GGRNA Home | Help | Advanced search

2024-04-27 11:09:07, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_033489               2533 bp    mRNA    linear   PRI 14-APR-2013
DEFINITION  Homo sapiens cyclin-dependent kinase 11B (CDK11B), transcript
            variant 5, mRNA.
ACCESSION   NM_033489
VERSION     NM_033489.1  GI:16332363
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2533)
  AUTHORS   Duan,Z., Zhang,J., Choy,E., Harmon,D., Liu,X., Nielsen,P.,
            Mankin,H., Gray,N.S. and Hornicek,F.J.
  TITLE     Systematic kinome shRNA screening identifies CDK11 (PITSLRE) kinase
            expression is critical for osteosarcoma cell growth and
            proliferation
  JOURNAL   Clin. Cancer Res. 18 (17), 4580-4588 (2012)
   PUBMED   22791884
  REMARK    GeneRIF: CDK11 signaling is essential in osteosarcoma cell growth
            and survival, further elucidating the regulatory mechanisms
            controlling the expression of CDK11 and ultimately develop a CDK11
            inhibitor that may provide therapeutic benefit against
            osteosarcoma.
REFERENCE   2  (bases 1 to 2533)
  AUTHORS   Zhang,G., Jiang,J., Luo,S., Tang,S., Liang,J. and Yao,P.
  TITLE     Analyses of CDC2L1 gene mutations in keloid tissue
  JOURNAL   Clin. Exp. Dermatol. 37 (3), 277-283 (2012)
   PUBMED   22188294
  REMARK    GeneRIF: We have identified a correlation between two exon 7
            mutations of the CDC2L1 gene and keloid disease.
REFERENCE   3  (bases 1 to 2533)
  AUTHORS   Wilkinson,S., Croft,D.R., O'Prey,J., Meedendorp,A., O'Prey,M.,
            Dufes,C. and Ryan,K.M.
  TITLE     The cyclin-dependent kinase PITSLRE/CDK11 is required for
            successful autophagy
  JOURNAL   Autophagy 7 (11), 1295-1301 (2011)
   PUBMED   21808150
  REMARK    GeneRIF: Since PITSLRE/CDK11 regulates autophagy in both Drosophila
            and human cells, this kinase represents a novel phylogenetically
            conserved component of the autophagy machinery.
REFERENCE   4  (bases 1 to 2533)
  AUTHORS   Bajic,V.P., Su,B., Lee,H.G., Kudo,W., Siedlak,S.L., Zivkovic,L.,
            Spremo-Potparevic,B., Djelic,N., Milicevic,Z., Singh,A.K.,
            Fahmy,L.M., Wang,X., Smith,M.A. and Zhu,X.
  TITLE     Mislocalization of CDK11/PITSLRE, a regulator of the G2/M phase of
            the cell cycle, in Alzheimer disease
  JOURNAL   Cell. Mol. Biol. Lett. 16 (3), 359-372 (2011)
   PUBMED   21461981
  REMARK    GeneRIF: These data suggest that CDK11 may play a vital role in
            cell cycle re-entry in Alzheimer disease neurons in an
            APP-dependent manner.
REFERENCE   5  (bases 1 to 2533)
  AUTHORS   Hao,Y., Kong,X., Ruan,Y., Gan,H., Chen,H., Zhang,C., Ren,S. and
            Gu,J.
  TITLE     CDK11p46 and RPS8 associate with each other and suppress
            translation in a synergistic manner
  JOURNAL   Biochem. Biophys. Res. Commun. 407 (1), 169-174 (2011)
   PUBMED   21371428
  REMARK    GeneRIF: Taken together, these results provide evidence for the
            novel role of CDK11p46 in the regulation of translation and cell
            apoptosis.
REFERENCE   6  (bases 1 to 2533)
  AUTHORS   White,P.S., Maris,J.M., Beltinger,C., Sulman,E., Marshall,H.N.,
            Fujimori,M., Kaufman,B.A., Biegel,J.A., Allen,C., Hilliard,C.,
            Valentine,M.B., Look,A.T., Enomoto,H., Sakiyama,S. and Brodeur,G.M.
  TITLE     A region of consistent deletion in neuroblastoma maps within human
            chromosome 1p36.2-36.3
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 92 (12), 5520-5524 (1995)
   PUBMED   7777541
REFERENCE   7  (bases 1 to 2533)
  AUTHORS   Lahti,J.M., Valentine,M., Xiang,J., Jones,B., Amann,J., Grenet,J.,
            Richmond,G., Look,A.T. and Kidd,V.J.
  TITLE     Alterations in the PITSLRE protein kinase gene complex on
            chromosome 1p36 in childhood neuroblastoma
  JOURNAL   Nat. Genet. 7 (3), 370-375 (1994)
   PUBMED   7920654
REFERENCE   8  (bases 1 to 2533)
  AUTHORS   Eipers,P.G., Lahti,J.M. and Kidd,V.J.
  TITLE     Structure and expression of the human p58clk-1 protein kinase
            chromosomal gene
  JOURNAL   Genomics 13 (3), 613-621 (1992)
   PUBMED   1639388
REFERENCE   9  (bases 1 to 2533)
  AUTHORS   Eipers,P.G., Barnoski,B.L., Han,J., Carroll,A.J. and Kidd,V.J.
  TITLE     Localization of the expressed human p58 protein kinase chromosomal
            gene to chromosome 1p36 and a highly related sequence to chromosome
            15
  JOURNAL   Genomics 11 (3), 621-629 (1991)
   PUBMED   1774066
REFERENCE   10 (bases 1 to 2533)
  AUTHORS   Bunnell,B.A., Heath,L.S., Adams,D.E., Lahti,J.M. and Kidd,V.J.
  TITLE     Increased expression of a 58-kDa protein kinase leads to changes in
            the CHO cell cycle
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 87 (19), 7467-7471 (1990)
   PUBMED   2217177
  REMARK    Erratum:[Proc Natl Acad Sci U S A 1991 Mar 15;88(6):2612]
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from AF067516.1.
            
            Summary: This gene encodes a member of the p34Cdc2 protein kinase
            family. p34Cdc2 kinase family members are known to be essential for
            eukaryotic cell cycle control. This gene is in close proximity to
            CDC2L2, a nearly identical gene in the same chromosomal region. The
            gene loci including this gene, CDC2L2, as well as metalloprotease
            MMP21/22, consist of two identical, tandemly linked genomic regions
            which are thought to be a part of the larger region that has been
            duplicated. This gene and CDC2L2 were shown to be deleted or
            altered frequently in neuroblastoma with amplified MYCN genes. The
            protein kinase encoded by this gene could be cleaved by caspases
            and was demonstrated to play roles in cell apoptosis. Several
            alternatively spliced variants of this gene have been reported.
            [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (5) contains an additional 5'
            internal fragment and lacks an internal coding region when compared
            to variant 1. The additional fragment leads to a translation frame
            shift. The resulting protein has a unique first 3 aa and a 37 aa
            truncation at the N-terminus, as well as lacks an internal
            fragment, as compared to isoform 1.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF067516.1 [ECO:0000332]
            ##Evidence-Data-END##
FEATURES             Location/Qualifiers
     source          1..2533
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="1"
                     /map="1p36.33"
     gene            1..2533
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="cyclin-dependent kinase 11B"
                     /db_xref="GeneID:984"
                     /db_xref="HGNC:1729"
                     /db_xref="HPRD:08909"
                     /db_xref="MIM:176873"
     misc_feature    222..224
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="upstream in-frame stop codon"
     misc_feature    223..269
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="Region: the region absent in variant 1"
     CDS             261..2507
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /EC_number="2.7.11.22"
                     /note="isoform 5 is encoded by transcript variant 5; cell
                     division cycle 2-like 1 (PITSLRE proteins); CDC-related
                     protein kinase p58; cell division cycle 2-like protein
                     kinase 1; PITSLRE serine/threonine-protein kinase CDC2L1;
                     cell division protein kinase 11B;
                     galactosyltransferase-associated protein kinase p58/GTA;
                     PITSLREA; p58 CLK-1"
                     /codon_start=1
                     /product="cyclin-dependent kinase 11B isoform 5"
                     /protein_id="NP_277024.1"
                     /db_xref="GI:16332364"
                     /db_xref="GeneID:984"
                     /db_xref="HGNC:1729"
                     /db_xref="HPRD:08909"
                     /db_xref="MIM:176873"
                     /translation="
MSQSDDRDSKRDSLEEGELRDHRMEITIRNSPYRREDSMEDRGEEDDSLAIKPPQQMSRKEKVHHRKDEKRKEKRRHRSHSAEGGKHARVKEKEREHERRKRHREEQDKARREWERQKRREMAREHSRRERDRLEQLERKRERERKMREQQKEQREQKERERRAEERRKEREARREVSAHHRTMREDYSDKVKASHWSRSPPRPPRERFELGDGRKPVKEEKMEERDLLSDLQDISDSERKTSSAESSSAESGSGSEEEEEEEEEEEEEGSTSEESEEEEEEEEEEEEETGSNSEEASEQSAEEVSEEEMSEDEERENENHLLVVPESRFDRDSGESEEAEEEVGEGTPQSSALTEGDYVPDSPALSPIELKQELPKYLPALQGCRSVEEFQCLNRIEEGTYGVVYRAKDKKTDEIVALKRLKMEKEKEGFPITSLREINTILKAQHPNIVTVREIVVGSNMDKIYIVMNYVEHDLKSLMETMKQPFLPGEVKTLMIQLLRGVKHLHDNWILHRDLKTSNLLLSHAGILKVGDFGLAREYGSPLKAYTPVVVTLWYRAPELLLGAKEYSTAVDMWSVGCIFGELLTQKPLFPGKSEIDQINKVFKDLGTPSEKIWPGYSELPAVKKMTFSEHPYNNLRKRFGALLSDQGFDLMNKFLTYFPGRRISAEDGLKHEYFRETPLPIDPSMFPTWPAKSEQQRVKRGTSPRPPEGGLGYSQLGDDDLKETGFHLTTTNQGASAAGPGFSLKF
"
     misc_feature    297..299
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    966..968
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    966..968
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     misc_feature    1413..2288
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="Catalytic domain of the Serine/Threonine Kinase,
                     Cell Division Cycle 2-like 1; Region: STKc_CDC2L1;
                     cd07843"
                     /db_xref="CDD:173741"
     misc_feature    1422..2294
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="cyclin-dependent kinase A; Provisional; Region:
                     PLN00009"
                     /db_xref="CDD:177649"
     misc_feature    order(1449..1460,1473..1475,1512..1514,1518..1520,
                     1569..1571,1611..1613,1665..1676,1683..1685,1689..1694,
                     1803..1805,1809..1811,1815..1820,1824..1826,1857..1859,
                     1866..1868,1902..1904,1908..1919,1923..1925,2037..2042)
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="active site"
                     /db_xref="CDD:173741"
     misc_feature    order(1449..1460,1473..1475,1512..1514,1518..1520,
                     1611..1613,1665..1676,1683..1685,1692..1694,1815..1820,
                     1824..1826,1857..1859)
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="ATP binding site [chemical binding]; other site"
                     /db_xref="CDD:173741"
     misc_feature    order(1545..1553,1557..1559,1566..1571,1575..1580,
                     1587..1592,1626..1628,1632..1634,1653..1655,1770..1772,
                     1779..1790,1872..1874,1878..1889,1899..1904,2244..2246,
                     2256..2264)
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="CDK/cyclin interface [polypeptide binding]; other
                     site"
                     /db_xref="CDD:173741"
     misc_feature    order(1569..1571,1689..1691,1803..1805,1809..1811,
                     1866..1868,1902..1904,1908..1919,1923..1925,2037..2042)
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="substrate binding site [chemical binding]; other
                     site"
                     /db_xref="CDD:173741"
     misc_feature    order(1854..1889,1893..1925)
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /note="activation loop (A-loop); other site"
                     /db_xref="CDD:173741"
     misc_feature    1902..1904
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="phosphorylation site"
     STS             1115..2531
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /db_xref="UniSTS:484401"
     variation       1610
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:17434073"
     variation       2066
                     /gene="CDK11B"
                     /gene_synonym="CDC2L1; CDK11; CDK11-p110; CDK11-p46;
                     CDK11-p58; CLK-1; p58; p58CDC2L1; p58CLK-1; PK58"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:17424311"
ORIGIN      
atacaggaagtgacgatacttttggcgcgcgcggttgctgtttcttctctggctccgggaccggcggcggcggcggcggcacgggcggcggcgtagggtgttttaactcaaatgggtgatgaaaaggactcttggaaagtgaaaactttagatgaaattcttcaggaaaagaaacgaaggaaggaacaagaggagaaagcagagataaaacgcttaaaaaataacaacgcttcttcggtgaagttcttttgtacttccaaatgtcgcagtctgatgaccgggattccaagcgggattcccttgaggagggggagctgagagatcaccgcatggagatcacaataaggaactccccgtatagaagagaagactctatggaagacagaggagaagaagatgattctttggccatcaaaccaccccagcaaatgtctcggaaagaaaaagttcatcacagaaaagatgaaaagagaaaagagaaacgtaggcatcgtagccattcagcagaaggggggaagcatgctagagtgaaagaaaaagaaagagagcacgaacgtcggaaacgacatcgagaagaacaggataaagctcgccgggaatgggaaagacagaagagaagggaaatggcaagggagcattccaggagagaaagggaccgcttggagcagttagaaaggaagcgggagcgggagcgcaagatgcgggagcagcagaaggagcagcgggagcagaaggagcgcgagcggcgggcggaggagcggcgcaaggagcgggaggcccgcagggaagtgtctgcacatcaccgaacgatgagagaggactacagcgacaaagtgaaagccagccactggagtcgcagcccgcctcggccgccgcgggagcggttcgagttgggagacggccggaagccagtaaaagaagagaaaatggaagaaagggacctgctgtccgacttacaggacatcagcgacagcgagaggaagaccagctcggccgagtcctcgtcagcagaatcaggctcaggttctgaggaagaagaggaggaggaggaagaggaggaggaggaagggagcaccagtgaagaatcagaggaggaggaggaggaagaggaagaggaggaggaggagaccggcagcaactctgaggaggcatcagagcagtctgccgaagaagtaagtgaggaagaaatgagtgaagatgaagaacgagaaaatgaaaaccacctcttggttgttccagagtcacggttcgaccgagattccggggagagtgaagaagcagaggaagaagtgggtgagggaacgccgcagagcagcgccctgacagagggcgactatgtgcccgactcccctgccctgtcgcccatcgagctcaagcaggagctgcccaagtacctgccggccctgcagggctgccggagcgtcgaggagttccagtgcctgaacaggatcgaggagggcacctatggagtggtctacagagcaaaagacaagaaaacagatgaaattgtggctctaaagcggctgaagatggagaaggagaaggagggcttcccgatcacgtcgctgagggagatcaacaccatcctcaaggcccagcatcccaacatcgtcaccgttagagagattgtggtgggcagcaacatggacaagatctacatcgtgatgaactatgtggagcacgacctcaagagcctgatggagaccatgaaacagcccttcctgccaggggaggtgaagaccctgatgatccagctgctgcgtggggtgaaacacctgcacgacaactggatcctgcaccgtgacctcaagacgtccaacctgctgctgagccacgccggcatcctcaaggtgggtgacttcgggctggcgcgggagtacggatcccctctgaaggcctacaccccggtcgtggtgaccctgtggtaccgcgccccagagctgctgcttggtgccaaggaatactccacggccgtggacatgtggtcagtgggttgcatcttcggggagctgctgactcagaagcctctgttccccgggaagtcagaaatcgatcagatcaacaaggtgttcaaggatctggggacccctagtgagaaaatctggcccggctacagcgagctcccagcagtcaagaagatgaccttcagcgagcacccctacaacaacctccgcaagcgcttcggggctctgctctcagaccagggcttcgacctcatgaacaagttcctgacctacttccccgggaggaggatcagcgctgaggacggcctcaagcatgagtatttccgcgagacccccctccccatcgacccctccatgttccccacgtggcccgccaagagcgagcagcagcgtgtgaagcggggcaccagcccgaggccccctgagggaggcctgggctacagccagctgggtgacgacgacctgaaggagacgggcttccaccttaccaccacgaaccagggggcctctgccgcgggccccggcttcagcctcaagttctgaaggtcagagtggaccccgtcatgggg
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:984 -> Molecular function: GO:0004672 [protein kinase activity] evidence: TAS
            GeneID:984 -> Molecular function: GO:0004674 [protein serine/threonine kinase activity] evidence: IDA
            GeneID:984 -> Molecular function: GO:0004693 [cyclin-dependent protein serine/threonine kinase activity] evidence: IEA
            GeneID:984 -> Molecular function: GO:0005515 [protein binding] evidence: IPI
            GeneID:984 -> Molecular function: GO:0005524 [ATP binding] evidence: IDA
            GeneID:984 -> Biological process: GO:0001558 [regulation of cell growth] evidence: IEP
            GeneID:984 -> Biological process: GO:0006355 [regulation of transcription, DNA-dependent] evidence: NAS
            GeneID:984 -> Biological process: GO:0006468 [protein phosphorylation] evidence: IDA
            GeneID:984 -> Biological process: GO:0006915 [apoptotic process] evidence: NAS
            GeneID:984 -> Biological process: GO:0007067 [mitosis] evidence: NAS
            GeneID:984 -> Biological process: GO:0008283 [cell proliferation] evidence: TAS
            GeneID:984 -> Biological process: GO:0050684 [regulation of mRNA processing] evidence: IDA
            GeneID:984 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:984 -> Cellular component: GO:0005737 [cytoplasm] evidence: IDA
ANNOTATIONS from NCBI Entrez Gene (20130726):
            NP_277024 -> EC 2.7.11.22

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.