2024-04-25 14:24:20, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_078480 1948 bp mRNA linear PRI 07-JUL-2013 DEFINITION Homo sapiens poly-U binding splicing factor 60KDa (PUF60), transcript variant 1, mRNA. ACCESSION NM_078480 VERSION NM_078480.2 GI:402794025 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 1948) AUTHORS Kajiwara,T., Matsushita,K., Itoga,S., Tamura,M., Tanaka,N., Tomonaga,T., Matsubara,H., Shimada,H., Habara,Y., Matsuo,M. and Nomura,F. TITLE SAP155-mediated c-myc suppressor far-upstream element-binding protein-interacting repressor splicing variants are activated in colon cancer tissues JOURNAL Cancer Sci. 104 (2), 149-156 (2013) PUBMED 23113893 REMARK GeneRIF: Circulating FIR variant mRNA in the peripheral blood of cancer patients were significantly overexpressed compared to that in healthy volunteers. REFERENCE 2 (bases 1 to 1948) AUTHORS Matsushita,K., Kajiwara,T., Tamura,M., Satoh,M., Tanaka,N., Tomonaga,T., Matsubara,H., Shimada,H., Yoshimoto,R., Ito,A., Kubo,S., Natsume,T., Levens,D., Yoshida,M. and Nomura,F. TITLE SAP155-mediated splicing of FUSE-binding protein-interacting repressor serves as a molecular switch for c-myc gene expression JOURNAL Mol. Cancer Res. 10 (6), 787-799 (2012) PUBMED 22496461 REMARK GeneRIF: Data indicate that altered FIR and c-myc pre-mRNA splicing, in addition to c-Myc expression by augmented FIR/FIRDeltaexon2-SAP155 complex, potentially contribute to colorectal cancer development. REFERENCE 3 (bases 1 to 1948) AUTHORS Hsiao,H.H., Nath,A., Lin,C.Y., Folta-Stogniew,E.J., Rhoades,E. and Braddock,D.T. TITLE Quantitative characterization of the interactions among c-myc transcriptional regulators FUSE, FBP, and FIR JOURNAL Biochemistry 49 (22), 4620-4634 (2010) PUBMED 20420426 REMARK GeneRIF: FIR is monomeric in solution but dimerizes upon DNA binding; DNA-induced dimerization is mediated by FIR's RNA recognition motif. REFERENCE 4 (bases 1 to 1948) AUTHORS Matsushita,K., Tomonaga,T., Kajiwara,T., Shimada,H., Itoga,S., Hiwasa,T., Kubo,S., Ochiai,T., Matsubara,H. and Nomura,F. TITLE c-myc suppressor FBP-interacting repressor for cancer diagnosis and therapy JOURNAL Front. Biosci. 14, 3401-3408 (2009) PUBMED 19273283 REMARK Publication Status: Online-Only REFERENCE 5 (bases 1 to 1948) AUTHORS Matsushita,K., Tomonaga,T., Shimada,H., Shioya,A., Higashi,M., Matsubara,H., Harigaya,K., Nomura,F., Libutti,D., Levens,D. and Ochiai,T. TITLE An essential role of alternative splicing of c-myc suppressor FUSE-binding protein-interacting repressor in carcinogenesis JOURNAL Cancer Res. 66 (3), 1409-1417 (2006) PUBMED 16452196 REFERENCE 6 (bases 1 to 1948) AUTHORS Poleev,A., Hartmann,A. and Stamm,S. TITLE A trans-acting factor, isolated by the three-hybrid system, that influences alternative splicing of the amyloid precursor protein minigene JOURNAL Eur. J. Biochem. 267 (13), 4002-4010 (2000) PUBMED 10866799 REFERENCE 7 (bases 1 to 1948) AUTHORS Liu,J., He,L., Collins,I., Ge,H., Libutti,D., Li,J., Egly,J.M. and Levens,D. TITLE The FBP interacting repressor targets TFIIH to inhibit activated transcription JOURNAL Mol. Cell 5 (2), 331-341 (2000) PUBMED 10882074 REFERENCE 8 (bases 1 to 1948) AUTHORS Bouffard,P., Barbar,E., Briere,F. and Boire,G. TITLE Interaction cloning and characterization of RoBPI, a novel protein binding to human Ro ribonucleoproteins JOURNAL RNA 6 (1), 66-78 (2000) PUBMED 10668799 REFERENCE 9 (bases 1 to 1948) AUTHORS Page-McCaw,P.S., Amonlirdviman,K. and Sharp,P.A. TITLE PUF60: a novel U2AF65-related splicing activity JOURNAL RNA 5 (12), 1548-1560 (1999) PUBMED 10606266 REFERENCE 10 (bases 1 to 1948) AUTHORS Bouffard,P., Briere,F., Wellinger,R.J. and Boire,G. TITLE Identification of ribonucleoprotein (RNP)-specific protein interactions using a yeast RNP interaction trap assay (RITA) JOURNAL BioTechniques 27 (4), 790-796 (1999) PUBMED 10524322 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from CN371576.1, AF114818.1, AF217197.2 and AW249619.1. On Sep 1, 2012 this sequence version replaced gi:17978511. Summary: This gene encodes a nucleic acid-binding protein that plays a role in a variety of nuclear processes, including pre-mRNA splicing and transcriptional regulation. The encoded protein forms a complex with the far upstream DNA element (FUSE) and FUSE-binding protein at the myelocytomatosis oncogene (MYC) promoter. This complex represses MYC transcription through the core-TFIIH basal transcription factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]. Transcript Variant: This variant (1) encodes the longest isoform (a). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AF114818.1, AF190744.1 [ECO:0000332] RNAseq introns :: mixed/partial sample support ERS025081, ERS025082 [ECO:0000350] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-19 CN371576.1 4-22 20-451 AF114818.1 1-432 452-1906 AF217197.2 328-1782 1907-1948 AW249619.1 1-42 c FEATURES Location/Qualifiers source 1..1948 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8q24.3" gene 1..1948 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="poly-U binding splicing factor 60KDa" /db_xref="GeneID:22827" /db_xref="HGNC:17042" /db_xref="HPRD:18051" /db_xref="MIM:604819" exon 1..107 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" CDS 84..1763 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="isoform a is encoded by transcript variant 1; FBP interacting repressor; pyrimidine tract binding splicing factor; Ro ribonucleoprotein-binding protein 1; FUSE-binding protein-interacting repressor; poly(U)-binding-splicing factor PUF60; Siah binding protein 1" /codon_start=1 /product="poly(U)-binding-splicing factor PUF60 isoform a" /protein_id="NP_510965.1" /db_xref="GI:17978512" /db_xref="CCDS:CCDS47934.1" /db_xref="GeneID:22827" /db_xref="HGNC:17042" /db_xref="HPRD:18051" /db_xref="MIM:604819" /translation="
MATATIALQVNGQQGGGSEPAAAAAVVAAGDKWKPPQGTDSIKMENGQSTAAKLGLPPLTPEQQEALQKAKKYAMEQSIKSVLVKQTIAHQQQQLTNLQMAAVTMGFGDPLSPLQSMAAQRQRALAIMCRVYVGSIYYELGEDTIRQAFAPFGPIKSIDMSWDSVTMKHKGFAFVEYEVPEAAQLALEQMNSVMLGGRNIKVGRPSNIGQAQPIIDQLAEEARAFNRIYVASVHQDLSDDDIKSVFEAFGKIKSCTLARDPTTGKHKGYGFIEYEKAQSSQDAVSSMNLFDLGGQYLRVGKAVTPPMPLLTPATPGGLPPAAAVAAAAATAKITAQEAVAGAAVLGTLGTPGLVSPALTLAQPLGTLPQAVMAAQAPGVITGVTPARPPIPVTIPSVGVVNPILASPPTLGLLEPKKEKEEEELFPESERPEMLSEQEHMSISGSSARHMVMQKLLRKQESTVMVLRNMVDPKDIDDDLEGEVTEECGKFGAVNRVIIYQEKQGEEEDAEIIVKIFVEFSIASETHKAIQALNGRWFAGRKVVAEVYDQERFDNSDLSA
" misc_feature 84..1631 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); Region: Inhibits homodimerization" misc_feature 102..>986 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="poly-U binding splicing factor, half-pint family; Region: half-pint; TIGR01645" /db_xref="CDD:130706" misc_feature 261..263 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); phosphorylation site" misc_feature <267..>542 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="P-loop containing Nucleoside Triphosphate Hydrolases; Region: P-loop_NTPase; cl09099" /db_xref="CDD:214148" misc_feature 312..1760 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); Region: Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction" misc_feature 417..419 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); phosphorylation site" misc_feature 471..695 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM (RNA recognition motif), also known as RBD (RNA binding domain) or RNP (ribonucleoprotein domain), is a highly abundant domain in eukaryotes found in proteins involved in post-transcriptional gene expression processes including mRNA and rRNA...; Region: RRM; cd00590" /db_xref="CDD:100104" misc_feature order(477..479,597..599,603..605) /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RNA/DNA binding site [nucleotide binding]; other site" /db_xref="CDD:100104" misc_feature 687..695 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM dimerization site [polypeptide binding]; other site" /db_xref="CDD:100104" misc_feature 762..986 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM (RNA recognition motif), also known as RBD (RNA binding domain) or RNP (ribonucleoprotein domain), is a highly abundant domain in eukaryotes found in proteins involved in post-transcriptional gene expression processes including mRNA and rRNA...; Region: RRM; cd00590" /db_xref="CDD:100104" misc_feature order(768..770,888..890,894..896) /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RNA/DNA binding site [nucleotide binding]; other site" /db_xref="CDD:100104" misc_feature 834..836 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); acetylation site" misc_feature 978..986 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM dimerization site [polypeptide binding]; other site" /db_xref="CDD:100104" misc_feature 1023..1025 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="Phosphothreonine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); phosphorylation site" misc_feature 1443..1445 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /experiment="experimental evidence, no additional details recorded" /note="N6-acetyllysine; propagated from UniProtKB/Swiss-Prot (Q9UHX1.1); acetylation site" misc_feature 1497..1718 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM (RNA recognition motif), also known as RBD (RNA binding domain) or RNP (ribonucleoprotein domain), is a highly abundant domain in eukaryotes found in proteins involved in post-transcriptional gene expression processes including mRNA and rRNA...; Region: RRM; cd00590" /db_xref="CDD:100104" misc_feature order(1623..1625,1629..1631) /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RNA/DNA binding site [nucleotide binding]; other site" /db_xref="CDD:100104" misc_feature 1713..1718 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /note="RRM dimerization site [polypeptide binding]; other site" /db_xref="CDD:100104" exon 108..194 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" variation 164 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /replace="a" /replace="g" /db_xref="dbSNP:11540342" exon 195..290 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 291..380 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 381..431 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" variation 422 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /replace="g" /replace="t" /db_xref="dbSNP:11540341" exon 432..593 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" variation 518 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /replace="c" /replace="t" /db_xref="dbSNP:11540345" exon 594..686 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 687..900 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 901..1091 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" variation 998 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /replace="c" /replace="g" /db_xref="dbSNP:11540343" exon 1092..1227 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 1228..1463 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" exon 1464..1939 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /inference="alignment:Splign:1.39.8" STS 1561..1811 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /standard_name="WI-19511" /db_xref="UniSTS:31309" STS 1752..1895 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" /standard_name="RH70666" /db_xref="UniSTS:37443" polyA_site 1906 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" polyA_site 1939 /gene="PUF60" /gene_synonym="FIR; RoBPI; SIAHBP1" ORIGIN
tccgtgcaccggcacccagatcgcgcgagacagcggaaggagcaagagtgggaggcgcgcgcggaggccgcgacggacgcaagatggcgacggcgaccatagctctccaggtcaatggccagcaaggaggggggtccgagccggcggcggcggcggcagtggtggcagcgggagacaaatggaaacctccacagggcacagactccatcaagatggagaacgggcagagcacagccgccaagctggggctgcctcccctgacgcccgagcagcaggaggcccttcagaaggccaagaagtacgccatggagcagagcatcaagagtgtgctggtgaagcagaccatcgcgcaccagcagcagcagctcaccaacctgcagatggcagcagtgacaatgggctttggagatcctctctcacctttgcaatcgatggcggctcagcggcagcgggcgctggccatcatgtgccgcgtctacgtgggctctatctactatgagctgggggaggacaccatccgccaggcctttgccccctttggccccatcaagagcatcgacatgtcctgggactccgtcaccatgaagcacaagggctttgccttcgtggagtatgaggtccccgaagctgcacagctggccttggagcagatgaactcggtgatgctggggggcaggaacatcaaggtgggcagacccagcaacatagggcaggcccagcccatcatagaccagttggctgaggaggcacgggccttcaaccgcatctacgtggcctctgtgcaccaggacctctcagacgatgacatcaagagcgtgtttgaggcctttggcaagatcaagtcctgcacactggcccgggaccccacaactggcaagcacaagggctacggcttcattgagtacgagaaggcccagtcgtcccaagatgctgtgtcttccatgaacctctttgacctgggtggccagtacttgcgggtgggcaaggctgtcacaccgcccatgcccctactcacaccagccacgcctggaggcctcccacctgccgctgctgtggcagctgctgcagccactgccaagatcacagctcaggaagcagtggccggagcagcggtgctgggtaccctgggcacacctggactggtgtccccagcactgaccctggcccagcccctgggcactttgccccaggctgtcatggctgcccaggcacctggagtcatcacaggtgtgaccccagcccgtcctcctatcccggtcaccatcccctcggtgggagtggtgaaccccatcctggccagccctccaacgctgggtctcctggagcccaagaaggagaaggaagaagaggagctgtttcccgagtcagagcggccagagatgctgagcgagcaggagcacatgagcatctcgggcagtagcgcccgacacatggtgatgcagaagctgctccgcaagcaggagtctacagtgatggttctgcgcaacatggtggaccccaaggacatcgatgatgacctggaaggggaggtgacagaggagtgtggcaagttcggggccgtgaaccgcgtcatcatctaccaagagaaacaaggcgaggaggaggatgcagaaatcattgtcaagatctttgtggagttttccatagcctctgagactcataaggccatccaggccctcaatggccgctggtttgctggccgcaaggtggtggctgaagtgtacgaccaggagcgttttgataacagtgacctctctgcgtgacagtggtccctctccccggacttgcacttgttccttgtttcctctgggttttatagtgatacagtggtgtccccggggccaggcgcgctctgcccagcccagcctacagtgcggataaaggtgcggatgctgctggccctgaacgtccgtgtgtctgccgtcggtcctgtcaccgaaaaaaaaaa
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:22827 -> Molecular function: GO:0000166 [nucleotide binding] evidence: IEA GeneID:22827 -> Molecular function: GO:0003677 [DNA binding] evidence: IEA GeneID:22827 -> Molecular function: GO:0003723 [RNA binding] evidence: IEA GeneID:22827 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:22827 -> Biological process: GO:0006351 [transcription, DNA-dependent] evidence: IEA GeneID:22827 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: IEA GeneID:22827 -> Biological process: GO:0006397 [mRNA processing] evidence: IEA GeneID:22827 -> Biological process: GO:0006915 [apoptotic process] evidence: IEA GeneID:22827 -> Biological process: GO:0008380 [RNA splicing] evidence: IEA GeneID:22827 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:22827 -> Cellular component: GO:0005730 [nucleolus] evidence: IDA GeneID:22827 -> Cellular component: GO:0019907 [cyclin-dependent protein kinase activating kinase holoenzyme complex] evidence: IDA GeneID:22827 -> Cellular component: GO:0030529 [ribonucleoprotein complex] evidence: IEA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.