GGRNA Home | Help | Advanced search

2024-03-28 20:40:20, GGRNA : RefSeq release 60 (20130726)

LOCUS       NM_033304               2001 bp    mRNA    linear   PRI 01-JUL-2013
DEFINITION  Homo sapiens adrenoceptor alpha 1A (ADRA1A), transcript variant 4,
            mRNA.
ACCESSION   NM_033304
VERSION     NM_033304.2  GI:111118989
KEYWORDS    RefSeq.
SOURCE      Homo sapiens (human)
  ORGANISM  Homo sapiens
            Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
            Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
            Catarrhini; Hominidae; Homo.
REFERENCE   1  (bases 1 to 2001)
  AUTHORS   Hennenberg,M., Miersch,J., Rutz,B., Strittmatter,F., Waidelich,R.,
            Stief,C.G. and Gratzke,C.
  TITLE     Noradrenaline induces binding of Clathrin light chain A to
            alpha1-adrenoceptors in the human prostate
  JOURNAL   Prostate 73 (7), 715-723 (2013)
   PUBMED   23460120
  REMARK    GeneRIF: Upon receptor activation, prostate alpha1A-adrenoceptors
            bind clathrin LCA.
REFERENCE   2  (bases 1 to 2001)
  AUTHORS   Kelsey,R.M., Alpert,B.S., Dahmer,M.K., Krushkal,J. and Quasney,M.W.
  TITLE     Alpha-adrenergic receptor gene polymorphisms and cardiovascular
            reactivity to stress in Black adolescents and young adults
  JOURNAL   Psychophysiology 49 (3), 401-412 (2012)
   PUBMED   22091949
  REMARK    GeneRIF: Arg492Cys polymorphism in the alpha(1A) -AR gene was
            associated with heart rate reactivity to stress in young African
            Americans.
REFERENCE   3  (bases 1 to 2001)
  AUTHORS   Cheng,C., Chiu,H.J., Loh,el.-W., Chan,C.H., Hwu,T.M., Liu,Y.R. and
            Lan,T.H.
  TITLE     Association of the ADRA1A gene and the severity of metabolic
            abnormalities in patients with schizophrenia
  JOURNAL   Prog. Neuropsychopharmacol. Biol. Psychiatry 36 (1), 205-210 (2012)
   PUBMED   22037178
  REMARK    GeneRIF: Presence of the Arg347 allele in the ADRA1A gene is a risk
            factor for occurrence of more severe metabolic abnormalities in
            patients with schizophrenia.
REFERENCE   4  (bases 1 to 2001)
  AUTHORS   Hart,A.B., Engelhardt,B.E., Wardle,M.C., Sokoloff,G., Stephens,M.,
            de Wit,H. and Palmer,A.A.
  TITLE     Genome-wide association study of d-amphetamine response in healthy
            volunteers identifies putative associations, including cadherin 13
            (CDH13)
  JOURNAL   PLoS ONE 7 (8), E42646 (2012)
   PUBMED   22952603
REFERENCE   5  (bases 1 to 2001)
  AUTHORS   Oganesian,A., Yarov-Yarovoy,V., Parks,W.C. and Schwinn,D.A.
  TITLE     Constitutive coupling of a naturally occurring human
            alpha1a-adrenergic receptor genetic variant to EGFR transactivation
            pathway
  JOURNAL   Proc. Natl. Acad. Sci. U.S.A. 108 (49), 19796-19801 (2011)
   PUBMED   22089237
  REMARK    GeneRIF: Data show that elevated levels of matrix
            metalloproteinase-7 (MMP7) and a disintegrin and
            metalloproteinase-12 (ADAM12) in alpha(1a)-247R-expressing cells
            are responsible for EGF receptor (EGFR) transactivation.
REFERENCE   6  (bases 1 to 2001)
  AUTHORS   Hirasawa,A., Shibata,K., Horie,K., Takei,Y., Obika,K., Tanaka,T.,
            Muramoto,N., Takagaki,K., Yano,J. and Tsujimoto,G.
  TITLE     Cloning, functional expression and tissue distribution of human
            alpha 1c-adrenoceptor splice variants
  JOURNAL   FEBS Lett. 363 (3), 256-260 (1995)
   PUBMED   7737411
REFERENCE   7  (bases 1 to 2001)
  AUTHORS   Schwinn,D.A., Johnston,G.I., Page,S.O., Mosley,M.J., Wilson,K.H.,
            Worman,N.P., Campbell,S., Fidock,M.D., Furness,L.M.,
            Parry-Smith,D.J. et al.
  TITLE     Cloning and pharmacological characterization of human alpha-1
            adrenergic receptors: sequence corrections and direct comparison
            with other species homologues
  JOURNAL   J. Pharmacol. Exp. Ther. 272 (1), 134-142 (1995)
   PUBMED   7815325
REFERENCE   8  (bases 1 to 2001)
  AUTHORS   Diehl,N.L. and Shreeve,S.M.
  TITLE     Identification of the alpha 1c-adrenoceptor in rabbit arteries and
            the human saphenous vein using the polymerase chain reaction
  JOURNAL   Eur. J. Pharmacol. 268 (3), 393-398 (1994)
   PUBMED   7805763
REFERENCE   9  (bases 1 to 2001)
  AUTHORS   Hoehe,M.R., Berrettini,W.H., Schwinn,D.A. and Hsieh,W.T.
  TITLE     A two-allele PstI RFLP for the alpha-1C adrenergic receptor gene
            (ADRA1C)
  JOURNAL   Hum. Mol. Genet. 1 (5), 349 (1992)
   PUBMED   1363873
REFERENCE   10 (bases 1 to 2001)
  AUTHORS   Schwinn,D.A., Lomasney,J.W., Lorenz,W., Szklut,P.J., Fremeau,R.T.
            Jr., Yang-Feng,T.L., Caron,M.G., Lefkowitz,R.J. and Cotecchia,S.
  TITLE     Molecular cloning and expression of the cDNA for a novel alpha
            1-adrenergic receptor subtype
  JOURNAL   J. Biol. Chem. 265 (14), 8183-8189 (1990)
   PUBMED   1970822
COMMENT     REVIEWED REFSEQ: This record has been curated by NCBI staff. The
            reference sequence was derived from D32201.1, AF013261.1 and
            AC091675.5.
            On Aug 2, 2006 this sequence version replaced gi:15451760.
            
            Summary: Alpha-1-adrenergic receptors (alpha-1-ARs) are members of
            the G protein-coupled receptor superfamily. They activate mitogenic
            responses and regulate growth and proliferation of many cells.
            There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of
            which signal through the Gq/11 family of G-proteins and different
            subtypes show different patterns of activation. This gene encodes
            alpha-1A-adrenergic receptor. Alternative splicing of this gene
            generates four transcript variants, which encode four different
            isoforms with distinct C-termini but having similar ligand binding
            properties. [provided by RefSeq, Jul 2008].
            
            Transcript Variant: This variant (4) includes an alternate 3'
            terminal exon, compared to variant 3. It encodes isoform 4, which
            has a longer and distinct C-terminus, compared to isoform 3.
            
            Publication Note:  This RefSeq record includes a subset of the
            publications that are available for this gene. Please see the Gene
            record to access additional publications.
            
            ##Evidence-Data-START##
            Transcript exon combination :: AF013261.1 [ECO:0000332]
            ##Evidence-Data-END##
PRIMARY     REFSEQ_SPAN         PRIMARY_IDENTIFIER PRIMARY_SPAN        COMP
            1-236               D32201.1           1-236
            237-1791            AF013261.1         1-1555
            1792-2001           AC091675.5         89018-89227
FEATURES             Location/Qualifiers
     source          1..2001
                     /organism="Homo sapiens"
                     /mol_type="mRNA"
                     /db_xref="taxon:9606"
                     /chromosome="8"
                     /map="8p21.2"
     gene            1..2001
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /note="adrenoceptor alpha 1A"
                     /db_xref="GeneID:148"
                     /db_xref="HGNC:277"
                     /db_xref="MIM:104221"
     exon            1..1319
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="alignment:Splign:1.39.8"
     STS             346..1837
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /db_xref="UniSTS:485346"
     misc_feature    350..352
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /note="upstream in-frame stop codon"
     variation       388
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /replace="a"
                     /replace="c"
                     /db_xref="dbSNP:34259227"
     CDS             437..1804
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /note="isoform 4 is encoded by transcript variant 4;
                     adrenergic, alpha-1A-, receptor variant 1; adrenergic,
                     alpha-1A-, receptor variant 3; adrenergic, alpha-1A-,
                     receptor variant 5; adrenergic, alpha-1A-, receptor
                     variant 8; G protein coupled receptor; alpha-1A
                     adrenoceptor; alpha-1A adrenoreceptor; alpha-1C adrenergic
                     receptor"
                     /codon_start=1
                     /product="alpha-1A adrenergic receptor isoform 4"
                     /protein_id="NP_150647.2"
                     /db_xref="GI:111118990"
                     /db_xref="CCDS:CCDS6053.1"
                     /db_xref="GeneID:148"
                     /db_xref="HGNC:277"
                     /db_xref="MIM:104221"
                     /translation="
MVFLSGNASDSSNCTQPPAPVNISKAILLGVILGGLILFGVLGNILVILSVACHRHLHSVTHYYIVNLAVADLLLTSTVLPFSAIFEVLGYWAFGRVFCNIWAAVDVLCCTASIMGLCIISIDRYIGVSYPLRYPTIVTQRRGLMALLCVWALSLVISIGPLFGWRQPAPEDETICQINEEPGYVLFSALGSFYLPLAIILVMYCRVYVVAKRESRGLKSGLKTDKSDSEQVTLRIHRKNAPAGGSGMASAKTKTHFSVRLLKFSREKKAAKTLGIVVGCFVLCWLPFFLVMPIGSFFPDFKPSETVFKIVFWLGYLNSCINPIIYPCSSQEFKKAFQNVLRIQCLCRKQSSKHALGYTLHPPSQAVEGQHKDMVRIPVGSRETFYRISKTDGVCEWKFFSSMPRGSARITVSKDQSSCTTARRGMDCRYFTKNCREHIKHVNFMMPPWRKGSEC
"
     misc_feature    518..589
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35348.2);
                     transmembrane region"
     misc_feature    587..1414
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /note="7 transmembrane receptor (rhodopsin family);
                     Region: 7tm_1; pfam00001"
                     /db_xref="CDD:200918"
     misc_feature    596..1459
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /note="Olfactory receptor; Region: 7tm_4; cl10458"
                     /db_xref="CDD:209142"
     misc_feature    629..700
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35348.2);
                     transmembrane region"
     misc_feature    734..802
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35348.2);
                     transmembrane region"
     misc_feature    866..937
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35348.2);
                     transmembrane region"
     misc_feature    980..1051
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35348.2);
                     transmembrane region"
     misc_feature    1256..1327
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35348.2);
                     transmembrane region"
     misc_feature    1352..1423
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="non-experimental evidence, no additional
                     details recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35348.2);
                     transmembrane region"
     misc_feature    1436..1483
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /experiment="experimental evidence, no additional details
                     recorded"
                     /note="propagated from UniProtKB/Swiss-Prot (P35348.2);
                     Region: Nuclear localization signal"
     variation       898
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:2229124"
     variation       1035
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /replace="g"
                     /replace="t"
                     /db_xref="dbSNP:2229125"
     variation       1175
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3730287"
     exon            1320..1705
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="alignment:Splign:1.39.8"
     variation       1475
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /replace="c"
                     /replace="t"
                     /db_xref="dbSNP:1048101"
     variation       1562
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /replace="c"
                     /replace="g"
                     /db_xref="dbSNP:1496121"
     variation       1677
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /replace="a"
                     /replace="g"
                     /db_xref="dbSNP:3730247"
     exon            1706..2001
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /inference="alignment:Splign:1.39.8"
     variation       1894..1895
                     /gene="ADRA1A"
                     /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR"
                     /replace=""
                     /replace="tttcttttcacaa"
                     /db_xref="dbSNP:34651910"
ORIGIN      
gaattccgaatcatgtgcagaatgctgaatcttcccccagccaggacgaataagacagcgcggaaaagcagattctcgtaattctggaattgcatgttgcaaggagtctcctggatcttcgcacccagcttcgggtagggagggagtccgggtcccgggctaggccagcccggcaggtggagagggtccccggcagccccgcgcgcccctggccatgtctttaatgccctgccccttcatgtggccttctgagggttcccagggctggccagggttgtttcccacccgcgcgcgcgctctcacccccagccaaacccacctggcagggctccctccagccgagaccttttgattcccggctcccgcgctcccgcctccgcgccagcccgggaggtggccctggacagccggacctcgcccggccccggctgggaccatggtgtttctctcgggaaatgcttccgacagctccaactgcacccaaccgccggcaccggtgaacatttccaaggccattctgctcggggtgatcttggggggcctcattcttttcggggtgctgggtaacatcctagtgatcctctccgtagcctgtcaccgacacctgcactcagtcacgcactactacatcgtcaacctggcggtggccgacctcctgctcacctccacggtgctgcccttctccgccatcttcgaggtcctaggctactgggccttcggcagggtcttctgcaacatctgggcggcagtggatgtgctgtgctgcaccgcgtccatcatgggcctctgcatcatctccatcgaccgctacatcggcgtgagctacccgctgcgctacccaaccatcgtcacccagaggaggggtctcatggctctgctctgcgtctgggcactctccctggtcatatccattggacccctgttcggctggaggcagccggcccccgaggacgagaccatctgccagatcaacgaggagccgggctacgtgctcttctcagcgctgggctccttctacctgcctctggccatcatcctggtcatgtactgccgcgtctacgtggtggccaagagggagagccggggcctcaagtctggcctcaagaccgacaagtcggactcggagcaagtgacgctccgcatccatcggaaaaacgccccggcaggaggcagcgggatggccagcgccaagaccaagacgcacttctcagtgaggctcctcaagttctcccgggagaagaaagcggccaaaacgctgggcatcgtggtcggctgcttcgtcctctgctggctgccttttttcttagtcatgcccattgggtctttcttccctgatttcaagccctctgaaacagtttttaaaatagtattttggctcggatatctaaacagctgcatcaaccccatcatatacccatgctccagccaagagttcaaaaaggcctttcagaatgtcttgagaatccagtgtctctgcagaaagcagtcttccaaacatgccctgggctacaccctgcacccgcccagccaggccgtggaagggcaacacaaggacatggtgcgcatccccgtgggatcaagagagaccttctacaggatctccaagacggatggcgtttgtgaatggaaatttttctcttccatgccccgtggatctgccaggattacagtgtccaaagaccaatcctcctgtaccacagcccggaggggaatggattgtagatatttcaccaagaattgcagagagcatatcaagcatgtgaattttatgatgccaccgtggagaaagggttcagaatgctgatctccaggtagctggagacctaggcagtctgcaaatgaggagtcagctggaagctatggctatgtattatgtgacatcgcttgttcctaagtgaaaactggatatcccaaccttctggcccagtaggtttcatggttaagacctggtagtgagaacattttaggaactatttgcttgggcaggcaatttttcactct
//

Annotations:

ANNOTATIONS from NCBI Entrez Gene (20130726):
            GeneID:148 -> Molecular function: GO:0004937 [alpha1-adrenergic receptor activity] evidence: ISS
            GeneID:148 -> Molecular function: GO:0004937 [alpha1-adrenergic receptor activity] evidence: NAS
            GeneID:148 -> Molecular function: GO:0004937 [alpha1-adrenergic receptor activity] evidence: TAS
            GeneID:148 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IDA
            GeneID:148 -> Biological process: GO:0001985 [negative regulation of heart rate involved in baroreceptor response to increased systemic arterial blood pressure] evidence: IEA
            GeneID:148 -> Biological process: GO:0001994 [norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure] evidence: IEA
            GeneID:148 -> Biological process: GO:0001996 [positive regulation of heart rate by epinephrine-norepinephrine] evidence: IEA
            GeneID:148 -> Biological process: GO:0001997 [positive regulation of the force of heart contraction by epinephrine-norepinephrine] evidence: IEA
            GeneID:148 -> Biological process: GO:0003084 [positive regulation of systemic arterial blood pressure] evidence: IEA
            GeneID:148 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS
            GeneID:148 -> Biological process: GO:0006939 [smooth muscle contraction] evidence: TAS
            GeneID:148 -> Biological process: GO:0006950 [response to stress] evidence: ISS
            GeneID:148 -> Biological process: GO:0007165 [signal transduction] evidence: TAS
            GeneID:148 -> Biological process: GO:0007186 [G-protein coupled receptor signaling pathway] evidence: TAS
            GeneID:148 -> Biological process: GO:0007200 [phospholipase C-activating G-protein coupled receptor signaling pathway] evidence: IEA
            GeneID:148 -> Biological process: GO:0007202 [activation of phospholipase C activity] evidence: ISS
            GeneID:148 -> Biological process: GO:0007204 [elevation of cytosolic calcium ion concentration] evidence: ISS
            GeneID:148 -> Biological process: GO:0007243 [intracellular protein kinase cascade] evidence: TAS
            GeneID:148 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS
            GeneID:148 -> Biological process: GO:0007512 [adult heart development] evidence: IEA
            GeneID:148 -> Biological process: GO:0007568 [aging] evidence: ISS
            GeneID:148 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: TAS
            GeneID:148 -> Biological process: GO:0009725 [response to hormone stimulus] evidence: ISS
            GeneID:148 -> Biological process: GO:0016049 [cell growth] evidence: IEA
            GeneID:148 -> Biological process: GO:0032229 [negative regulation of synaptic transmission, GABAergic] evidence: ISS
            GeneID:148 -> Biological process: GO:0035024 [negative regulation of Rho protein signal transduction] evidence: ISS
            GeneID:148 -> Biological process: GO:0035265 [organ growth] evidence: IEA
            GeneID:148 -> Biological process: GO:0042493 [response to drug] evidence: ISS
            GeneID:148 -> Biological process: GO:0043410 [positive regulation of MAPK cascade] evidence: IDA
            GeneID:148 -> Biological process: GO:0045760 [positive regulation of action potential] evidence: ISS
            GeneID:148 -> Biological process: GO:0045907 [positive regulation of vasoconstriction] evidence: ISS
            GeneID:148 -> Biological process: GO:0045987 [positive regulation of smooth muscle contraction] evidence: IEA
            GeneID:148 -> Biological process: GO:0060073 [micturition] evidence: IEA
            GeneID:148 -> Biological process: GO:0060402 [calcium ion transport into cytosol] evidence: ISS
            GeneID:148 -> Biological process: GO:0060452 [positive regulation of cardiac muscle contraction] evidence: ISS
            GeneID:148 -> Biological process: GO:0070374 [positive regulation of ERK1 and ERK2 cascade] evidence: ISS
            GeneID:148 -> Biological process: GO:0090037 [positive regulation of protein kinase C signaling cascade] evidence: ISS
            GeneID:148 -> Biological process: GO:0097195 [pilomotor reflex] evidence: IEA
            GeneID:148 -> Cellular component: GO:0005634 [nucleus] evidence: IDA
            GeneID:148 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS
            GeneID:148 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS
            GeneID:148 -> Cellular component: GO:0030018 [Z disc] evidence: IEA
            GeneID:148 -> Cellular component: GO:0030315 [T-tubule] evidence: IEA
            GeneID:148 -> Cellular component: GO:0031965 [nuclear membrane] evidence: IDA

by @meso_cacase at DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.