GGRNA Home | Help | Advanced search

2024-03-29 21:41:29, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_052931               2751 bp    mRNA    linear   PRI 07-JUL-2013
DEFINITION  Homo sapiens SLAM family member 6 (SLAMF6), transcript variant 2,
            mRNA.
ACCESSION   NM_052931
VERSION     NM_052931.4  GI:296040489
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2751)
  AUTHORS   Bolduan,S., Hubel,P., Reif,T., Lodermeyer,V., Hohne,K., Fritz,J.V.,
            Sauter,D., Kirchhoff,F., Fackler,O.T., Schindler,M. and Schubert,U.
  TITLE     HIV-1 Vpu affects the anterograde transport and the glycosylation
            pattern of NTB-A
  JOURNAL   Virology 440 (2), 190-203 (2013)
   PUBMED   23528733
  REMARK    GeneRIF: Together, these results suggest that the reduction of
            NTB-A from the cell surface is associated with the Vpu-mediated
            effect on the glycosylation pattern of newly synthesized NTB-A
            molecules.
REFERENCE   2  (bases 1 to 2751)
  AUTHORS   Chatterjee,M., Hedrich,C.M., Rauen,T., Ioannidis,C., Terhorst,C.
            and Tsokos,G.C.
  TITLE     CD3-T cell receptor co-stimulation through SLAMF3 and SLAMF6
            receptors enhances RORgammat recruitment to the IL17A promoter in
            human T lymphocytes
  JOURNAL   J. Biol. Chem. 287 (45), 38168-38177 (2012)
   PUBMED   22989874
  REMARK    GeneRIF: Data indicate that the dominance of the SLAMF3/SLAMF6
            pathway in inducing IL-17A production can be attributed to an
            increased nuclear abundance and recruitment of RORgammat to the
            IL17A promoter.
REFERENCE   3  (bases 1 to 2751)
  AUTHORS   Chatterjee,M., Rauen,T., Kis-Toth,K., Kyttaris,V.C., Hedrich,C.M.,
            Terhorst,C. and Tsokos,G.C.
  TITLE     Increased expression of SLAM receptors SLAMF3 and SLAMF6 in
            systemic lupus erythematosus T lymphocytes promotes Th17
            differentiation
  JOURNAL   J. Immunol. 188 (3), 1206-1212 (2012)
   PUBMED   22184727
  REMARK    GeneRIF: SLAMF3 and SLAMF6 T cell surface expression and IL-17
            levels significantly correlate with disease activity in systemic
            lupus erythematosus patients
REFERENCE   4  (bases 1 to 2751)
  AUTHORS   Chatterjee,M., Kis-Toth,K., Thai,T.H., Terhorst,C. and Tsokos,G.C.
  TITLE     SLAMF6-driven co-stimulation of human peripheral T cells is
            defective in SLE T cells
  JOURNAL   Autoimmunity 44 (3), 211-218 (2011)
   PUBMED   21231893
  REMARK    GeneRIF: Although the expression of SLAMF6 on the surface of T
            cells from patients with systemic lupus erythematosus (SLE) T cells
            is comparable to that on the normal T cells, engagement of SLAMF6
            results in severely reduced Th1 and IL-2 cytokine production
REFERENCE   5  (bases 1 to 2751)
  AUTHORS   Shah,A.H., Sowrirajan,B., Davis,Z.B., Ward,J.P., Campbell,E.M.,
            Planelles,V. and Barker,E.
  TITLE     Degranulation of natural killer cells following interaction with
            HIV-1-infected cells is hindered by downmodulation of NTB-A by Vpu
  JOURNAL   Cell Host Microbe 8 (5), 397-409 (2010)
   PUBMED   21075351
  REMARK    GeneRIF: Vpu downmodulation of NTB-A protects the infected cell
            from lysis by NK cells.
REFERENCE   6  (bases 1 to 2751)
  AUTHORS   Fraser,C.C., Howie,D., Morra,M., Qiu,Y., Murphy,C., Shen,Q.,
            Gutierrez-Ramos,J.C., Coyle,A., Kingsbury,G.A. and Terhorst,C.
  TITLE     Identification and characterization of SF2000 and SF2001, two new
            members of the immune receptor SLAM/CD2 family
  JOURNAL   Immunogenetics 53 (10-11), 843-850 (2002)
   PUBMED   11862385
REFERENCE   7  (bases 1 to 2751)
  AUTHORS   Bottino,C., Falco,M., Parolini,S., Marcenaro,E., Augugliaro,R.,
            Sivori,S., Landi,E., Biassoni,R., Notarangelo,L.D., Moretta,L. and
            Moretta,A.
  TITLE     NTB-A [correction of GNTB-A], a novel SH2D1A-associated surface
            molecule contributing to the inability of natural killer cells to
            kill Epstein-Barr virus-infected B cells in X-linked
            lymphoproliferative disease
  JOURNAL   J. Exp. Med. 194 (3), 235-246 (2001)
   PUBMED   11489943
  REMARK    Erratum:[J Exp Med 2001 Sep 3;194(5):following 703]
REFERENCE   8  (bases 1 to 2751)
  AUTHORS   Lee,Y.J., Luisiri,P. and Clark,M.R.
  TITLE     A novel complex, p40/42, is constitutively associated with the B
            cell antigen receptor and phosphorylated upon receptor stimulation
  JOURNAL   J. Immunol. 157 (9), 3828-3837 (1996)
   PUBMED   8892612
REFERENCE   9  (bases 1 to 2751)
  AUTHORS   Kong,G., Dalton,M., Bubeck Wardenburg,J., Straus,D., Kurosaki,T.
            and Chan,A.C.
  TITLE     Distinct tyrosine phosphorylation sites in ZAP-70 mediate
            activation and negative regulation of antigen receptor function
  JOURNAL   Mol. Cell. Biol. 16 (9), 5026-5035 (1996)
   PUBMED   8756661
REFERENCE   10 (bases 1 to 2751)
  AUTHORS   Hercend,T., Meuer,S., Brennan,A., Edson,M.A., Acuto,O.,
            Reinherz,E.L., Schlossman,S.F. and Ritz,J.
  TITLE     Natural killer-like function of activated T lymphocytes:
            differential blocking effects of monoclonal antibodies specific for
            a 90-kDa clonotypic structure
  JOURNAL   Cell. Immunol. 86 (2), 381-392 (1984)
   PUBMED   6610481
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from DB197632.1, BC113893.1 and
            AK125624.1.
            On May 14, 2010 this sequence version replaced gi:38327616.
            
            Summary: The protein encoded by this gene is a type I transmembrane
            protein, belonging to the CD2 subfamily of the immunoglobulin
            superfamily. This encoded protein is expressed on Natural killer
            (NK), T, and B lymphocytes. It undergoes tyrosine phosphorylation
            and associates with the Src homology 2 domain-containing protein
            (SH2D1A) as well as with SH2 domain-containing phosphatases (SHPs).
            It functions as a coreceptor in the process of NK cell activation.
            It can also mediate inhibitory signals in NK cells from X-linked
            lymphoproliferative patients. Alternative splicing results in
            multiple transcript variants encoding distinct isoforms.[provided
            by RefSeq, May 2010].
            
            Transcript Variant: This variant (2) uses an alternate splice site
            in the 3' coding region, compared to variant 1, which results in an
            isoform (2) that is one amino acid shorter than isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AK125624.1, AJ277141.1 [ECO:0000332]
            RNAseq introns              :: single sample supports all introns
                                           ERS025084, ERS025088 [ECO:0000348]
            ##Evidence-Data-END##
            COMPLETENESS: complete on the 3' end.
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-43                DB197632.1         1-43
            44-1253             BC113893.1         1-1210
            1254-2751           AK125624.1         1253-2750
FEATURES             Location/Qualifiers
     source          1..2751
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1q23.2"
     gene            1..2751
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="SLAM family member 6"
                     /db_xref="GeneID:114836"
                     /db_xref="HGNC:21392"
                     /db_xref="HPRD:05920"
                     /db_xref="MIM:606446"
     exon            1..119
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     STS             44..1494
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /db_xref="UniSTS:486452"
     CDS             71..1066
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="isoform 2 precursor is encoded by transcript
                     variant 2; activating NK receptor; natural killer-, T- and
                     B-cell antigen; NTBA receptor; NK-T-B-antigen"
                     /codon_start=1
                     /product="SLAM family member 6 isoform 2 precursor"
                     /protein_id="NP_443163.1"
                     /db_xref="GI:16418407"
                     /db_xref="CCDS:CCDS1205.1"
                     /db_xref="GeneID:114836"
                     /db_xref="HGNC:21392"
                     /db_xref="HPRD:05920"
                     /db_xref="MIM:606446"
                     /translation="
MLWLFQSLLFVFCFGPGNVVSQSSLTPLMVNGILGESVTLPLEFPAGEKVNFITWLFNETSLAFIVPHETKSPEIHVTNPKQGKRLNFTQSYSLQLSNLKMEDTGSYRAQISTKTSAKLSSYTLRILRQLRNIQVTNHSQLFQNMTCELHLTCSVEDADDNVSFRWEALGNTLSSQPNLTVSWDPRISSEQDYTCIAENAVSNLSFSVSAQKLCEDVKIQYTDTKMILFMVSGICIVFGFIILLLLVLRKRRDSLSLSTQRTQGPESARNLEYVSVSPTNNTVYASVTHSNRETEIWTPRENDTITIYSTINHSKESKPTFSRATALDNVV
"
     sig_peptide     71..133
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="COORDINATES: ab initio prediction:SignalP:4.0"
     misc_feature    131..409
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="Immunoglobulin V-set domain; Region: V-set;
                     pfam07686"
                     /db_xref="CDD:203725"
     mat_peptide     134..1063
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /product="SLAM family member 6 isoform 2"
     misc_feature    164..451
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="N-terminal immunoglobulin (Ig)-like domain of the
                     signaling lymphocyte activation molecule (SLAM) family,
                     CD84_like; Region: Ig_SLAM-CD84_like_N; cd05775"
                     /db_xref="CDD:143252"
     misc_feature    order(224..226,230..232,392..394,398..400,404..406)
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="dimer interface [polypeptide binding]; other site"
                     /db_xref="CDD:143252"
     misc_feature    470..667
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /note="Immunoglobulin domain; Region: Ig; cl11960"
                     /db_xref="CDD:213125"
     misc_feature    749..811
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (Q96DU3.3);
                     transmembrane region"
     misc_feature    887..889
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine; propagated from
                     UniProtKB/Swiss-Prot (Q96DU3.3); phosphorylation site"
     misc_feature    899..901
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphoserine; propagated from UniProtKB/Swiss-Prot
                     (Q96DU3.3); phosphorylation site"
     misc_feature    992..994
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="Phosphotyrosine; propagated from
                     UniProtKB/Swiss-Prot (Q96DU3.3); phosphorylation site"
     exon            120..452
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     exon            453..716
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     variation       556
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /replace="a"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:35414223"
     exon            717..827
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     variation       800
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:34355503"
     exon            828..866
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     exon            867..946
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     exon            947..1018
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     exon            1019..2743
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /inference="alignment:Splign:1.39.8"
     variation       2454
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /replace="a"
                     /replace="t"
                     /db_xref="dbSNP:634791"
     STS             2487..2655
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /standard_name="G35510"
                     /db_xref="UniSTS:44150"
     STS             2529..2619
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
                     /standard_name="D8S2279"
                     /db_xref="UniSTS:473907"
     polyA_signal    2709..2714
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
     polyA_signal    2713..2718
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
     polyA_signal    2717..2722
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
     polyA_signal    2722..2727
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
     polyA_site      2743
                     /gene="SLAMF6"
                     /gene_synonym="CD352; KALI; KALIb; Ly108; NTB-A; NTBA;
                     SF2000"
ORIGIN      
agtttatgacagaagggcaaaaacattgactgcctcaaggtctcaagcaccagtcttcaccgcggaaagcatgttgtggctgttccaatcgctcctgtttgtcttctgctttggcccagggaatgtagtttcacaaagcagcttaaccccattgatggtgaacgggattctgggggagtcagtaactcttcccctggagtttcctgcaggagagaaggtcaacttcatcacttggcttttcaatgaaacatctcttgccttcatagtaccccatgaaaccaaaagtccagaaatccacgtgactaatccgaaacagggaaagcgactgaacttcacccagtcctactccctgcaactcagcaacctgaagatggaagacacaggctcttacagagcccagatatccacaaagacctctgcaaagctgtccagttacactctgaggatattaagacaactgaggaacatacaagttaccaatcacagtcagctatttcagaatatgacctgtgagctccatctgacttgctctgtggaggatgcagatgacaatgtctcattcagatgggaggccttgggaaacacactttcaagtcagccaaacctcactgtctcctgggaccccaggatttccagtgaacaggactacacctgcatagcagagaatgctgtcagtaatttatccttctctgtctctgcccagaagctttgcgaagatgttaaaattcaatatacagataccaaaatgattctgtttatggtttctgggatatgcatagtcttcggtttcatcatactgctgttacttgttttgaggaaaagaagagattccctatctttgtctactcagcgaacacagggccccgagtccgcaaggaacctagagtatgtttcagtgtctccaacgaacaacactgtgtatgcttcagtcactcattcaaacagggaaacagaaatctggacacctagagaaaatgatactatcacaatttactccacaattaatcattccaaagagagtaaacccactttttccagggcaactgcccttgacaatgtcgtgtaagttgctgaaaggcctcagaggaattcgggaatgacacgtcttctgatcccatgagacagaacaaagaacaggaagcttggttcctgttgttcctggcaacagaatttgaatatctaggataggatgatcacctccagtccttcggacttaaacctgcctacctgagtcaaacacctaaggataacatcatttccagcatgtggttcaaataatattttccaatccacttcaggccaaaacatgctaaagataacacaccagcacattgactctctctttgataactaagcaaatggaattatggttgacagagagtttatgatccagaagacaaccacttctctccttttagaaagcagcaggattgacttattgagaaataatgcagtgtgttggttacatgtgtagtctctggagttggatgggcccatcctgatacaagttgagcatcccttgtctgaaatgcttgggattagaaatgtttcagatttcaattttttttcagattttggaatatttgcattatatttagcggttgagtatccaaatccaaaaatccaaaattcaaaatgctccaataagcatttcccttgagtttcattgatgtcgatgcagtgctcaaaatctcagattttggagcattttggatattggatttttggatttgggatgctcaacttgtacaatgtttattagacacatctcctgggacatactgcctaaccttttggagccttagtctcccagactgaaaaaggaagaggatggtattacatcagctccattgtttgagccaagaatctaagtcatccctgactccagtgtctttgtcaccaggccctttggactctacctcagaaatatttcttggaccttccacttctcctccaactccttgaccaccatcctgtatccaaccatcaccacctctaacctgaatcctaccttaagatcagaacagttgtcctcacttttgttcttgtccctctccaacccactctccacaagatggccagagtaatgtttttaatataaattggatccttcagtttcctgcttaaaaccctgcaggtttcccaatgcactcagaaagaaatccagtttccatggccctggatggtctggcccacctccagcctcagctagcattacccttctgacactctctatgtagcctccctgatcttctttcagctcctctattaaaggaaaagttctttatgttaattatttacatcttcctgcaggcccttcctctgcctgctggggtcctcctattctttaggtttaattttaaatatgtcacctcctaagagaaaccttcccagaccactctttctaaaatgaatcttctaggctgggcatggtggctcacacctgtaatccctgtactttgggaggccaaggggggagatcacttgaggtcaggagttcaagaccagcctggccaacttggtgaaaccccgtctttactaaaaatacaaaaaaattagccaggcgtggtggtgcacccctaaaatcccagctacttgagagactgaggcaggagaatcgcttgaacccaggaggtggaggttccagtgagccaaaatcatgccaatgtattccagtctgggtgacagagtgagactctgtctcaaaaaataaataaataaaataaaatgaaatagatcttataaaaaaaa
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:114836 -> Molecular function: GO:0004872 [receptor activity] evidence: IEA
            GeneID:114836 -> Cellular component: GO:0005886 [plasma membrane] evidence: IEA
            GeneID:114836 -> Cellular component: GO:0016021 [integral to membrane] evidence: IEA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.