Home |
Help |
Advanced search
2024-04-20 04:28:49, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_033493 2453 bp mRNA linear PRI 14-APR-2013
DEFINITION Homo sapiens cyclin-dependent kinase 11B (CDK11B), transcript
variant 9, mRNA.
ACCESSION NM_033493
VERSION NM_033493.1 GI:16332371
KEYWORDS RefSeq.
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 2453)
AUTHORS Duan,Z., Zhang,J., Choy,E., Harmon,D., Liu,X., Nielsen,P.,
Mankin,H., Gray,N.S. and Hornicek,F.J.
TITLE Systematic kinome shRNA screening identifies CDK11 (PITSLRE) kinase
expression is critical for osteosarcoma cell growth and
proliferation
JOURNAL Clin. Cancer Res. 18 (17), 4580-4588 (2012)
PUBMED 22791884
REMARK GeneRIF: CDK11 signaling is essential in osteosarcoma cell growth
and survival, further elucidating the regulatory mechanisms
controlling the expression of CDK11 and ultimately develop a CDK11
inhibitor that may provide therapeutic benefit against
osteosarcoma.
REFERENCE 2 (bases 1 to 2453)
AUTHORS Zhang,G., Jiang,J., Luo,S., Tang,S., Liang,J. and Yao,P.
TITLE Analyses of CDC2L1 gene mutations in keloid tissue
JOURNAL Clin. Exp. Dermatol. 37 (3), 277-283 (2012)
PUBMED 22188294
REMARK GeneRIF: We have identified a correlation between two exon 7
mutations of the CDC2L1 gene and keloid disease.
REFERENCE 3 (bases 1 to 2453)
AUTHORS Wilkinson,S., Croft,D.R., O'Prey,J., Meedendorp,A., O'Prey,M.,
Dufes,C. and Ryan,K.M.
TITLE The cyclin-dependent kinase PITSLRE/CDK11 is required for
successful autophagy
JOURNAL Autophagy 7 (11), 1295-1301 (2011)
PUBMED 21808150
REMARK GeneRIF: Since PITSLRE/CDK11 regulates autophagy in both Drosophila
and human cells, this kinase represents a novel phylogenetically
conserved component of the autophagy machinery.
REFERENCE 4 (bases 1 to 2453)
AUTHORS Bajic,V.P., Su,B., Lee,H.G., Kudo,W., Siedlak,S.L., Zivkovic,L.,
Spremo-Potparevic,B., Djelic,N., Milicevic,Z., Singh,A.K.,
Fahmy,L.M., Wang,X., Smith,M.A. and Zhu,X.
TITLE Mislocalization of CDK11/PITSLRE, a regulator of the G2/M phase of
the cell cycle, in Alzheimer disease
JOURNAL Cell. Mol. Biol. Lett. 16 (3), 359-372 (2011)
PUBMED 21461981
REMARK GeneRIF: These data suggest that CDK11 may play a vital role in
cell cycle re-entry in Alzheimer disease neurons in an
APP-dependent manner.
REFERENCE 5 (bases 1 to 2453)
AUTHORS Hao,Y., Kong,X., Ruan,Y., Gan,H., Chen,H., Zhang,C., Ren,S. and
Gu,J.
TITLE CDK11p46 and RPS8 associate with each other and suppress
translation in a synergistic manner
JOURNAL Biochem. Biophys. Res. Commun. 407 (1), 169-174 (2011)
PUBMED 21371428
REMARK GeneRIF: Taken together, these results provide evidence for the
novel role of CDK11p46 in the regulation of translation and cell
apoptosis.
REFERENCE 6 (bases 1 to 2453)
AUTHORS White,P.S., Maris,J.M., Beltinger,C., Sulman,E., Marshall,H.N.,
Fujimori,M., Kaufman,B.A., Biegel,J.A., Allen,C., Hilliard,C.,
Valentine,M.B., Look,A.T., Enomoto,H., Sakiyama,S. and Brodeur,G.M.
TITLE A region of consistent deletion in neuroblastoma maps within human
chromosome 1p36.2-36.3
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (12), 5520-5524 (1995)
PUBMED 7777541
REFERENCE 7 (bases 1 to 2453)
AUTHORS Lahti,J.M., Valentine,M., Xiang,J., Jones,B., Amann,J., Grenet,J.,
Richmond,G., Look,A.T. and Kidd,V.J.
TITLE Alterations in the PITSLRE protein kinase gene complex on
chromosome 1p36 in childhood neuroblastoma
JOURNAL Nat. Genet. 7 (3), 370-375 (1994)
PUBMED 7920654
REFERENCE 8 (bases 1 to 2453)
AUTHORS Eipers,P.G., Lahti,J.M. and Kidd,V.J.
TITLE Structure and expression of the human p58clk-1 protein kinase
chromosomal gene
JOURNAL Genomics 13 (3), 613-621 (1992)
PUBMED 1639388
REFERENCE 9 (bases 1 to 2453)
AUTHORS Eipers,P.G., Barnoski,B.L., Han,J., Carroll,A.J. and Kidd,V.J.
TITLE Localization of the expressed human p58 protein kinase chromosomal
gene to chromosome 1p36 and a highly related sequence to chromosome
15
JOURNAL Genomics 11 (3), 621-629 (1991)
PUBMED 1774066
REFERENCE 10 (bases 1 to 2453)
AUTHORS Bunnell,B.A., Heath,L.S., Adams,D.E., Lahti,J.M. and Kidd,V.J.
TITLE Increased expression of a 58-kDa protein kinase leads to changes in
the CHO cell cycle
JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (19), 7467-7471 (1990)
PUBMED 2217177
REMARK Erratum:[Proc Natl Acad Sci U S A 1991 Mar 15;88(6):2612]
COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The
reference sequence was derived from U04817.1.
Summary: This gene encodes a member of the p34Cdc2 protein kinase
family. p34Cdc2 kinase family members are known to be essential for
eukaryotic cell cycle control. This gene is in close proximity to
CDC2L2, a nearly identical gene in the same chromosomal region. The
gene loci including this gene, CDC2L2, as well as metalloprotease
MMP21/22, consist of two identical, tandemly linked genomic regions
which are thought to be a part of the larger region that has been
duplicated. This gene and CDC2L2 were shown to be deleted or
altered frequently in neuroblastoma with amplified MYCN genes. The
protein kinase encoded by this gene could be cleaved by caspases
and was demonstrated to play roles in cell apoptosis. Several
alternatively spliced variants of this gene have been reported.
[provided by RefSeq, Jul 2008].
Transcript Variant: This variant (9) lacks two separated internal
coding regions when compared to variant 1. The resulting protein
thus lacks a 11 aa and a 14 aa internal fragment, as compared to
isoform 1.
Publication Note: This RefSeq record includes a subset of the
publications that are available for this gene. Please see the Gene
record to access additional publications.
##Evidence-Data-START##
Transcript exon combination :: U04817.1 [ECO:0000332]
##Evidence-Data-END##
FEATURES Location/Qualifiers
source 1..2453
/organism="Homo sapiens"
/mol_type="mRNA"
/db_xref="taxon:9606"
/chromosome="1"
/map="1p36.33"
gene 1..2453
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/note="cyclin-dependent kinase 11B"
/db_xref="GeneID:984"
/db_xref="HGNC:1729"
/db_xref="HPRD:08909"
/db_xref="MIM:176873"
misc_feature 94..96
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/note="upstream in-frame stop codon"
CDS 112..2427
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/EC_number="2.7.11.22"
/note="isoform 9 is encoded by transcript variant 9; cell
division cycle 2-like 1 (PITSLRE proteins); CDC-related
protein kinase p58; cell division cycle 2-like protein
kinase 1; PITSLRE serine/threonine-protein kinase CDC2L1;
cell division protein kinase 11B;
galactosyltransferase-associated protein kinase p58/GTA;
PITSLREA; p58 CLK-1"
/codon_start=1
/product="cyclin-dependent kinase 11B isoform 9"
/protein_id="NP_277028.1"
/db_xref="GI:16332372"
/db_xref="GeneID:984"
/db_xref="HGNC:1729"
/db_xref="HPRD:08909"
/db_xref="MIM:176873"
/translation="
MGDEKDSWKVKTLDEILQEKKRRKEQEEKAEIKRLKNSDDRDSKRDSLEEGELRDHCMEITIRNSPYRREDSMEDRGEEDDSLAIKPPQQMSRKEKVHHRKDEKRKEKKHARVKEKEREHERRKRHREEQDKARREWERQKRREMAREHSRRERDRLEQLERKRERERKMREQQKEQREQKERERRAEERRKEREARREVSAHHRTMREDYSDKVKASHWSRSPPRPPRERFELGDGRKPVKEEKMEERDLLSDLQDISDSERKTSSAESSSAESGSGSEEEEEEEEEEEEEGSTSEESEEEEEEEEEEEEETGSNSEEASEQSAEEVSEEEMSEDEERENENHLLVVPESRFDRDSGESEEAEEEVGEGTPQSSALTEGDYVPDSPALSPIELKQELPKYLPALQGCRSVEEFQCLNRIEEGTYGVVYRAKDKKTDEIVALKRLKMEKEKEGFPITSLREINTILKAQHPNIVTVREIVVGSNMDKIYIVMNYVEHDLKSLMETMKQPFLPGEVKTLMIQLLRGVKHLHDNWILHRDLKTSNLLLSHAGILKVGDFGLAREYGSPLKAYTPVVVTLWYRAPELLLGAKEYSTAVDMWSVGCIFGELLTQKPLFPGKSEIDQINKVFKDLGTPSEKIWPGYSELPAVKKMTFSEHPYNNLRKRFGALLSDQGFDLMNKFLTYFPGRRISAEDGLKHEYFRETPLPIDPSMFPTWPAKSEQQRVKRGTSPRPPEGGLGYSQLGDDDLKETGFHLTTTNQGASAAGPGFSLKF
"
misc_feature 886..888
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 886..888
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
misc_feature 1333..2208
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/note="Catalytic domain of the Serine/Threonine Kinase,
Cell Division Cycle 2-like 1; Region: STKc_CDC2L1;
cd07843"
/db_xref="CDD:173741"
misc_feature 1342..2214
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/note="cyclin-dependent kinase A; Provisional; Region:
PLN00009"
/db_xref="CDD:177649"
misc_feature order(1369..1380,1393..1395,1432..1434,1438..1440,
1489..1491,1531..1533,1585..1596,1603..1605,1609..1614,
1723..1725,1729..1731,1735..1740,1744..1746,1777..1779,
1786..1788,1822..1824,1828..1839,1843..1845,1957..1962)
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/note="active site"
/db_xref="CDD:173741"
misc_feature order(1369..1380,1393..1395,1432..1434,1438..1440,
1531..1533,1585..1596,1603..1605,1612..1614,1735..1740,
1744..1746,1777..1779)
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/note="ATP binding site [chemical binding]; other site"
/db_xref="CDD:173741"
misc_feature order(1465..1473,1477..1479,1486..1491,1495..1500,
1507..1512,1546..1548,1552..1554,1573..1575,1690..1692,
1699..1710,1792..1794,1798..1809,1819..1824,2164..2166,
2176..2184)
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/note="CDK/cyclin interface [polypeptide binding]; other
site"
/db_xref="CDD:173741"
misc_feature order(1489..1491,1609..1611,1723..1725,1729..1731,
1786..1788,1822..1824,1828..1839,1843..1845,1957..1962)
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/note="substrate binding site [chemical binding]; other
site"
/db_xref="CDD:173741"
misc_feature order(1774..1809,1813..1845)
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/note="activation loop (A-loop); other site"
/db_xref="CDD:173741"
misc_feature 1822..1824
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/experiment="experimental evidence, no additional details
recorded"
/note="phosphorylation site"
STS 1035..2451
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/db_xref="UniSTS:484401"
variation 1530
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/replace="c"
/replace="t"
/db_xref="dbSNP:17434073"
variation 1986
/gene="CDK11B"
/gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
/replace="a"
/replace="g"
/db_xref="dbSNP:17424311"
ORIGIN
atacaggaagtgacgatacttttggcgcgcgcggttgctgtttcttctctggctccgggaccggcggcggcggcggcggcacgggcggcggcgtagggtgttttaactcaaatgggtgatgaaaaggactcttggaaagtgaaaactttagatgaaattcttcaggaaaagaaacgaaggaaggaacaagaggagaaagcagagataaaacgcttaaaaaattctgatgaccgggattccaagcgggattcccttgaggagggggagctgagagatcactgcatggagatcacaataaggaactccccgtatagaagagaagactctatggaagacagaggagaagaagatgattctttggccatcaaaccaccccagcaaatgtctcggaaagaaaaagttcatcacagaaaagatgaaaagagaaaagagaaaaagcatgctagagtgaaagaaaaagaaagagagcacgaacgtcggaaacgacatcgagaagaacaggataaagctcgccgggaatgggaaagacagaagagaagggaaatggcaagggagcattccaggagagaaagggaccgcttggagcagttagaaaggaagcgggagcgggagcgcaagatgcgggagcagcagaaggagcagcgggagcagaaggagcgcgagcggcgggcggaggagcggcgcaaggagcgggaggcccgcagggaagtgtctgcacatcaccgaacgatgagagaggactacagcgacaaagtgaaagccagccactggagtcgcagcccgcctcggccgccgcgggagcggttcgagttgggagacggccggaagccagtaaaagaagagaaaatggaagaaagggacctgctgtccgacttacaggacatcagcgacagcgagaggaagaccagctcggccgagtcctcgtcagcagaatcaggctcaggttctgaggaagaagaggaggaggaggaagaggaggaggaggaagggagcaccagtgaagaatcagaggaggaggaggaggaagaggaagaggaggaggaggagaccggcagcaactctgaggaggcatcagagcagtctgccgaagaagtaagtgaggaagaaatgagtgaagatgaagaacgagaaaatgaaaaccacctcttggttgttccagagtcacggttcgaccgagattccggggagagtgaagaagcagaggaagaagtgggtgagggaacgccgcagagcagcgccctgacagagggcgactatgtgcccgactcccctgccctgtcgcccatcgagctcaagcaggagctgcccaagtacctgccggccctgcagggctgccggagcgtcgaggagttccagtgcctgaacaggatcgaggagggcacctatggagtggtctacagagcaaaagacaagaaaacagatgaaattgtggctctaaagcggctgaagatggagaaggagaaggagggcttcccgatcacgtcgctgagggagatcaacaccatcctcaaggcccagcatcccaacatcgtcaccgttagagagattgtggtgggcagcaacatggacaagatctacatcgtgatgaactatgtggagcacgacctcaagagcctgatggagaccatgaaacagcccttcctgccaggggaggtgaagaccctgatgatccagctgctgcgtggggtgaaacacctgcacgacaactggatcctgcaccgtgacctcaagacgtccaacctgctgctgagccacgccggcatcctcaaggtgggtgacttcgggctggcgcgggagtacggatcccctctgaaggcctacaccccggtcgtggtgaccctgtggtaccgcgccccagagctgctgcttggtgccaaggaatactccacggccgtggacatgtggtcagtgggttgcatcttcggggagctgctgactcagaagcctctgttccccgggaagtcagaaatcgatcagatcaacaaggtgttcaaggatctggggacccctagtgagaaaatctggcccggctacagcgagctcccagcagtcaagaagatgaccttcagcgagcacccctacaacaacctccgcaagcgcttcggggctctgctctcagaccagggcttcgacctcatgaacaagttcctgacctacttccccgggaggaggatcagcgctgaggacggcctcaagcatgagtatttccgcgagacccccctccccatcgacccctccatgttccccacgtggcccgccaagagcgagcagcagcgtgtgaagcggggcaccagcccgaggccccctgagggaggcctgggctacagccagctgggtgacgacgacctgaaggagacgggcttccaccttaccaccacgaaccagggggcctctgccgcgggccccggcttcagcctcaagttctgaaggtcagagtggaccccgtcatgggg
//
ANNOTATIONS from NCBI Entrez Gene (20130726):
GeneID:984 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS
GeneID:984 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
GeneID:984 -> Molecular function: GO:0004693 [cyclin-dependent protein serine/threonine kinase activity] evidence: IEA
GeneID:984 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
GeneID:984 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA
GeneID:984 -> Biological process: GO:0001558 [regulation of cell growth] evidence: IEP
GeneID:984 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS
GeneID:984 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
GeneID:984 -> Biological process: GO:0006915 [apoptotic process] evidence: NAS
GeneID:984 -> Biological process: GO:0007067 [mitosis] evidence: NAS
GeneID:984 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
GeneID:984 -> Biological process: GO:0050684 [regulation of mRNA processing] evidence: IDA
GeneID:984 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
GeneID:984 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
NP_277028 -> EC 2.7.11.22
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.