2024-04-27 11:39:49, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_033492 2480 bp mRNA linear PRI 14-APR-2013 DEFINITION Homo sapiens cyclin-dependent kinase 11B (CDK11B), transcript variant 8, mRNA. ACCESSION NM_033492 VERSION NM_033492.1 GI:16332369 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2480) AUTHORS Duan,Z., Zhang,J., Choy,E., Harmon,D., Liu,X., Nielsen,P., Mankin,H., Gray,N.S. and Hornicek,F.J. TITLE Systematic kinome shRNA screening identifies CDK11 (PITSLRE) kinase expression is critical for osteosarcoma cell growth and proliferation JOURNAL Clin. Cancer Res. 18 (17), 4580-4588 (2012) PUBMED 22791884 REMARK GeneRIF: CDK11 signaling is essential in osteosarcoma cell growth and survival, further elucidating the regulatory mechanisms controlling the expression of CDK11 and ultimately develop a CDK11 inhibitor that may provide therapeutic benefit against osteosarcoma. REFERENCE 2 (bases 1 to 2480) AUTHORS Zhang,G., Jiang,J., Luo,S., Tang,S., Liang,J. and Yao,P. TITLE Analyses of CDC2L1 gene mutations in keloid tissue JOURNAL Clin. Exp. Dermatol. 37 (3), 277-283 (2012) PUBMED 22188294 REMARK GeneRIF: We have identified a correlation between two exon 7 mutations of the CDC2L1 gene and keloid disease. REFERENCE 3 (bases 1 to 2480) AUTHORS Wilkinson,S., Croft,D.R., O'Prey,J., Meedendorp,A., O'Prey,M., Dufes,C. and Ryan,K.M. TITLE The cyclin-dependent kinase PITSLRE/CDK11 is required for successful autophagy JOURNAL Autophagy 7 (11), 1295-1301 (2011) PUBMED 21808150 REMARK GeneRIF: Since PITSLRE/CDK11 regulates autophagy in both Drosophila and human cells, this kinase represents a novel phylogenetically conserved component of the autophagy machinery. REFERENCE 4 (bases 1 to 2480) AUTHORS Bajic,V.P., Su,B., Lee,H.G., Kudo,W., Siedlak,S.L., Zivkovic,L., Spremo-Potparevic,B., Djelic,N., Milicevic,Z., Singh,A.K., Fahmy,L.M., Wang,X., Smith,M.A. and Zhu,X. TITLE Mislocalization of CDK11/PITSLRE, a regulator of the G2/M phase of the cell cycle, in Alzheimer disease JOURNAL Cell. Mol. Biol. Lett. 16 (3), 359-372 (2011) PUBMED 21461981 REMARK GeneRIF: These data suggest that CDK11 may play a vital role in cell cycle re-entry in Alzheimer disease neurons in an APP-dependent manner. REFERENCE 5 (bases 1 to 2480) AUTHORS Hao,Y., Kong,X., Ruan,Y., Gan,H., Chen,H., Zhang,C., Ren,S. and Gu,J. TITLE CDK11p46 and RPS8 associate with each other and suppress translation in a synergistic manner JOURNAL Biochem. Biophys. Res. Commun. 407 (1), 169-174 (2011) PUBMED 21371428 REMARK GeneRIF: Taken together, these results provide evidence for the novel role of CDK11p46 in the regulation of translation and cell apoptosis. REFERENCE 6 (bases 1 to 2480) AUTHORS White,P.S., Maris,J.M., Beltinger,C., Sulman,E., Marshall,H.N., Fujimori,M., Kaufman,B.A., Biegel,J.A., Allen,C., Hilliard,C., Valentine,M.B., Look,A.T., Enomoto,H., Sakiyama,S. and Brodeur,G.M. TITLE A region of consistent deletion in neuroblastoma maps within human chromosome 1p36.2-36.3 JOURNAL Proc. Natl. Acad. Sci. U.S.A. 92 (12), 5520-5524 (1995) PUBMED 7777541 REFERENCE 7 (bases 1 to 2480) AUTHORS Lahti,J.M., Valentine,M., Xiang,J., Jones,B., Amann,J., Grenet,J., Richmond,G., Look,A.T. and Kidd,V.J. TITLE Alterations in the PITSLRE protein kinase gene complex on chromosome 1p36 in childhood neuroblastoma JOURNAL Nat. Genet. 7 (3), 370-375 (1994) PUBMED 7920654 REFERENCE 8 (bases 1 to 2480) AUTHORS Eipers,P.G., Lahti,J.M. and Kidd,V.J. TITLE Structure and expression of the human p58clk-1 protein kinase chromosomal gene JOURNAL Genomics 13 (3), 613-621 (1992) PUBMED 1639388 REFERENCE 9 (bases 1 to 2480) AUTHORS Eipers,P.G., Barnoski,B.L., Han,J., Carroll,A.J. and Kidd,V.J. TITLE Localization of the expressed human p58 protein kinase chromosomal gene to chromosome 1p36 and a highly related sequence to chromosome 15 JOURNAL Genomics 11 (3), 621-629 (1991) PUBMED 1774066 REFERENCE 10 (bases 1 to 2480) AUTHORS Bunnell,B.A., Heath,L.S., Adams,D.E., Lahti,J.M. and Kidd,V.J. TITLE Increased expression of a 58-kDa protein kinase leads to changes in the CHO cell cycle JOURNAL Proc. Natl. Acad. Sci. U.S.A. 87 (19), 7467-7471 (1990) PUBMED 2217177 REMARK Erratum:[Proc Natl Acad Sci U S A 1991 Mar 15;88(6):2612] COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from U04816.1. Summary: This gene encodes a member of the p34Cdc2 protein kinase family. p34Cdc2 kinase family members are known to be essential for eukaryotic cell cycle control. This gene is in close proximity to CDC2L2, a nearly identical gene in the same chromosomal region. The gene loci including this gene, CDC2L2, as well as metalloprotease MMP21/22, consist of two identical, tandemly linked genomic regions which are thought to be a part of the larger region that has been duplicated. This gene and CDC2L2 were shown to be deleted or altered frequently in neuroblastoma with amplified MYCN genes. The protein kinase encoded by this gene could be cleaved by caspases and was demonstrated to play roles in cell apoptosis. Several alternatively spliced variants of this gene have been reported. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (8) contains an extra coding region and lacks two separated internal coding regions when compared to variant 1. The resulting protein thus contains an additional 9 aa internal fragment, and lacks two separated internal fragments, as compared to isoform 1. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: U04816.1 [ECO:0000332] ##Evidence-Data-END## FEATURES Location/Qualifiers source 1..2480 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="1" /map="1p36.33" gene 1..2480 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="cyclin-dependent kinase 11B" /db_xref="GeneID:984" /db_xref="HGNC:1729" /db_xref="HPRD:08909" /db_xref="MIM:176873" misc_feature 94..96 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="upstream in-frame stop codon" CDS 112..2454 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /EC_number="2.7.11.22" /note="isoform 8 is encoded by transcript variant 8; cell division cycle 2-like 1 (PITSLRE proteins); CDC-related protein kinase p58; cell division cycle 2-like protein kinase 1; PITSLRE serine/threonine-protein kinase CDC2L1; cell division protein kinase 11B; galactosyltransferase-associated protein kinase p58/GTA; PITSLREA; p58 CLK-1" /codon_start=1 /product="cyclin-dependent kinase 11B isoform 8" /protein_id="NP_277027.1" /db_xref="GI:16332370" /db_xref="GeneID:984" /db_xref="HGNC:1729" /db_xref="HPRD:08909" /db_xref="MIM:176873" /translation="
MGDEKDSWKVKTLDEILQEKKRRKEQEEKAEIKRLKNSDDRDSKRDSLEEGELRDHCMEITIRNSPYRREDSMEDRGEEDDSLAIKPPQQMSRKEKVHHRKDEKRKEKKHARVKEKEREHERRKRHREEQDKARREWERQKRREMAREHSRRERGNDGVCLFRDRLEQLERKRERERKMREQQKEQREQKERERRAEERRKEREARREVSAHHRTMREDYSDKVKASHWSRSPPRPPRERFELGDGRKPVKEEKMEERDLLSDLQDISDSERKTSSAESSSAESGSGSEEEEEEEEEEEEEGSTSEESEEEEEEEEEEEEETGSNSEEASEQSAEEVSEEEMSEDEERENENHLLVVPESRFDRDSGESEEAEEEVGEGTPQSSALTEGDYVPDSPALSPIELKQELPKYLPALQGCRSVEEFQCLNRIEEGTYGVVYRAKDKKTDEIVALKRLKMEKEKEGFPITSLREINTILKAQHPNIVTVREIVVGSNMDKIYIVMNYVEHDLKSLMETMKQPFLPGEVKTLMIQLLRGVKHLHDNWILHRDLKTSNLLLSHAGILKVGDFGLAREYGSPLKAYTPVVVTLWYRAPELLLGAKEYSTAVDMWSVGCIFGELLTQKPLFPGKSEIDQINKVFKDLGTPSEKIWPGYSELPAVKKMTFSEHPYNNLRKRFGALLSDQGFDLMNKFLTYFPGRRISAEDGLKHEYFRETPLPIDPSMFPTWPAKSEQQRVKRGTSPRPPEGGLGYSQLGDDDLKETGFHLTTTNQGASAAGPGFSLKF
" misc_feature 913..915 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 913..915 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 1360..2235 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="Catalytic domain of the Serine/Threonine Kinase, Cell Division Cycle 2-like 1; Region: STKc_CDC2L1; cd07843" /db_xref="CDD:173741" misc_feature 1369..2241 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="cyclin-dependent kinase A; Provisional; Region: PLN00009" /db_xref="CDD:177649" misc_feature order(1396..1407,1420..1422,1459..1461,1465..1467, 1516..1518,1558..1560,1612..1623,1630..1632,1636..1641, 1750..1752,1756..1758,1762..1767,1771..1773,1804..1806, 1813..1815,1849..1851,1855..1866,1870..1872,1984..1989) /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="active site" /db_xref="CDD:173741" misc_feature order(1396..1407,1420..1422,1459..1461,1465..1467, 1558..1560,1612..1623,1630..1632,1639..1641,1762..1767, 1771..1773,1804..1806) /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="ATP binding site [chemical binding]; other site" /db_xref="CDD:173741" misc_feature order(1492..1500,1504..1506,1513..1518,1522..1527, 1534..1539,1573..1575,1579..1581,1600..1602,1717..1719, 1726..1737,1819..1821,1825..1836,1846..1851,2191..2193, 2203..2211) /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="CDK/cyclin interface [polypeptide binding]; other site" /db_xref="CDD:173741" misc_feature order(1516..1518,1636..1638,1750..1752,1756..1758, 1813..1815,1849..1851,1855..1866,1870..1872,1984..1989) /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="substrate binding site [chemical binding]; other site" /db_xref="CDD:173741" misc_feature order(1801..1836,1840..1872) /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="activation loop (A-loop); other site" /db_xref="CDD:173741" misc_feature 1849..1851 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /experiment="experimental evidence, no additional details recorded" /note="phosphorylation site" misc_feature 573..598 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /note="Region: the region absent in variant 1" STS 1062..2478 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /db_xref="UniSTS:484401" variation 1557 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /replace="c" /replace="t" /db_xref="dbSNP:17434073" variation 2013 /gene="CDK11B" /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46; CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58" /replace="a" /replace="g" /db_xref="dbSNP:17424311" ORIGIN
atacaggaagtgacgatacttttggcgcgcgcggttgctgtttcttctctggctccgggaccggcggcggcggcggcggcacgggcggcggcgtagggtgttttaactcaaatgggtgatgaaaaggactcttggaaagtgaaaactttagatgaaattcttcaggaaaagaaacgaaggaaggaacaagaggagaaagcagagataaaacgcttaaaaaattctgatgaccgggattccaagcgggattcccttgaggagggggagctgagagatcactgcatggagatcacaataaggaactccccgtatagaagagaagactctatggaagacagaggagaagaagatgattctttggccatcaaaccaccccagcaaatgtctcggaaagaaaaagttcatcacagaaaagatgaaaagagaaaagagaaaaagcatgctagagtgaaagaaaaagaaagagagcacgaacgtcggaaacgacatcgagaagaacaggataaagctcgccgggaatgggaaagacagaagagaagggaaatggcaagggagcattccaggagagaaagggggaatgatggcgtgtgcctcttcagggaccgcttggagcagttagaaaggaagcgggagcgggagcgcaagatgcgggagcagcagaaggagcagcgggagcagaaggagcgcgagcggcgggcggaggagcggcgcaaggagcgggaggcccgcagggaagtgtctgcacatcaccgaacgatgagagaggactacagcgacaaagtgaaagccagccactggagtcgcagcccgcctcggccgccgcgggagcggttcgagttgggagacggccggaagccagtaaaagaagagaaaatggaagaaagggacctgctgtccgacttacaggacatcagcgacagcgagaggaagaccagctcggccgagtcctcgtcagcagaatcaggctcaggttctgaggaagaagaggaggaggaggaagaggaggaggaggaagggagcaccagtgaagaatcagaggaggaggaggaggaagaggaagaggaggaggaggagaccggcagcaactctgaggaggcatcagagcagtctgccgaagaagtaagtgaggaagaaatgagtgaagatgaagaacgagaaaatgaaaaccacctcttggttgttccagagtcacggttcgaccgagattccggggagagtgaagaagcagaggaagaagtgggtgagggaacgccgcagagcagcgccctgacagagggcgactatgtgcccgactcccctgccctgtcgcccatcgagctcaagcaggagctgcccaagtacctgccggccctgcagggctgccggagcgtcgaggagttccagtgcctgaacaggatcgaggagggcacctatggagtggtctacagagcaaaagacaagaaaacagatgaaattgtggctctaaagcggctgaagatggagaaggagaaggagggcttcccgatcacgtcgctgagggagatcaacaccatcctcaaggcccagcatcccaacatcgtcaccgttagagagattgtggtgggcagcaacatggacaagatctacatcgtgatgaactatgtggagcacgacctcaagagcctgatggagaccatgaaacagcccttcctgccaggggaggtgaagaccctgatgatccagctgctgcgtggggtgaaacacctgcacgacaactggatcctgcaccgtgacctcaagacgtccaacctgctgctgagccacgccggcatcctcaaggtgggtgacttcgggctggcgcgggagtacggatcccctctgaaggcctacaccccggtcgtggtgaccctgtggtaccgcgccccagagctgctgcttggtgccaaggaatactccacggccgtggacatgtggtcagtgggttgcatcttcggggagctgctgactcagaagcctctgttccccgggaagtcagaaatcgatcagatcaacaaggtgttcaaggatctggggacccctagtgagaaaatctggcccggctacagcgagctcccagcagtcaagaagatgaccttcagcgagcacccctacaacaacctccgcaagcgcttcggggctctgctctcagaccagggcttcgacctcatgaacaagttcctgacctacttccccgggaggaggatcagcgctgaggacggcctcaagcatgagtatttccgcgagacccccctccccatcgacccctccatgttccccacgtggcccgccaagagcgagcagcagcgtgtgaagcggggcaccagcccgaggccccctgagggaggcctgggctacagccagctgggtgacgacgacctgaaggagacgggcttccaccttaccaccacgaaccagggggcctctgccgcgggccccggcttcagcctcaagttctgaaggtcagagtggaccccgtcatgggg
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:984 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS GeneID:984 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA GeneID:984 -> Molecular function: GO:0004693 [cyclin-dependent protein serine/threonine kinase activity] evidence: IEA GeneID:984 -> Molecular function: GO:0005515 [protein binding] evidence: IPI GeneID:984 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA GeneID:984 -> Biological process: GO:0001558 [regulation of cell growth] evidence: IEP GeneID:984 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS GeneID:984 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA GeneID:984 -> Biological process: GO:0006915 [apoptotic process] evidence: NAS GeneID:984 -> Biological process: GO:0007067 [mitosis] evidence: NAS GeneID:984 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS GeneID:984 -> Biological process: GO:0050684 [regulation of mRNA processing] evidence: IDA GeneID:984 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:984 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA ANNOTATIONS from NCBI Entrez Gene (20130726): NP_277027 -> EC 2.7.11.22
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.