2024-04-24 02:54:37, GGRNA : RefSeq release 60 (20130726)
LOCUS NM_033302 2089 bp mRNA linear PRI 01-JUL-2013 DEFINITION Homo sapiens adrenoceptor alpha 1A (ADRA1A), transcript variant 3, mRNA. ACCESSION NM_033302 VERSION NM_033302.2 GI:111118987 KEYWORDS RefSeq. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2089) AUTHORS Hennenberg,M., Miersch,J., Rutz,B., Strittmatter,F., Waidelich,R., Stief,C.G. and Gratzke,C. TITLE Noradrenaline induces binding of Clathrin light chain A to alpha1-adrenoceptors in the human prostate JOURNAL Prostate 73 (7), 715-723 (2013) PUBMED 23460120 REMARK GeneRIF: Upon receptor activation, prostate alpha1A-adrenoceptors bind clathrin LCA. REFERENCE 2 (bases 1 to 2089) AUTHORS Kelsey,R.M., Alpert,B.S., Dahmer,M.K., Krushkal,J. and Quasney,M.W. TITLE Alpha-adrenergic receptor gene polymorphisms and cardiovascular reactivity to stress in Black adolescents and young adults JOURNAL Psychophysiology 49 (3), 401-412 (2012) PUBMED 22091949 REMARK GeneRIF: Arg492Cys polymorphism in the alpha(1A) -AR gene was associated with heart rate reactivity to stress in young African Americans. REFERENCE 3 (bases 1 to 2089) AUTHORS Cheng,C., Chiu,H.J., Loh,el.-W., Chan,C.H., Hwu,T.M., Liu,Y.R. and Lan,T.H. TITLE Association of the ADRA1A gene and the severity of metabolic abnormalities in patients with schizophrenia JOURNAL Prog. Neuropsychopharmacol. Biol. Psychiatry 36 (1), 205-210 (2012) PUBMED 22037178 REMARK GeneRIF: Presence of the Arg347 allele in the ADRA1A gene is a risk factor for occurrence of more severe metabolic abnormalities in patients with schizophrenia. REFERENCE 4 (bases 1 to 2089) AUTHORS Hart,A.B., Engelhardt,B.E., Wardle,M.C., Sokoloff,G., Stephens,M., de Wit,H. and Palmer,A.A. TITLE Genome-wide association study of d-amphetamine response in healthy volunteers identifies putative associations, including cadherin 13 (CDH13) JOURNAL PLoS ONE 7 (8), E42646 (2012) PUBMED 22952603 REFERENCE 5 (bases 1 to 2089) AUTHORS Oganesian,A., Yarov-Yarovoy,V., Parks,W.C. and Schwinn,D.A. TITLE Constitutive coupling of a naturally occurring human alpha1a-adrenergic receptor genetic variant to EGFR transactivation pathway JOURNAL Proc. Natl. Acad. Sci. U.S.A. 108 (49), 19796-19801 (2011) PUBMED 22089237 REMARK GeneRIF: Data show that elevated levels of matrix metalloproteinase-7 (MMP7) and a disintegrin and metalloproteinase-12 (ADAM12) in alpha(1a)-247R-expressing cells are responsible for EGF receptor (EGFR) transactivation. REFERENCE 6 (bases 1 to 2089) AUTHORS Hirasawa,A., Shibata,K., Horie,K., Takei,Y., Obika,K., Tanaka,T., Muramoto,N., Takagaki,K., Yano,J. and Tsujimoto,G. TITLE Cloning, functional expression and tissue distribution of human alpha 1c-adrenoceptor splice variants JOURNAL FEBS Lett. 363 (3), 256-260 (1995) PUBMED 7737411 REFERENCE 7 (bases 1 to 2089) AUTHORS Schwinn,D.A., Johnston,G.I., Page,S.O., Mosley,M.J., Wilson,K.H., Worman,N.P., Campbell,S., Fidock,M.D., Furness,L.M., Parry-Smith,D.J. et al. TITLE Cloning and pharmacological characterization of human alpha-1 adrenergic receptors: sequence corrections and direct comparison with other species homologues JOURNAL J. Pharmacol. Exp. Ther. 272 (1), 134-142 (1995) PUBMED 7815325 REFERENCE 8 (bases 1 to 2089) AUTHORS Diehl,N.L. and Shreeve,S.M. TITLE Identification of the alpha 1c-adrenoceptor in rabbit arteries and the human saphenous vein using the polymerase chain reaction JOURNAL Eur. J. Pharmacol. 268 (3), 393-398 (1994) PUBMED 7805763 REFERENCE 9 (bases 1 to 2089) AUTHORS Hoehe,M.R., Berrettini,W.H., Schwinn,D.A. and Hsieh,W.T. TITLE A two-allele PstI RFLP for the alpha-1C adrenergic receptor gene (ADRA1C) JOURNAL Hum. Mol. Genet. 1 (5), 349 (1992) PUBMED 1363873 REFERENCE 10 (bases 1 to 2089) AUTHORS Schwinn,D.A., Lomasney,J.W., Lorenz,W., Szklut,P.J., Fremeau,R.T. Jr., Yang-Feng,T.L., Caron,M.G., Lefkowitz,R.J. and Cotecchia,S. TITLE Molecular cloning and expression of the cDNA for a novel alpha 1-adrenergic receptor subtype JOURNAL J. Biol. Chem. 265 (14), 8183-8189 (1990) PUBMED 1970822 COMMENT REVIEWED REFSEQ: This record has been curated by NCBI staff. The reference sequence was derived from D32201.1 and AC091675.5. On Aug 2, 2006 this sequence version replaced gi:15451756. Summary: Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1A-adrenergic receptor. Alternative splicing of this gene generates four transcript variants, which encode four different isoforms with distinct C-termini but having similar ligand binding properties. [provided by RefSeq, Jul 2008]. Transcript Variant: This variant (3) encodes the shortest isoform (3). Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Gene record to access additional publications. ##Evidence-Data-START## Transcript exon combination :: D32201.1 [ECO:0000332] RNAseq introns :: single sample supports all introns ERS025084, ERS025088 [ECO:0000348] ##Evidence-Data-END## PRIMARY REFSEQ_SPAN PRIMARY_IDENTIFIER PRIMARY_SPAN COMP 1-1472 D32201.1 1-1472 1473-1478 AC091675.5 84568-84573 1479-2089 D32201.1 1479-2089 FEATURES Location/Qualifiers source 1..2089 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /chromosome="8" /map="8p21.2" gene 1..2089 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /note="adrenoceptor alpha 1A" /db_xref="GeneID:148" /db_xref="HGNC:277" /db_xref="MIM:104221" exon 1..1319 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="alignment:Splign:1.39.8" misc_feature 350..352 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /note="upstream in-frame stop codon" variation 388 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /replace="a" /replace="c" /db_xref="dbSNP:34259227" CDS 437..1726 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /note="isoform 3 is encoded by transcript variant 3; adrenergic, alpha-1A-, receptor variant 1; adrenergic, alpha-1A-, receptor variant 3; adrenergic, alpha-1A-, receptor variant 5; adrenergic, alpha-1A-, receptor variant 8; G protein coupled receptor; alpha-1A adrenoceptor; alpha-1A adrenoreceptor; alpha-1C adrenergic receptor" /codon_start=1 /product="alpha-1A adrenergic receptor isoform 3" /protein_id="NP_150645.2" /db_xref="GI:111118988" /db_xref="CCDS:CCDS6052.1" /db_xref="GeneID:148" /db_xref="HGNC:277" /db_xref="MIM:104221" /translation="
MVFLSGNASDSSNCTQPPAPVNISKAILLGVILGGLILFGVLGNILVILSVACHRHLHSVTHYYIVNLAVADLLLTSTVLPFSAIFEVLGYWAFGRVFCNIWAAVDVLCCTASIMGLCIISIDRYIGVSYPLRYPTIVTQRRGLMALLCVWALSLVISIGPLFGWRQPAPEDETICQINEEPGYVLFSALGSFYLPLAIILVMYCRVYVVAKRESRGLKSGLKTDKSDSEQVTLRIHRKNAPAGGSGMASAKTKTHFSVRLLKFSREKKAAKTLGIVVGCFVLCWLPFFLVMPIGSFFPDFKPSETVFKIVFWLGYLNSCINPIIYPCSSQEFKKAFQNVLRIQCLCRKQSSKHALGYTLHPPSQAVEGQHKDMVRIPVGSRETFYRISKTDGVCEWKFFSSMPRGSARITVSKDQSSCTTARGHTPMT
" misc_feature 518..589 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35348.2); transmembrane region" misc_feature 587..1414 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /note="7 transmembrane receptor (rhodopsin family); Region: 7tm_1; pfam00001" /db_xref="CDD:200918" misc_feature 596..1459 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /note="Olfactory receptor; Region: 7tm_4; cl10458" /db_xref="CDD:209142" misc_feature 629..700 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35348.2); transmembrane region" misc_feature 734..802 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35348.2); transmembrane region" misc_feature 866..937 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35348.2); transmembrane region" misc_feature 980..1051 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35348.2); transmembrane region" misc_feature 1256..1327 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35348.2); transmembrane region" misc_feature 1352..1423 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="non-experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35348.2); transmembrane region" misc_feature 1436..1483 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /experiment="experimental evidence, no additional details recorded" /note="propagated from UniProtKB/Swiss-Prot (P35348.2); Region: Nuclear localization signal" variation 898 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /replace="c" /replace="g" /db_xref="dbSNP:2229124" variation 1035 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /replace="g" /replace="t" /db_xref="dbSNP:2229125" variation 1175 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /replace="a" /replace="g" /db_xref="dbSNP:3730287" exon 1320..1705 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="alignment:Splign:1.39.8" variation 1475 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /replace="c" /replace="t" /db_xref="dbSNP:1048101" variation 1562 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /replace="c" /replace="g" /db_xref="dbSNP:1496121" variation 1677 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /replace="a" /replace="g" /db_xref="dbSNP:3730247" exon 1706..2089 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /inference="alignment:Splign:1.39.8" STS 1800..2010 /gene="ADRA1A" /gene_synonym="ADRA1C; ADRA1L1; ALPHA1AAR" /standard_name="SGC35558" /db_xref="UniSTS:34325" ORIGIN
gaattccgaatcatgtgcagaatgctgaatcttcccccagccaggacgaataagacagcgcggaaaagcagattctcgtaattctggaattgcatgttgcaaggagtctcctggatcttcgcacccagcttcgggtagggagggagtccgggtcccgggctaggccagcccggcaggtggagagggtccccggcagccccgcgcgcccctggccatgtctttaatgccctgccccttcatgtggccttctgagggttcccagggctggccagggttgtttcccacccgcgcgcgcgctctcacccccagccaaacccacctggcagggctccctccagccgagaccttttgattcccggctcccgcgctcccgcctccgcgccagcccgggaggtggccctggacagccggacctcgcccggccccggctgggaccatggtgtttctctcgggaaatgcttccgacagctccaactgcacccaaccgccggcaccggtgaacatttccaaggccattctgctcggggtgatcttggggggcctcattcttttcggggtgctgggtaacatcctagtgatcctctccgtagcctgtcaccgacacctgcactcagtcacgcactactacatcgtcaacctggcggtggccgacctcctgctcacctccacggtgctgcccttctccgccatcttcgaggtcctaggctactgggccttcggcagggtcttctgcaacatctgggcggcagtggatgtgctgtgctgcaccgcgtccatcatgggcctctgcatcatctccatcgaccgctacatcggcgtgagctacccgctgcgctacccaaccatcgtcacccagaggaggggtctcatggctctgctctgcgtctgggcactctccctggtcatatccattggacccctgttcggctggaggcagccggcccccgaggacgagaccatctgccagatcaacgaggagccgggctacgtgctcttctcagcgctgggctccttctacctgcctctggccatcatcctggtcatgtactgccgcgtctacgtggtggccaagagggagagccggggcctcaagtctggcctcaagaccgacaagtcggactcggagcaagtgacgctccgcatccatcggaaaaacgccccggcaggaggcagcgggatggccagcgccaagaccaagacgcacttctcagtgaggctcctcaagttctcccgggagaagaaagcggccaaaacgctgggcatcgtggtcggctgcttcgtcctctgctggctgccttttttcttagtcatgcccattgggtctttcttccctgatttcaagccctctgaaacagtttttaaaatagtattttggctcggatatctaaacagctgcatcaaccccatcatatacccatgctccagccaagagttcaaaaaggcctttcagaatgtcttgagaatccagtgtctctgcagaaagcagtcttccaaacatgccctgggctacaccctgcacccgcccagccaggccgtggaagggcaacacaaggacatggtgcgcatccccgtgggatcaagagagaccttctacaggatctccaagacggatggcgtttgtgaatggaaatttttctcttccatgccccgtggatctgccaggattacagtgtccaaagaccaatcctcctgtaccacagcccggggacacacacccatgacatgaagccagcttcccgtccacgactgttgtccttactgcccaaggaaggggagcatgaaacccaccactggtcctgcgacccactgtctttggaatccaccccaggagcccaggagccttgcctgacacttggatttacttctttatcaagcatccatctgactaaggcacaaatccaacatgttactgttactgatacaggaaaaacagtaacttaaggaatgatcatgaatgcaaagggaaagaggaaaagagccttcagggacaaatagctcgattttttgtaaatcagtttcatacaacctccctcccccatttcattcttaaaagttaattgagaatcatcagccacgtgtagggtgtgag
//
ANNOTATIONS from NCBI Entrez Gene (20130726): GeneID:148 -> Molecular function: GO:0004937 [alpha1-adrenergic receptor activity] evidence: ISS GeneID:148 -> Molecular function: GO:0004937 [alpha1-adrenergic receptor activity] evidence: NAS GeneID:148 -> Molecular function: GO:0004937 [alpha1-adrenergic receptor activity] evidence: TAS GeneID:148 -> Molecular function: GO:0046982 [protein heterodimerization activity] evidence: IDA GeneID:148 -> Biological process: GO:0001985 [negative regulation of heart rate involved in baroreceptor response to increased systemic arterial blood pressure] evidence: IEA GeneID:148 -> Biological process: GO:0001994 [norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure] evidence: IEA GeneID:148 -> Biological process: GO:0001996 [positive regulation of heart rate by epinephrine-norepinephrine] evidence: IEA GeneID:148 -> Biological process: GO:0001997 [positive regulation of the force of heart contraction by epinephrine-norepinephrine] evidence: IEA GeneID:148 -> Biological process: GO:0003084 [positive regulation of systemic arterial blood pressure] evidence: IEA GeneID:148 -> Biological process: GO:0006915 [apoptotic process] evidence: TAS GeneID:148 -> Biological process: GO:0006939 [smooth muscle contraction] evidence: TAS GeneID:148 -> Biological process: GO:0006950 [response to stress] evidence: ISS GeneID:148 -> Biological process: GO:0007165 [signal transduction] evidence: TAS GeneID:148 -> Biological process: GO:0007186 [G-protein coupled receptor signaling pathway] evidence: TAS GeneID:148 -> Biological process: GO:0007200 [phospholipase C-activating G-protein coupled receptor signaling pathway] evidence: IEA GeneID:148 -> Biological process: GO:0007202 [activation of phospholipase C activity] evidence: ISS GeneID:148 -> Biological process: GO:0007204 [elevation of cytosolic calcium ion concentration] evidence: ISS GeneID:148 -> Biological process: GO:0007243 [intracellular protein kinase cascade] evidence: TAS GeneID:148 -> Biological process: GO:0007267 [cell-cell signaling] evidence: TAS GeneID:148 -> Biological process: GO:0007512 [adult heart development] evidence: IEA GeneID:148 -> Biological process: GO:0007568 [aging] evidence: ISS GeneID:148 -> Biological process: GO:0008285 [negative regulation of cell proliferation] evidence: TAS GeneID:148 -> Biological process: GO:0009725 [response to hormone stimulus] evidence: ISS GeneID:148 -> Biological process: GO:0016049 [cell growth] evidence: IEA GeneID:148 -> Biological process: GO:0032229 [negative regulation of synaptic transmission, GABAergic] evidence: ISS GeneID:148 -> Biological process: GO:0035024 [negative regulation of Rho protein signal transduction] evidence: ISS GeneID:148 -> Biological process: GO:0035265 [organ growth] evidence: IEA GeneID:148 -> Biological process: GO:0042493 [response to drug] evidence: ISS GeneID:148 -> Biological process: GO:0043410 [positive regulation of MAPK cascade] evidence: IDA GeneID:148 -> Biological process: GO:0045760 [positive regulation of action potential] evidence: ISS GeneID:148 -> Biological process: GO:0045907 [positive regulation of vasoconstriction] evidence: ISS GeneID:148 -> Biological process: GO:0045987 [positive regulation of smooth muscle contraction] evidence: IEA GeneID:148 -> Biological process: GO:0060073 [micturition] evidence: IEA GeneID:148 -> Biological process: GO:0060402 [calcium ion transport into cytosol] evidence: ISS GeneID:148 -> Biological process: GO:0060452 [positive regulation of cardiac muscle contraction] evidence: ISS GeneID:148 -> Biological process: GO:0070374 [positive regulation of ERK1 and ERK2 cascade] evidence: ISS GeneID:148 -> Biological process: GO:0090037 [positive regulation of protein kinase C signaling cascade] evidence: ISS GeneID:148 -> Biological process: GO:0097195 [pilomotor reflex] evidence: IEA GeneID:148 -> Cellular component: GO:0005634 [nucleus] evidence: IDA GeneID:148 -> Cellular component: GO:0005886 [plasma membrane] evidence: TAS GeneID:148 -> Cellular component: GO:0005887 [integral to plasma membrane] evidence: TAS GeneID:148 -> Cellular component: GO:0030018 [Z disc] evidence: IEA GeneID:148 -> Cellular component: GO:0030315 [T-tubule] evidence: IEA GeneID:148 -> Cellular component: GO:0031965 [nuclear membrane] evidence: IDA
by
@meso_cacase at
DBCLS
This page is licensed under a Creative Commons Attribution 2.1 Japan License.