GGRNA Home | Help | Advanced search

2020-10-24 06:39:41, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_052957               3178 bp    mRNA    linear   PRI 17-APR-2013
DEFINITION  Homo sapiens acidic repeat containing (ACRC), mRNA.
ACCESSION   NM_052957
VERSION     NM_052957.4  GI:218777841
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 3178)
  AUTHORS   Kimura,K., Wakamatsu,A., Suzuki,Y., Ota,T., Nishikawa,T.,
            Yamashita,R., Yamamoto,J., Sekine,M., Tsuritani,K., Wakaguri,H.,
            Ishii,S., Sugiyama,T., Saito,K., Isono,Y., Irie,R., Kushida,N.,
            Yoneyama,T., Otsuka,R., Kanda,K., Yokoi,T., Kondo,H., Wagatsuma,M.,
            Murakawa,K., Ishida,S., Ishibashi,T., Takahashi-Fujii,A.,
            Tanase,T., Nagai,K., Kikuchi,H., Nakai,K., Isogai,T. and Sugano,S.
  TITLE     Diversification of transcriptional modulation: large-scale
            identification and characterization of putative alternative
            promoters of human genes
  JOURNAL   Genome Res. 16 (1), 55-65 (2006)
   PUBMED   16344560
REFERENCE   2  (bases 1 to 3178)
  AUTHORS   Strausberg,R.L., Feingold,E.A., Grouse,L.H., Derge,J.G.,
            Klausner,R.D., Collins,F.S., Wagner,L., Shenmen,C.M., Schuler,G.D.,
            Altschul,S.F., Zeeberg,B., Buetow,K.H., Schaefer,C.F., Bhat,N.K.,
            Hopkins,R.F., Jordan,H., Moore,T., Max,S.I., Wang,J., Hsieh,F.,
            Diatchenko,L., Marusina,K., Farmer,A.A., Rubin,G.M., Hong,L.,
            Stapleton,M., Soares,M.B., Bonaldo,M.F., Casavant,T.L.,
            Scheetz,T.E., Brownstein,M.J., Usdin,T.B., Toshiyuki,S.,
            Carninci,P., Prange,C., Raha,S.S., Loquellano,N.A., Peters,G.J.,
            Abramson,R.D., Mullahy,S.J., Bosak,S.A., McEwan,P.J.,
            McKernan,K.J., Malek,J.A., Gunaratne,P.H., Richards,S.,
            Worley,K.C., Hale,S., Garcia,A.M., Gay,L.J., Hulyk,S.W.,
            Villalon,D.K., Muzny,D.M., Sodergren,E.J., Lu,X., Gibbs,R.A.,
            Fahey,J., Helton,E., Ketteman,M., Madan,A., Rodrigues,S.,
            Sanchez,A., Whiting,M., Madan,A., Young,A.C., Shevchenko,Y.,
            Bouffard,G.G., Blakesley,R.W., Touchman,J.W., Green,E.D.,
            Dickson,M.C., Rodriguez,A.C., Grimwood,J., Schmutz,J., Myers,R.M.,
            Butterfield,Y.S., Krzywinski,M.I., Skalska,U., Smailus,D.E.,
            Schnerch,A., Schein,J.E., Jones,S.J. and Marra,M.A.
  CONSRTM   Mammalian Gene Collection Program Team
  TITLE     Generation and initial analysis of more than 15,000 full-length
            human and mouse cDNA sequences
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 99 (26), 16899-16903 (2002)
   PUBMED   12477932
REFERENCE   3  (bases 1 to 3178)
  AUTHORS   Nolte,D., Ramser,J., Niemann,S., Lehrach,H., Sudbrak,R. and
            Muller,U.
  TITLE     ACRC codes for a novel nuclear protein with unusual acidic repeat
            tract and maps to DYT3 (dystonia parkinsonism) critical interval in
            xq13.1
  JOURNAL   Neurogenetics 3 (4), 207-213 (2001)
   PUBMED   11714101
COMMENT     VALIDATED REFSEQ: This record has undergone validation or
            preliminary review. The reference sequence was derived from
            DB073623.1, AK097433.1 and AJ311392.1.
            On Dec 25, 2008 this sequence version replaced gi:142356086.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK097433.1, BC136259.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025085 [ECO:0000348]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-387               DB073623.1         35-421
            388-2756            AK097433.1         2-2370
            2757-2757           AJ311392.1         2258-2258
            2758-3178           AK097433.1         2372-2792
FEATURES             Location/Qualifiers
     source          1..3178
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="X"
                     /map="Xq13.1"
     gene            1..3178
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /note="acidic repeat containing"
                     /db_xref="GeneID:93953"
                     /db_xref="HGNC:15805"
                     /db_xref="HPRD:02298"
                     /db_xref="MIM:300369"
     exon            1..499
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       58
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:181264953"
     variation       131
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:149316740"
     misc_feature    208..210
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /note="upstream in-frame stop codon"
     variation       384
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:185329642"
     exon            500..560
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     CDS             502..2577
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /note="putative nuclear protein"
                     /codon_start=1
                     /product="acidic repeat-containing protein"
                     /protein_id="NP_443189.1"
                     /db_xref="GI:16445033"
                     /db_xref="CCDS:CCDS35326.1"
                     /db_xref="GeneID:93953"
                     /db_xref="HGNC:15805"
                     /db_xref="HPRD:02298"
                     /db_xref="MIM:300369"
                     /translation="
MDGCKKELPRLQEPEEDEDCYILNVQSSSDDTSGSSVARRAPKRQASCILNVQSRSGDTSGSSVARRAPKRQASSVVVIDSDSDEECHTHEEKKAKLLEINSDDESPECCHVKPAIQEPPIVISDDDNDDDNGNDLEVPDDNSDDSEAPDDNSDDSEAPDDNSDDSEAPDDNSDDSEAPDDNSDDSDVPDDNSDDSSDDNSDDSSDDNSDDSDVPDDKSDDSDVPDDSSDDSDVPDDSSDDSEAPDDSSDDSEAPDDSSDDSEAPDDSSDDSEAPDDSSDDSEASDDSSDDSEASDDSSDDSEAPDDKSDDSDVPEDKSDDSDVPDDNSDDLEVPVPAEDLCNEGQIASDEEELVEAAAAVSQHDSSDDAGEQDLGENLSKPPSDPEANPEVSERKLPTEEEPAPVVEQSGKRKSKTKTIVEPPRKRQTKTKNIVEPPRKRQTKTKNIVEPLRKRKAKTKNVSVTPGHKKRGPSKKKPGAAKVEKRKTRTPKCKVPGCFLQDLEKSKKYSGKNLKRNKDELVQRIYDLFNRSVCDKKLPEKLRIGWNNKMVKTAGLCSTGEMWYPKWRRFAKIQIGLKVCDSADRIRDTLIHEMCHAASWLIDGIHDSHGDAWKYYARKSNRIHPELPRVTRCHNYKINYKVHYECTGCKTRIGCYTKSLDTSRFICAKCKGSLVMVPLTQKDGTRIVPHV
"
     misc_feature    2056..2532
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /note="SprT homologues; Region: SprT; smart00731"
                     /db_xref="CDD:128970"
     misc_feature    2065..2526
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /note="SprT-like family; Region: SprT-like; pfam10263"
                     /db_xref="CDD:192504"
     variation       512
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:73552708"
     variation       530
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:373420187"
     variation       538
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377384243"
     variation       540
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:12834159"
     variation       541
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138602001"
     variation       552
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:377049000"
     exon            561..607
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       563
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:36115715"
     variation       567
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:140131381"
     variation       576
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:36019324"
     variation       585
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35103538"
     variation       588
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:192178165"
     variation       598
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199535750"
     exon            608..641
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     exon            642..688
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       644
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148480806"
     variation       660
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191063341"
     exon            689..722
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     exon            723..811
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       727
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200457016"
     variation       785
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374988083"
     variation       799
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:369261522"
     variation       802
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:150589805"
     exon            812..1900
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       834
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:144634706"
     variation       888
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:369494929"
     variation       889
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:200100539"
     variation       947
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:141677815"
     variation       951
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150035777"
     variation       978
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139110831"
     variation       981
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:184215123"
     variation       992
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:373154220"
     variation       999
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:113212495"
     variation       1011
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:186995823"
     variation       1028
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200851627"
     variation       1041
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:149193424"
     variation       1066
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143368028"
     variation       1069
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377418953"
     variation       1072
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:371151044"
     variation       1117
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:146884185"
     variation       1132
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140761910"
     variation       1149
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:144622847"
     variation       1151
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374031224"
     variation       1154
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:138572604"
     variation       1155
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:141229655"
     variation       1182
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:150347408"
     variation       1206
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:138010303"
     variation       1207
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202199167"
     variation       1236
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376108950"
     variation       1266
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:370469989"
     variation       1295
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:375239920"
     variation       1317
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:368020183"
     variation       1326
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:74847303"
     variation       1354
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199853865"
     variation       1357
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370834908"
     variation       1371
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:140646392"
     variation       1387
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:374341284"
     variation       1407
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:190153911"
     variation       1420
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142978522"
     variation       1424
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202075711"
     variation       1425
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:200264438"
     variation       1446
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:147470042"
     variation       1467
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:139970660"
     variation       1476
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:145146238"
     variation       1484
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:368726372"
     variation       1487
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:201630116"
     variation       1488
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:139849576"
     variation       1507
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:182208750"
     variation       1571
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:372385736"
     variation       1608
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:75573923"
     variation       1702..1703
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace=""
                     /replace="c"
                     /db_xref="dbSNP:34330554"
     variation       1710
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:372246678"
     variation       1773
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:375608182"
     variation       1786
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:78056830"
     variation       1810
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:146873231"
     variation       1815
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140732386"
     variation       1824
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:144602884"
     variation       1843
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367693044"
     variation       1897
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:146677567"
     exon            1901..1967
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       1913
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:10217999"
     variation       1952
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:185057741"
     variation       1957
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374858167"
     exon            1968..2112
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       2001
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:199881606"
     variation       2048
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:148824873"
     variation       2079
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:143483517"
     variation       2082
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:373426190"
     variation       2098
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201497331"
     exon            2113..2251
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       2129
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377512808"
     variation       2169
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:370699145"
     variation       2207
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:202033704"
     variation       2241
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374902352"
     exon            2252..2456
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       2265
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:199619527"
     variation       2268
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:374548018"
     variation       2321
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:201675601"
     variation       2334
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:148012096"
     variation       2335
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:141727533"
     exon            2457..3178
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /inference="alignment:Splign:1.39.8"
     variation       2469
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:181616333"
     variation       2482
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:146014858"
     variation       2486
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:2280962"
     variation       2491
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:138927483"
     variation       2516
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:367815000"
     variation       2527
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:371643737"
     variation       2557
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:376298923"
     variation       2558
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:142937775"
     variation       2575
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:372473788"
     variation       2626
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:377165901"
     variation       2855
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:191198370"
     variation       2867
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:7061462"
     variation       2869
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:183317547"
     variation       2951
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:140284414"
     variation       3136
                     /gene="ACRC"
                     /gene_synonym="NAAR1"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:2280963"
ORIGIN      
ttcccagtggttgcaataacggacttagaggtctggacaattcaagtaaggaacaaggctcgcttatccaagttctcgcaggataaaagtttgttatgaacgatttcacatggtttctctttatcagaaagttgttagggacttttaatcgcagaattggcctcgggtgcccacgctctagtattgaaatggcggttttgggacaaataagcaacatccgtgggagtggaaagcgacagacctgatcccggaagcgttacagctaggcgccaagttcacaggcgcgaagttcaaatttgtcttgtgaccactgtgataggtgggtacaggggagcgcgggcgagcacacgtgaattactgctaccgccccctaggtccgggcactataaaggggcctgcgcctggcgttgttcatcgcagttgctccggatctttgcacacactccacgggcagttggaggtgagctgctgccggccacgccagaggctgcaacaccagacatggatgggtgcaaaaaagagctgccccgcttgcaagagccggaggaggacgaggattgttacatccttaatgttcagtcaagcagtgatgacaccagtgggtcttctgtggccagaagagctccgaagagacaggcgagttgcatccttaatgtccagtcaaggagtggtgacaccagtgggtcttctgtggccagaagagctccgaagagacaggcgagctccgtggtagtgattgactctgattctgatgaggaatgtcacacccatgaagagaagaaagctaagttattggaaataaacagcgacgatgagagtccggagtgttgtcatgtgaagcctgccatccaggaacctccaatagttattagtgatgatgacaatgacgatgacaacggtaatgatttggaagttcccgacgacaacagtgatgattcagaagctcccgacgacaacagtgatgattcggaagctcctgacgacaacagtgatgattcggaagctcccgacgacaacagtgatgattcggaagctcccgacgacaatagtgatgattcggatgttcccgacgacaacagtgatgattcatccgacgacaacagtgatgattcatccgacgacaacagtgatgattcggatgttcccgacgacaagagtgatgattcggatgttcccgacgacagcagtgatgattcggatgttcccgacgacagcagtgatgattcggaagctcccgacgacagcagtgatgattcggaagctcccgacgacagcagtgatgattcggaagctcccgacgacagcagtgatgattcggaagctcccgacgacagcagtgatgattcggaagcttccgacgacagcagtgatgattcggaagcttccgacgacagcagtgatgattcggaagctcccgacgacaagagtgatgattcggatgttcccgaagacaagagtgatgattcggatgttcccgatgacaatagtgatgatttggaagttcctgtgccagcagaagatttgtgtaatgaaggccaaattgcttcagatgaagaagagctggttgaggctgctgctgctgtctcccagcatgattcatctgatgatgctggtgagcaggatcttggtgagaatctcagcaaaccaccaagtgatcctgaggctaaccctgaagtttcagagagaaagctgccaactgaggaagagcctgcacctgtggtggaacaatcagggaaaaggaagtcaaaaaccaaaactattgtggagccaccgaggaaaaggcagacaaagaccaaaaatatagtggagccaccaaggaaaaggcagacaaagaccaaaaatatagtggagccactgaggaagaggaaggcgaaaaccaaaaatgtatctgtgacacctggacataagaagcgtgggccttcaaagaagaaacccggtgcagcaaaagttgaaaaacgcaagactaggactcctaaatgcaaagtccctggatgtttcttgcaagaccttgaaaagtcaaagaaatactctggaaaaaatttaaagcgaaataaggatgaattggttcagagaatctacgacctgtttaacagatccgtctgtgataaaaagctgccagagaaactacgcataggctggaataacaagatggtgaaaactgctggcttatgcagcactggtgagatgtggtacccaaagtggcggcgctttgccaagatccagattggcttgaaagtctgcgactctgcagaccgaatccgggataccttgatccatgaaatgtgccatgctgcctcctggctgattgatggtatccatgattctcatggtgacgcatggaagtattatgccaggaaatccaacaggatacacccggagctgcccagggtcacccgttgccataactataagattaactacaaggtccattatgaatgtactggatgcaaaacgaggattggctgctacaccaaatcgttggacaccagccgcttcatctgtgccaaatgcaaggggtctctggtcatggtgccattaactcagaaagatgggacccgtattgtgccccacgtgtgaccatttgctgtgtatgtgcagaagtattatagaaaaattatgcaggagatggctaggattagccttggggatgtgatgaaaacacttggcaggaattacaaggcaatgaagaattcttaaggttatcttagagtatattaatgtgagctatatcctttactggtaagaagttttagaaaagtttgttttgtgaagttaggaatattagaatttaggtactgttaagtaagtaatgttagaatttaagattcatgttattaacgatgattgaccttaaatagggactctattgctaaccattctgtgcccttgacagggtatttctgaagcccttgggatctaccttgggtcttacttgagttccatatttttcacatgtagaacaaaatgcaaaagaaaagtgagttttcaagagtggcaggttgagagaggagaatgctggaaagaggacaagtttgagaggcaacacttaaacactagggctactgtggcatctatgtagacaggaaagacaaacgtgtttcataaaattcgttgttgatggtattgattgaaactatctgagccatgtaatcaaaaaataaaagttttctgcatcttg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:93953 -> Cellular component: GO:0005634 [nucleus] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.