2024-04-26 01:27:49, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_057157 2245 bp mRNA linear PRI 15-JUN-2013 DEFINITION Homo sapiens cytochrome P450, family 26, subfamily A, polypeptide 1 (CYP26A1), transcript variant 2, mRNA. ACCESSION NM_057157 VERSION NM_057157.2 GI:189339192 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2245) AUTHORS Verhoeven,V.J., Hysi,P.G., Wojciechowski,R., Fan,Q., Guggenheim,J.A., Hohn,R., MacGregor,S., Hewitt,A.W., Nag,A., Cheng,C.Y., Yonova-Doing,E., Zhou,X., Ikram,M.K., Buitendijk,G.H., McMahon,G., Kemp,J.P., Pourcain,B.S., Simpson,C.L., Makela,K.M., Lehtimaki,T., Kahonen,M., Paterson,A.D., Hosseini,S.M., Wong,H.S., Xu,L., Jonas,J.B., Parssinen,O., Wedenoja,J., Yip,S.P., Ho,D.W., Pang,C.P., Chen,L.J., Burdon,K.P., Craig,J.E., Klein,B.E., Klein,R., Haller,T., Metspalu,A., Khor,C.C., Tai,E.S., Aung,T., Vithana,E., Tay,W.T., Barathi,V.A., Chen,P., Li,R., Liao,J., Zheng,Y., Ong,R.T., Doring,A., Evans,D.M., Timpson,N.J., Verkerk,A.J., Meitinger,T., Raitakari,O., Hawthorne,F., Spector,T.D., Karssen,L.C., Pirastu,M., Murgia,F., Ang,W., Mishra,A., Montgomery,G.W., Pennell,C.E., Cumberland,P.M., Cotlarciuc,I., Mitchell,P., Wang,J.J., Schache,M., Janmahasathian,S., Igo,R.P. Jr., Lass,J.H., Chew,E., Iyengar,S.K., Gorgels,T.G., Rudan,I., Hayward,C., Wright,A.F., Polasek,O., Vatavuk,Z., Wilson,J.F., Fleck,B., Zeller,T., Mirshahi,A., Muller,C., Uitterlinden,A.G., Rivadeneira,F., Vingerling,J.R., Hofman,A., Oostra,B.A., Amin,N., Bergen,A.A., Teo,Y.Y., Rahi,J.S., Vitart,V., Williams,C., Baird,P.N., Wong,T.Y., Oexle,K., Pfeiffer,N., Mackey,D.A., Young,T.L., van Duijn,C.M., Saw,S.M., Bailey-Wilson,J.E., Stambolian,D., Klaver,C.C. and Hammond,C.J. CONSRTM Consortium for Refractive Error and Myopia (CREAM); Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications (DCCT/EDIC) Research Group; Wellcome Trust Case Control Consortium 2 (WTCCC2); Fuchs' Genetics Multi-Center Study Group TITLE Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia JOURNAL Nat. Genet. 45 (3), 314-318 (2013) PUBMED 23396134 REFERENCE 2 (bases 1 to 2245) AUTHORS Topletz,A.R., Thatcher,J.E., Zelter,A., Lutz,J.D., Tay,S., Nelson,W.L. and Isoherranen,N. TITLE Comparison of the function and expression of CYP26A1 and CYP26B1, the two retinoic acid hydroxylases JOURNAL Biochem. Pharmacol. 83 (1), 149-163 (2012) PUBMED 22020119 REMARK GeneRIF: CYP26A1 and CYP26B1 are qualitatively similar retinoic acid hydroxylases with overlapping expression profiles; CYP26A1 has higher catalytic activity than CYP26B1. REFERENCE 3 (bases 1 to 2245) AUTHORS Osanai,M. and Lee,G.H. TITLE Enhanced expression of retinoic acid-metabolizing enzyme CYP26A1 in sunlight-damaged human skin JOURNAL Med Mol Morphol 44 (4), 200-206 (2011) PUBMED 22179182 REMARK GeneRIF: Our observation suggests an involvement of enhanced CYP26A1 expression causing a functional vitamin A deficieny state in skin that can potentially lead to neoplastic transformation of keratinocytes in an early phase during skin carcinogenesis REFERENCE 4 (bases 1 to 2245) AUTHORS Pascual,M., Suzuki,M., Isidoro-Garcia,M., Padron,J., Turner,T., Lorente,F., Davila,I. and Greally,J.M. TITLE Epigenetic changes in B lymphocytes associated with house dust mite allergic asthma JOURNAL Epigenetics 6 (9), 1131-1137 (2011) PUBMED 21975512 REMARK GeneRIF: The promoter region of CYP26A1 is significantly hypermethylated in allergic asthmatic subjects. REFERENCE 5 (bases 1 to 2245) AUTHORS Meire,F., Delpierre,I., Brachet,C., Roulez,F., Van Nechel,C., Depasse,F., Christophe,C., Menten,B. and De Baere,E. TITLE Nonsyndromic bilateral and unilateral optic nerve aplasia: first familial occurrence and potential implication of CYP26A1 and CYP26C1 genes JOURNAL Mol. Vis. 17, 2072-2079 (2011) PUBMED 21850183 REMARK GeneRIF: CYP26A1 and CYP26C1 play a pivotal role in the pathogenesis of nonsyndromic bilateral and unilateral optic nerve aplasia. REFERENCE 6 (bases 1 to 2245) AUTHORS Nelson,D.R., Zeldin,D.C., Hoffman,S.M., Maltais,L.J., Wain,H.M. and Nebert,D.W. TITLE Comparison of cytochrome P450 (CYP) genes from the mouse and human genomes, including nomenclature recommendations for genes, pseudogenes and alternative-splice variants JOURNAL Pharmacogenetics 14 (1), 1-18 (2004) PUBMED 15128046 REMARK Review article REFERENCE 7 (bases 1 to 2245) AUTHORS White,J.A., Beckett,B., Scherer,S.W., Herbrick,J.A. and Petkovich,M. TITLE P450RAI (CYP26A1) maps to human chromosome 10q23-q24 and mouse chromosome 19C2-3 JOURNAL Genomics 48 (2), 270-272 (1998) PUBMED 9521883 REFERENCE 8 (bases 1 to 2245) AUTHORS Ray,W.J., Bain,G., Yao,M. and Gottlieb,D.I. TITLE CYP26, a novel mammalian cytochrome P450, is induced by retinoic acid and defines a new family JOURNAL J. Biol. Chem. 272 (30), 18702-18708 (1997) PUBMED 9228041 REFERENCE 9 (bases 1 to 2245) AUTHORS White,J.A., Beckett-Jones,B., Guo,Y.D., Dilworth,F.J., Bonasoro,J., Jones,G. and Petkovich,M. TITLE cDNA cloning of human retinoic acid-metabolizing enzyme (hP450RAI) identifies a novel family of cytochromes P450 JOURNAL J. Biol. Chem. 272 (30), 18538-18541 (1997) PUBMED 9228017 REFERENCE 10 (bases 1 to 2245) AUTHORS Duell,E.A., Kang,S. and Voorhees,J.J. TITLE Retinoic acid isomers applied to human skin in vivo each induce a 4-hydroxylase that inactivates only trans retinoic acid JOURNAL J. Invest. Dermatol. 106 (2), 316-320 (1996) PUBMED 8601734 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from AL358613.16. On Jun 4, 2008 this sequence version replaced gi:16933527. Summary: This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein acts on retinoids, including all-trans-retinoic acid (RA), with both 4-hydroxylation and 18-hydroxylation activities. This enzyme regulates the cellular level of retinoic acid which is involved in regulation of gene expression in both embryonic and adult tissues. Two alternatively spliced transcript variants of this gene, which encode the distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (2) contains an alternate 5' end region, which doesn't contain an in-frame translation start codon, when compared to variant 1. Translation thus begins at a downstream start codon, and results in a N-terminal truncated protein, as compared to isoform 1. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: AK027560.1 [ECO:0000332] ##Evidence-Data-END## COMPLETENESS: complete on the 3' end. PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-360 AL358613.16 23107-23466 361-585 AL358613.16 23940-24164 586-876 AL358613.16 24411-24701 877-1035 AL358613.16 24781-24939 1036-1170 AL358613.16 25458-25592 1171-1323 AL358613.16 26176-26328 1324-2245 AL358613.16 26595-27516 FEATURES Location/Qualifiers source 1..2245 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="10" /map="10q23-q24" gene 1..2245 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /note="cytochrome P450, family 26, subfamily A, polypeptide 1" /db_xref="GeneID:1592" /db_xref="HGNC:2603" /db_xref="HPRD:03759" /db_xref="MIM:602239" exon 1..360 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 86 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:371007952" variation 88 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:369720016" variation 181 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:72558182" variation 214 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:373431017" variation 265 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:111361951" misc_feature 340..342 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /note="upstream in-frame stop codon" exon 361..585 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 378 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:376312852" CDS 379..1665 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /EC_number="1.14.-.-" /note="isoform 2 is encoded by transcript variant 2; P450, retinoic acid-inactivating, 1; retinoic acid-metabolizing cytochrome; retinoic acid 4-hydroxylase; cytochrome P450, subfamily XXVIA, polypeptide 1; cytochrome P450 26A1; hP450RAI; cytochrome P450RAI; cytochrome P450 retinoic acid-inactivating 1" /codon_start=1 /product="cytochrome P450 26A1 isoform 2" /protein_id="NP_476498.1" /db_xref="GI:16933528" /db_xref="CCDS:CCDS7427.1" /db_xref="GeneID:1592" /db_xref="HGNC:2603" /db_xref="HPRD:03759" /db_xref="MIM:602239" /translation="
MKRRKYGFIYKTHLFGRPTVRVMGADNVRRILLGEHRLVSVHWPASVRTILGSGCLSNLHDSSHKQRKKVIMRAFSREALECYVPVITEEVGSSLEQWLSCGERGLLVYPEVKRLMFRIAMRILLGCEPQLAGDGDSEQQLVEAFEEMTRNLFSLPIDVPFSGLYRGMKARNLIHARIEQNIRAKICGLRASEAGQGCKDALQLLIEHSWERGERLDMQALKQSSTELLFGGHETTASAATSLITYLGLYPHVLQKVREELKSKGLLCKSNQDNKLDMEILEQLKYIGCVIKETLRLNPPVPGGFRVALKTFELNGYQIPKGWNVIYSICDTHDVAEIFTNKEEFNPDRFMLPHPEDASRFSFIPFGGGLRSCVGKEFAKILLKIFTVELARHCDWQLLNGPPTMKTSPTVYPVDNLPARFTHFHGEI
" misc_feature 388..1644 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /note="Cytochrome P450 [Secondary metabolites biosynthesis, transport, and catabolism]; Region: CypX; cl12078" /db_xref="CDD:212625" misc_feature 1495..1497 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /note="heme binding site" variation 393 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140561960" variation 462 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:182251373" variation 494 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:199888287" variation 540 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:150026228" variation 573 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:145329305" variation 578 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140932042" exon 586..876 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 603 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:60549655" variation 618 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:35355587" variation 628 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140213678" variation 645 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:143605675" variation 649 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:374370768" variation 659 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:73319394" variation 662 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:148053802" variation 666 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:141743098" variation 671 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /replace="t" /db_xref="dbSNP:150571738" variation 682 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:138806671" variation 684 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:143939065" variation 688 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:61735552" variation 718 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:368680474" variation 719 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:200654050" variation 720 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:199767327" variation 735 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:372113028" variation 750 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140717057" variation 767 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:75690427" variation 784 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:371233600" variation 802 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="g" /replace="t" /db_xref="dbSNP:149343022" variation 824 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:374294057" exon 877..1035 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 877 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:79622881" variation 880 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:368110826" variation 888 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:200805136" variation 913 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:200516628" variation 917 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:367762887" variation 922 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:370074492" variation 960 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:367860330" variation 961 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:144846699" variation 1014 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:201685188" variation 1031 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:56956463" exon 1036..1170 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 1084 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:74435030" variation 1085 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:142962735" variation 1153 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:369951759" exon 1171..1323 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 1198 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:376570347" variation 1243 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:146619916" variation 1272 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:370584989" variation 1273 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:140125959" variation 1276 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:377406709" variation 1297 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:370744399" variation 1302 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:374596674" variation 1305 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:35768328" variation 1315 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:202094176" exon 1324..2245 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /inference="alignment:Splign:1.39.8" variation 1354 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /replace="g" /db_xref="dbSNP:200904706" variation 1362 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:73319400" variation 1379 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:200246602" variation 1407 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:202120226" variation 1479 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="t" /db_xref="dbSNP:186901298" variation 1485 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:2229104" variation 1493 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:140117559" variation 1500 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:144194304" variation 1501 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:371966523" variation 1546 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:146552397" variation 1614 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:375225582" variation 1661 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:200820945" polyA_signal 1836..1841 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" variation 1851 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="g" /db_xref="dbSNP:192234280" polyA_site 1856 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" variation 1858..1859 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="" /replace="t" /db_xref="dbSNP:34739947" variation 1858 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="g" /db_xref="dbSNP:184072831" variation 2075 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:4917998" variation 2091 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:187859329" variation 2137 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="a" /replace="c" /db_xref="dbSNP:149158167" variation 2181 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" /replace="c" /replace="t" /db_xref="dbSNP:41290188" polyA_signal 2225..2230 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" polyA_site 2245 /gene="CYP26A1" /gene_synonym="CP26; CYP26; P450RAI; P450RAI1" ORIGIN
cggcacctggaaatggaaagccagtgaaggctgctttgggccggggcagcgggtgggaccgggcgggagggattccaaagagaccgccgggaaggctagagcttggaattccggctcctcggagtcctggccctcccccaccgccgcctcggagctcagcacaccttggatgggggaggcgggcagctcctagccccgcaccccaggaggcgcgctcggagggaagccgccaccgcgccgcctctgcctcggcgcggaacaaacggttaaagattttgggcagcgcctcgcggggggaggagccaggggcccaatccgcaattaaagatgaactttgggtgaactaattgtctgaccaagcggaggaagttcctgcagatgaagcgcaggaaatacggcttcatctacaagacgcatctgttcgggcggcccaccgtacgggtgatgggcgcggacaatgtgcggcgcatcttgctcggagagcaccggctggtgtcggtccactggccagcgtcggtgcgcaccattctgggatctggctgcctctctaacctgcacgactcctcgcacaagcagcgcaagaaggtgattatgcgggccttcagccgcgaggcactcgaatgctacgtgccggtgatcaccgaggaagtgggcagcagcctggagcagtggctgagctgcggcgagcgcggcctcctggtctaccccgaggtgaagcgcctcatgttccgaatcgccatgcgcatcctactgggctgcgaaccccaactggcgggcgacggggactccgagcagcagcttgtggaggccttcgaggaaatgacccgcaatctcttctcgctgcccatcgacgtgcccttcagcgggctgtaccggggcatgaaggcgcggaacctcattcacgcgcgcatcgagcagaacattcgcgccaagatctgcgggctgcgggcatccgaggcgggccagggctgcaaagacgcgctgcagctgttgatcgagcactcgtgggagaggggagagcggctggacatgcaggcactaaagcaatcttcaaccgaactcctctttggaggacacgaaaccacggccagtgcagccacatctctgatcacttacctggggctctacccacatgttctccagaaagtgcgagaagagctgaagagtaagggtttactttgcaagagcaatcaagacaacaagttggacatggaaattttggaacaacttaaatacatcgggtgtgttattaaggagacccttcgactgaatcccccagttccaggagggtttcgggttgctctgaagacttttgaattaaatggataccagattcccaagggctggaatgttatctacagtatctgtgatactcatgatgtggcagagatcttcaccaacaaggaagaatttaatcctgaccgattcatgctgcctcacccagaggatgcatccaggttcagcttcattccatttggaggaggccttaggagctgtgtaggcaaagaatttgcaaaaattcttctcaaaatatttacagtggagctggccaggcattgtgactggcagcttctaaatggacctcctacaatgaaaaccagtcccaccgtgtatcctgtggacaatctccctgcaagattcacccatttccatggggaaatctgatgagcttgaatgttcaaacctgagacttattggaagtgtacatatgagtttttaaggagtgttgtgttgactttatatttaatttctaaatgtatattataatatttatgtgttttgactatactaccacaatctttaaatattaaaataatgaatttgtatcatttccaaataaagtaaaatttgaaggtacttttctggtattttaagattcctgttgggtaaaactcaccagtttagtattttcttagtgtatttaaccagattttacaatgcctacctggacttatttgtcatctttgcatctgttttctgtgagaagaaatcttagctgttttttatgttaacagttattagaaaatatatgtctgtgtgtgttattccagacgtatctctgtaaattcttctacagtcacttagattccctatttggaaaattgatccaagttaatttaatttttttttggtttgctgtactttagggaaagatgaacctgaaaaggtaacactgagaactgtcactctaacctctccagcttatctaacatgtcataaacataataaatctgtgttgtccaat
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:1592 -> Molecular function: GO:0001972 [retinoic acid binding] evidence: IDA GeneID:1592 -> Molecular function: GO:0005506 [iron ion binding] evidence: IEA GeneID:1592 -> Molecular function: GO:0008401 [retinoic acid 4-hydroxylase activity] evidence: IDA GeneID:1592 -> Molecular function: GO:0009055 [electron carrier activity] evidence: IEA GeneID:1592 -> Molecular function: GO:0019825 [oxygen binding] evidence: TAS GeneID:1592 -> Molecular function: GO:0020037 [heme binding] evidence: NAS GeneID:1592 -> Biological process: GO:0006766 [vitamin metabolic process] evidence: TAS GeneID:1592 -> Biological process: GO:0006805 [xenobiotic metabolic process] evidence: TAS GeneID:1592 -> Biological process: GO:0007417 [central nervous system development] evidence: IEA GeneID:1592 -> Biological process: GO:0008152 [metabolic process] evidence: TAS GeneID:1592 -> Biological process: GO:0009952 [anterior/posterior pattern specification] evidence: IEA GeneID:1592 -> Biological process: GO:0014032 [neural crest cell development] evidence: IEA GeneID:1592 -> Biological process: GO:0034653 [retinoic acid catabolic process] evidence: IDA GeneID:1592 -> Biological process: GO:0044281 [small molecule metabolic process] evidence: TAS GeneID:1592 -> Biological process: GO:0048384 [retinoic acid receptor signaling pathway] evidence: IEA GeneID:1592 -> Biological process: GO:0048387 [negative regulation of retinoic acid receptor signaling pathway] evidence: TAS GeneID:1592 -> Biological process: GO:0071300 [cellular response to retinoic acid] evidence: IEA GeneID:1592 -> Cellular component: GO:0005789 [endoplasmic reticulum membrane] evidence: TAS ANNOTATIONS from NCBI Entrez Gene (20130726): NP_476498 -> EC 1.14.-.-
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.