474
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
misc_feature 141..143
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/note="upstream in-frame stop codon"
STS 215..467
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="REN56549"
/db_xref="UniSTS:381349"
STS 444..535
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="REN56548"
/db_xref="UniSTS:381348"
exon 475..957
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
variation 496
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:653534"
CDS 498..2345
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/note="isoform 1 is encoded by transcript variant e1D;
menin"
/codon_start=1
/product="menin isoform 1"
/protein_id="NP_570714.1"
/db_xref="GI:18860853"
/db_xref="CCDS:CCDS8083.1"
/db_xref="GeneID:4221"
/db_xref="HGNC:7010"
/db_xref="HPRD:00564"
/db_xref="MIM:613733"
/translation="
MGLKAAQKTLFPLRSIDDVVRLFAAELGREEPDLVLLSLVLGFVEHFLAVNRVIPTNVPELTFQPSPAPDPPGGLTYFPVADLSIIAALYARFTAQIRGAVDLSLYPREGGVSSRELVKKVSDVIWNSLSRSYFKDRAHIQSLFSFITGWSPVGTKLDSSGVAFAVVGACQALGLRDVHLALSEDHAWVVFGPNGEQTAEVTWHGKGNEDRRGQTVNAGVAERSWLYLKGSYMRCDRKMEVAFMVCAINPSIDLHTDSLELLQLQQKLLWLLYDLGHLERYPMALGNLADLEELEPTPGRPDPLTLYHKGIASAKTYYRDEHIYPYMYLAGYHCRNRNVREALQAWADTATVIQDYNYCREDEEIYKEFFEVANDVIPNLLKEAASLLEAGEERPGEQSQGTQSQGSALQDPECFAHLLRFYDGICKWEEGSPTPVLHVGWATFLVQSLGRFEGQVRQKVRIVSREAEAAEAEEPWGEEAREGRRRGPRRESKPEEPPPPKKPALDKGLGTGQGAVSGPPRKPPGTVAGTARGPEGGSTAQVPAPAASPPPEGPVLTFQSEKMKGMKELLVATKINSSAIKLQLTAQSQVQMKKQKVSTPSDYTLSFLKRQRKGL
"
misc_feature 498..2342
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/note="Menin; Region: Menin; pfam05053"
/db_xref="CDD:191179"
misc_feature 1152..1682
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/experiment="experimental evidence, no additional details
recorded"
/note="propagated from UniProtKB/Swiss-Prot (O00255.4);
Region: Interaction with FANCD2"
misc_feature 1692..1694
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 2292..2294
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/experiment="experimental evidence, no additional details
recorded"
/note="Phosphothreonine; propagated from
UniProtKB/Swiss-Prot (O00255.4); phosphorylation site"
STS 513..767
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="REN56547"
/db_xref="UniSTS:381347"
STS 627..878
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="REN56546"
/db_xref="UniSTS:381346"
exon 958..1166
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
exon 1167..1295
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
exon 1296..1336
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
exon 1337..1424
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
exon 1425..1561
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
variation 1521
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2071312"
exon 1562..1697
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
exon 1698..1862
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
variation 1766
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:2071313"
exon 1863..3165
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/inference="alignment:Splign:1.39.8"
STS 1966..2198
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="REN56522"
/db_xref="UniSTS:381322"
variation 2133
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/replace="a"
/replace="g"
/db_xref="dbSNP:2959656"
STS 2175..2419
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="REN56521"
/db_xref="UniSTS:381321"
STS 2401..2629
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="REN56520"
/db_xref="UniSTS:381320"
STS 2595..2824
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="REN56519"
/db_xref="UniSTS:381319"
variation 2647
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1804849"
variation 2652
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/replace="g"
/replace="t"
/db_xref="dbSNP:1804848"
STS 2799..3060
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="REN56518"
/db_xref="UniSTS:381318"
STS 2876..3115
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/standard_name="A007D15"
/db_xref="UniSTS:36248"
variation 2998
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
/replace="c"
/replace="t"
/db_xref="dbSNP:1804850"
polyA_site 3165
/gene="MEN1"
/gene_synonym="MEAI; SCG2"
ORIGIN
caatccctgagtatctcgggaaggaggtgtccggagccgcggacctagagatcccagaagccacagcgcagcggcccggcccgccactatttccaggctcagcggggcaggggtgggcccagactccacttcccggcgggtagtgcgaccctaggggcgggacttcatgtcccagcaggctccgggcggcgtgcgccgcggtgcctagtgtgggatgtaagcgcggaggtgggcgagggggaccgaggccaggactctccttggggtttgggggcttgacctgggtgcgctttctggacagactttacagccccgggggcacagtcgtagagagggggcggggcggccattggggctcctcattggggtgcttggggcgcaccccatcgggtaccgggcgtcccggaattgtgggggacaaaaaggctctgcagtctcggctgaggggtctcaccgacaaaagaggggaagccggccgccgcccaccgcccgccgccatggggctgaaggccgcccagaagacgctgttcccgctgcgctccatcgacgacgtggtgcgcctgtttgctgccgagctgggccgagaggagccggacctggtgctcctttccttggtgctgggcttcgtggagcattttctggctgtcaaccgcgtcatccctaccaacgttcccgagctcaccttccagcccagccccgcccccgacccgcctggcggcctcacctactttcccgtggccgacctgtctatcatcgccgccctctatgcccgcttcaccgcccagatccgaggcgccgtcgacctgtccctctatcctcgagaagggggtgtctccagccgtgagctggtgaagaaggtctccgatgtcatatggaacagcctcagccgctcctacttcaaggatcgggcccacatccagtccctcttcagcttcatcacaggttggagcccagtaggcaccaaattggacagctccggtgtggcctttgctgtggttggggcctgccaggccctgggtctccgggatgtccacctcgccctgtctgaggatcatgcctgggtagtgtttgggcccaatggggagcagacagctgaggtcacctggcacggcaagggcaacgaggaccgcaggggccagacagtcaatgccggtgtggctgagcggagctggctgtacctgaaaggatcatacatgcgctgtgaccgcaagatggaggtggcgttcatggtgtgtgccatcaacccttccattgacctgcacaccgactcgctggagcttctgcagctgcagcagaagctgctctggctgctctatgacctgggacatctggaaaggtaccccatggccttagggaacctggcagatctagaggagctggagcccacccctggccggccagacccactcaccctctaccacaagggcattgcctcagccaagacctactatcgggatgaacacatctacccctacatgtacctggctggctaccactgtcgcaaccgcaatgtgcgggaagccctgcaggcctgggcggacacggccactgtcatccaggactacaactactgccgggaagacgaggagatctacaaggagttctttgaagtagccaatgatgtcatccccaacctgctgaaggaggcagccagcttgctggaggcgggcgaggagcggccgggggagcaaagccagggcacccagagccaaggttccgccctccaggaccctgagtgcttcgcccacctgctgcgattctacgacggcatctgcaaatgggaggagggcagtcccacgcctgtgctgcacgtgggctgggccacctttcttgtgcagtccctaggccgttttgagggacaggtgcggcagaaggtgcgcatagtgagccgagaggccgaggcggccgaggccgaggagccgtggggcgaggaagcccgggaaggccggcggcggggcccacggcgggagtccaagccagaggagcccccgccgcccaagaagccagcactggacaagggcctgggcaccggccagggtgcagtgtcaggacccccccggaagcctcctgggactgtcgctggcacagcccgaggccctgaaggtggcagcacggctcaggtgccagcacccgcagcatcaccaccgccggagggtccagtgctcactttccagagtgagaagatgaagggcatgaaggagctgctggtggccaccaagatcaactcgagcgccatcaagctgcaactcacggcacagtcgcaagtgcagatgaagaagcagaaagtgtccacccctagtgactacactctgtctttcctcaagcggcagcgcaaaggcctctgaactactggggacttcggaccgcttgtggggacccaggctccgcccttagtcccccaactctgagcccatgttctgcccccagcccaaaggggacaggcctcacctctacccaaaccctaggttcccggtcccgagtacagtctgtatcaaacccacgattttctccagctcagaacccagggctctgccccagtcgttagaatataggtctcttctcccagaatcccagccggccaatggaaacctcacgctgggtcctaattaccagtctttaaaggcccagcccctagaaacccaagctcctcctcggaaccgctcacctagagccagaccaacgttactcagggctcctcccagcttgtaggagctgaggtttcacccttaacccaaggagcacaggtcccacctccagcccgggagcctaggaccactcagcccctaggagtatatttccgcacttcagaattccatatcttgcgaatccaagctccctgccccaaataacttcagtcctgctccagaatttggaaatcctagtttcctctccttcgtatcccgagtctgggacacaaaactccgcccccagcctatgagcatcctgagccccgccctcttcctgacgaaactggccccggatcagagcaggacctcccttccgaccctctgggaacctcccagaggtccagcccatctcggagcatcccggaggaaatctgcagagggttaggagtgggtgacaagagcctgatctcttcctgttttgtacatagatttatttttcagttccaagaaagatgaatacattttgttaaaaaaaataaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:4221 -> Molecular function: GO:0000400 [four-way junction DNA binding] evidence: IDA
GeneID:4221 -> Molecular function: GO:0000403 [Y-form DNA binding] evidence: IDA
GeneID:4221 -> Molecular function: GO:0003682 [chromatin binding] evidence: IEA
GeneID:4221 -> Molecular function: GO:0003690 [double-stranded DNA binding] evidence: IDA
GeneID:4221 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:4221 -> Molecular function: GO:0018024 [histone-lysine N-methyltransferase activity] evidence: IDA
GeneID:4221 -> Molecular function: GO:0030674 [protein binding, bridging] evidence: IDA
GeneID:4221 -> Molecular function: GO:0043565 [sequence-specific DNA binding] evidence: IEA
GeneID:4221 -> Molecular function: GO:0044212 [transcription regulatory region DNA binding] evidence: IDA
GeneID:4221 -> Molecular function: GO:0047485 [protein N-terminus binding] evidence: IPI
GeneID:4221 -> Molecular function: GO:0070412 [R-SMAD binding] evidence: IPI
GeneID:4221 -> Biological process: GO:0000122 [negative regulation of transcription from RNA polymerase II promoter] evidence: IDA
GeneID:4221 -> Biological process: GO:0000165 [MAPK cascade] evidence: IDA
GeneID:4221 -> Biological process: GO:0001776 [leukocyte homeostasis] evidence: IEA
GeneID:4221 -> Biological process: GO:0001933 [negative regulation of protein phosphorylation] evidence: IDA
GeneID:4221 -> Biological process: GO:0002051 [osteoblast fate commitment] evidence: IEA
GeneID:4221 -> Biological process: GO:0002076 [osteoblast development] evidence: IGI
GeneID:4221 -> Biological process: GO:0006281 [DNA repair] evidence: NAS
GeneID:4221 -> Biological process: GO:0006338 [chromatin remodeling] evidence: IEA
GeneID:4221 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: TAS
GeneID:4221 -> Biological process: GO:0006367 [transcription initiation from RNA polymerase II promoter] evidence: TAS
GeneID:4221 -> Biological process: GO:0006974 [response to DNA damage stimulus] evidence: IDA
GeneID:4221 -> Biological process: GO:0007050 [cell cycle arrest] evidence: IEA
GeneID:4221 -> Biological process: GO:0007179 [transforming growth factor beta receptor signaling pathway] evidence: TAS
GeneID:4221 -> Biological process: GO:0007420 [brain development] evidence: IEA
GeneID:4221 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: IDA
GeneID:4221 -> Biological process: GO:0009411 [response to UV] evidence: IDA
GeneID:4221 -> Biological process: GO:0010332 [response to gamma radiation] evidence: IDA
GeneID:4221 -> Biological process: GO:0010467 [gene expression] evidence: TAS
GeneID:4221 -> Biological process: GO:0030097 [hemopoiesis] evidence: IEA
GeneID:4221 -> Biological process: GO:0030511 [positive regulation of transforming growth factor beta receptor signaling pathway] evidence: IMP
GeneID:4221 -> Biological process: GO:0031062 [positive regulation of histone methylation] evidence: IEA
GeneID:4221 -> Biological process: GO:0032092 [positive regulation of protein binding] evidence: IDA
GeneID:4221 -> Biological process: GO:0032925 [regulation of activin receptor signaling pathway] evidence: IEA
GeneID:4221 -> Biological process: GO:0034968 [histone lysine methylation] evidence: IDA
GeneID:4221 -> Biological process: GO:0043065 [positive regulation of apoptotic process] evidence: IEA
GeneID:4221 -> Biological process: GO:0043280 [positive regulation of cysteine-type endopeptidase activity involved in apoptotic process] evidence: IEA
GeneID:4221 -> Biological process: GO:0043433 [negative regulation of sequence-specific DNA binding transcription factor activity] evidence: IDA
GeneID:4221 -> Biological process: GO:0045668 [negative regulation of osteoblast differentiation] evidence: IGI
GeneID:4221 -> Biological process: GO:0045669 [positive regulation of osteoblast differentiation] evidence: IEA
GeneID:4221 -> Biological process: GO:0045736 [negative regulation of cyclin-dependent protein serine/threonine kinase activity] evidence: IMP
GeneID:4221 -> Biological process: GO:0045786 [negative regulation of cell cycle] evidence: IDA
GeneID:4221 -> Biological process: GO:0045892 [negative regulation of transcription, DNA-dependent] evidence: IDA
GeneID:4221 -> Biological process: GO:0045944 [positive regulation of transcription from RNA polymerase II promoter] evidence: TAS
GeneID:4221 -> Biological process: GO:0046329 [negative regulation of JNK cascade] evidence: IDA
GeneID:4221 -> Biological process: GO:0046621 [negative regulation of organ growth] evidence: IEA
GeneID:4221 -> Biological process: GO:0048704 [embryonic skeletal system morphogenesis] evidence: IEA
GeneID:4221 -> Biological process: GO:0051781 [positive regulation of cell division] evidence: IEA
GeneID:4221 -> Biological process: GO:0051974 [negative regulation of telomerase activity] evidence: IMP
GeneID:4221 -> Biological process: GO:0060021 [palate development] evidence: IEA
GeneID:4221 -> Biological process: GO:0060135 [maternal process involved in female pregnancy] evidence: IEA
GeneID:4221 -> Cellular component: GO:0000785 [chromatin] evidence: IDA
GeneID:4221 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:4221 -> Cellular component: GO:0005654 [nucleoplasm] evidence: TAS
GeneID:4221 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA
GeneID:4221 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
GeneID:4221 -> Cellular component: GO:0005829 [cytosol] evidence: IDA
GeneID:4221 -> Cellular component: GO:0016363 [nuclear matrix] evidence: IDA
GeneID:4221 -> Cellular component: GO:0032154 [cleavage furrow] evidence: IDA
GeneID:4221 -> Cellular component: GO:0035097 [histone methyltransferase complex] evidence: IDA
GeneID:4221 -> Cellular component: GO:0035097 [histone methyltransferase complex] evidence: IPI
GeneID:4221 -> Cellular component: GO:0043234 [protein complex] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.